siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs, Sidirect 185   195   218   251   421   474   485   562   628   682   770   778   780   781   789   795   874   1037   1040   1047  
1048   1265   1524   1557   1558   1562   1570   1584   1593   1636   1650   1685   1686   1729   1732   1733   1743  
Biltr, Ernai, Rnaxs 216   466   563   767  
Biltr, Rnaxs 2   19   157   158   159   160   163   164   178   180   181   182   183   184   194   196   215   217   219   247  
248   249   250   252   255   256   257   258   279   291   292   293   294   295   296   297   301   302   303   333  
334   335   344   357   358   367   368   380   381   387   395   402   405   406   407   408   409   410   411   412  
413   414   415   416   417   419   420   422   434   435   441   442   443   444   447   448   449   453   454   455  
456   457   460   461   462   463   464   465   467   468   469   472   473   475   477   484   486   491   492   494  
498   499   500   503   504   506   509   510   512   513   518   519   551   552   553   556   557   558   564   565  
582   583   584   585   586   587   588   589   604   605   626   627   629   630   636   637   638   639   651   652  
653   655   656   657   658   659   660   661   662   663   666   667   668   670   671   676   677   678   681   683  
707   708   711   718   719   720   721   722   725   726   728   729   734   739   742   743   765   766   769   771  
776   777   779   782   783   784   785   786   790   791   794   799   800   801   802   803   804   811   820   821  
822   823   824   825   826   854   855   866   867   873   875   876   881   887   888   926   927   928   929   930  
933   934   935   936   937   941   942   943   944   946   947   948   949   950   951   952   953   956   957   958  
975   976   977   978   1007   1008   1011   1012   1024   1032   1033   1034   1035   1036   1038   1039   1045   1046   1053   1059  
1084   1085   1086   1087   1114   1117   1145   1146   1147   1148   1159   1227   1228   1229   1231   1245   1246   1247   1249   1250  
1253   1254   1255   1256   1257   1258   1259   1260   1264   1267   1304   1305   1308   1337   1338   1339   1340   1341   1344   1345  
1346   1348   1349   1350   1351   1352   1362   1363   1364   1366   1372   1373   1374   1375   1376   1378   1379   1383   1385   1397  
1398   1399   1404   1421   1422   1423   1424   1426   1427   1448   1452   1453   1454   1455   1456   1459   1460   1461   1462   1466  
1467   1468   1473   1474   1480   1481   1482   1486   1487   1488   1492   1493   1506   1507   1508   1510   1511   1512   1513   1519  
1520   1525   1548   1549   1550   1551   1552   1553   1554   1555   1556   1559   1560   1561   1563   1565   1568   1569   1571   1572  
1573   1574   1581   1582   1583   1585   1586   1587   1588   1589   1590   1591   1592   1594   1595   1596   1607   1612   1613   1614  
1615   1616   1617   1623   1631   1635   1644   1645   1649   1651   1652   1657   1661   1662   1676   1677   1679   1680   1681   1682  
1684   1687   1688   1693   1694   1697   1720   1721   1724   1725   1728   1730   1731   1734   1735   1736   1737   1738   1739   1744  
1745   1746   1748   1749   1750   1751   1753   1754   1755   1756   1757   1761   1762   1770   1771   1772   1773  
Biltr, Ernai, Rnaxs, Sidirect 253   476   505   1447   1564   1683  
Biltr, Sidirect 210   372   373   478   489   631   687   1043   1234   1236   1251   1261   1309   1314   1414   1446   1620   1627   1646   1655  
1723  


Target Position: 1467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1467GGAUCAACCUUAAAGGAAA100.7439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2011485GGATCAACCTTAAAGGAAATTTCCTTTAAGGTTGATCC0.177300.046100.870701.000000.989100.87500


Target Position: 604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
604UUCCCACAGCAAUGCACAU68.85081031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
407622TTCCCACAGCAATGCACATATGTGCATTGCTGTGGGAA0.046100.004000.517200.500000.972800.75000


Target Position: 1753, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1753AAAUACAUUUAUAAAAUAA94.714555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031771AAATACATTTATAAAATAATTATTTTATAAATGTATTT0.698800.125900.465500.500001.000001.00000


Target Position: 551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
551ACCUGUGCAUCCCAACGAU78.4132596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
387569ACCTGTGCATCCCAACGATATCGTTGGGATGCACAGGT0.284500.004700.672400.750000.978300.62500


Target Position: 387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
387GCAAUAAUGAAGGCAGCAG68.93551027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313405GCAATAATGAAGGCAGCAGCTGCTGCCTTCATTATTGC0.182200.015300.569000.750001.000001.00000


Target Position: 1487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1487UGCUAUCGAACUUGGCUAU71.9622895

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4181505TGCTATCGAACTTGGCTATATAGCCAAGTTCGATAGCA0.066500.003700.810300.750001.000001.00000


Target Position: 1426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1426AUGACAAGGCAGCAAAGAU80.0267530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4801444ATGACAAGGCAGCAAAGATATCTTTGCTGCCTTGTCAT0.226600.007100.474100.500001.000001.00000


Target Position: 442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
442CUCUCGUGGUAUGGCAGAC65.71571185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
460460CTCTCGTGGTATGGCAGACGTCTGCCATACCACGAGAG0.038800.011100.491400.500001.000001.00000


Target Position: 255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
255UCUACGAUGAACUUUAAGA77.1741651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
408273TCTACGATGAACTTTAAGATCTTAAAGTTCATCGTAGA0.100300.045100.500000.500001.000001.00000


Target Position: 485, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
485GAAUGUAAAUGAAGUCAUU95.842538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
436503GAATGTAAATGAAGTCATTAATGACTTCATTTACATTC0.029900.015600.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
483-505ATGAATGTAAATGAAGTCATTAGAAUGACUUCAUUUACAUUCAUGAAUGUAAAUGAAGUCAUUAGU19.26.922


Target Position: 506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
506CAAUAGAGCAAUUGAAAUG77.9456616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
450524CAATAGAGCAATTGAAATGCATTTCAATTGCTCTATTG0.095900.062300.491400.500001.000001.00000


Target Position: 415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
415CUGAAGGUAAAUUAAAUGA81.1592478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
409433CTGAAGGTAAATTAAATGATCATTTAATTTACCTTCAG0.326000.146800.560300.500001.000001.00000


Target Position: 1662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1662UGAACUUAAGCAUCUCUAG70.3463978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4561680TGAACTTAAGCATCTCTAGCTAGAGATGCTTAAGTTCA0.025100.002500.551700.500001.000001.00000


Target Position: 258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
258ACGAUGAACUUUAAGAUUG68.0181071

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
472276ACGATGAACTTTAAGATTGCAATCTTAAAGTTCATCGT0.021000.010700.629300.500001.000001.00000


Target Position: 944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
944UUUUGUCACUGCUCCGAAU73.4197824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482962TTTTGTCACTGCTCCGAATATTCGGAGCAGTGACAAAA0.055200.036400.491400.500001.000001.00000


Target Position: 1117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1117AACCAGGAAGCAGUAUCAU73.3898825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941135AACCAGGAAGCAGTATCATATGATACTGCTTCCTGGTT0.013700.002600.491400.500001.000001.00000


Target Position: 682, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
682CUCUUGAUGCAAAAUCCAA88.5595194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
450700CTCTTGATGCAAAATCCAATTGGATTTTGCATCAAGAG0.134400.002700.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
680-702TGCTCTTGATGCAAAATCCAAAGUUGGAUUUUGCAUCAAGAGCACUCUUGAUGCAAAAUCCAAAGU20.120.422


Target Position: 947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
947UGUCACUGCUCCGAAUAAA81.5009468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
346965TGTCACTGCTCCGAATAAATTTATTCGGAGCAGTGACA0.071400.026000.706900.750001.000001.00000


Target Position: 1427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1427UGACAAGGCAGCAAAGAUU77.3165642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101445TGACAAGGCAGCAAAGATTAATCTTTGCTGCCTTGTCA0.043000.004000.715500.750001.000001.00000


Target Position: 1525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1525ACGAAUGGGUAAAACCUAA85.2145301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4621543ACGAATGGGTAAAACCTAATTAGGTTTTACCCATTCGT0.022200.002400.741400.750000.967400.87500


Target Position: 1697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1697GUAUAUAAAACCCUAGGAU86.3072265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4201715GTATATAAAACCCTAGGATATCCTAGGGTTTTATATAC0.035400.032400.500000.750001.000001.00000


Target Position: 659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
659AGGACUACAGAAGUUACAU80.8371493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
234677AGGACTACAGAAGTTACATATGTAACTTCTGTAGTCCT0.145500.020500.689700.750001.000001.00000


Target Position: 605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
605UCCCACAGCAAUGCACAUU59.67221401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
488623TCCCACAGCAATGCACATTAATGTGCATTGCTGTGGGA0.015000.002900.862100.750000.972800.75000


Target Position: 1734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1734AUUAAACAAGUAUAAAAUA86.3499260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971752ATTAAACAAGTATAAAATATATTTTATACTTGTTTAAT0.335300.287800.465500.500001.000001.00000


Target Position: 1550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1550GCUGGGUCCAAAGUGAUUU73.5071820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3301568GCTGGGTCCAAAGTGATTTAAATCACTTTGGACCCAGC0.262900.007900.853401.000001.000001.00000


Target Position: 291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
291CGCAUGCCAACCCCAGUUA78.604584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
498309CGCATGCCAACCCCAGTTATAACTGGGGTTGGCATGCG0.125800.001100.887901.000001.000001.00000


Target Position: 1635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1635CGGAUAAGUUUGAAAGGAA98.224920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411653CGGATAAGTTTGAAAGGAATTCCTTTCAAACTTATCCG0.083400.002900.741401.000001.000001.00000


Target Position: 1147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1147UGAACCCUACUCAGUGUGA74.8552758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771165TGAACCCTACTCAGTGTGATCACACTGAGTAGGGTTCA0.058300.010500.500000.500000.994600.87500


Target Position: 1385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1385GUCUCUAAUGUUGGUGACA81.5345466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421403GTCTCTAATGTTGGTGACATGTCACCAACATTAGAGAC0.028100.004700.612100.500001.000001.00000


Target Position: 417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
417GAAGGUAAAUUAAAUGAUC81.1166482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
462435GAAGGTAAATTAAATGATCGATCATTTAATTTACCTTC0.302300.095400.491400.500001.000001.00000


Target Position: 1304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1304GGAUGCUUCAGUUUCCUUU83.0527392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031322GGATGCTTCAGTTTCCTTTAAAGGAAACTGAAGCATCC0.019300.001000.870701.000001.000001.00000


Target Position: 1422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1422GGGUAUGACAAGGCAGCAA88.4256198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4561440GGGTATGACAAGGCAGCAATTGCTGCCTTGTCATACCC0.023100.002700.844801.000001.000001.00000


Target Position: 934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
934CAGGCUUGCCUUUUGUCAC70.1325984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
458952CAGGCTTGCCTTTTGTCACGTGACAAAAGGCAAGCCTG0.188000.004200.491400.500000.918500.62500


Target Position: 1559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1559AAAGUGAUUUACAUAAAUU87.3807233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4451577AAAGTGATTTACATAAATTAATTTATGTAAATCACTTT0.076600.047100.491400.500001.000001.00000


Target Position: 412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
412UAGCUGAAGGUAAAUUAAA82.6531410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
390430TAGCTGAAGGTAAATTAAATTTAATTTACCTTCAGCTA0.396400.030600.672400.500001.000001.00000


Target Position: 1680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1680GCAGAGCAAUUUGAUCAGU76.8593668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2471698GCAGAGCAATTTGATCAGTACTGATCAAATTGCTCTGC0.203300.017100.646600.750001.000001.00000


Target Position: 1309, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1309CUUCAGUUUCCUUUACAGA83.7899363

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1307-1329TGCTTCAGTTTCCTTTACAGAAAUCUGUAAAGGAAACUGAAGCACUUCAGUUUCCUUUACAGAAAU11.819.202


Target Position: 1228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1228GCAAUGGACAUUUUGAGUU78.0703612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111246GCAATGGACATTTTGAGTTAACTCAAAATGTCCATTGC0.039100.009700.706901.000001.000001.00000


Target Position: 942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
942CCUUUUGUCACUGCUCCGA71.5639922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
375960CCTTTTGTCACTGCTCCGATCGGAGCAGTGACAAAAGG0.054100.038100.551700.750001.000001.00000


Target Position: 182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
182CCGGAUAGAAUAUGAUACC67.30251110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
478200CCGGATAGAATATGATACCGGTATCATATTCTATCCGG0.182800.014100.560300.500001.000001.00000


Target Position: 1627, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1627CUUAAAAACGGAUAAGUUU79.7767534

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1625-1647TTCTTAAAAACGGATAAGTTTGAAAACUUAUCCGUUUUUAAGAACUUAAAAACGGAUAAGUUUGAU4.6-9.132


Target Position: 1340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1340GGGAAUCCAGGCCAAUACA86.077277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3651358GGGAATCCAGGCCAATACATGTATTGGCCTGGATTCCC0.107000.005700.784500.750001.000001.00000


Target Position: 1721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1721AGGUCUAAGAUGGAUUAAA87.792222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
861739AGGTCTAAGATGGATTAAATTTAATCCATCTTAGACCT0.405000.111500.844800.750001.000001.00000


Target Position: 372, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
372CCAAAGAUUGCUAAUGCAA88.1376205

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
370-392ATCCAAAGATTGCTAATGCAATAUUGCAUUAGCAAUCUUUGGAUCCAAAGAUUGCUAAUGCAAUAU21.112.033


Target Position: 472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472CUCAGACAAAUAUGAAUGU75.5917727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
395490CTCAGACAAATATGAATGTACATTCATATTTGTCTGAG0.107600.045400.603400.500001.000001.00000


Target Position: 381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
381GCUAAUGCAAUAAUGAAGG62.75941301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
388399GCTAATGCAATAATGAAGGCCTTCATTATTGCATTAGC0.529100.014900.508600.500001.000001.00000


Target Position: 1260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1260CCAAUGAUGAUUAAAAAUG70.1383983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1351278CCAATGATGATTAAAAATGCATTTTTAATCATCATTGG0.463900.093900.689700.750001.000001.00000


Target Position: 183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
183CGGAUAGAAUAUGAUACCU84.2547343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
343201CGGATAGAATATGATACCTAGGTATCATATTCTATCCG0.072600.013500.569000.750001.000001.00000


Target Position: 1617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1617ACUCCCAUUUCUUAAAAAC65.34481203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301635ACTCCCATTTCTTAAAAACGTTTTTAAGAAATGGGAGT0.167400.052900.560300.500001.000001.00000


Target Position: 373, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
373CAAAGAUUGCUAAUGCAAU88.0921206

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
371-393TCCAAAGATTGCTAATGCAATAAAUUGCAUUAGCAAUCUUUGGACAAAGAUUGCUAAUGCAAUAAU20.05.332


Target Position: 822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
822GCUGCCAUGCCAAGAAUCU74.246789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
297840GCTGCCATGCCAAGAATCTAGATTCTTGGCATGGCAGC0.177200.011300.629300.750001.000001.00000


Target Position: 1339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1339UGGGAAUCCAGGCCAAUAC58.95151428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241357TGGGAATCCAGGCCAATACGTATTGGCCTGGATTCCCA0.092800.003600.663800.500000.951100.62500


Target Position: 1344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1344AUCCAGGCCAAUACAGAAA75.3669736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711362ATCCAGGCCAATACAGAAATTTCTGTATTGGCCTGGAT0.458300.022200.681000.500001.000001.00000


Target Position: 1383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1383GAGUCUCUAAUGUUGGUGA90.7919132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921401GAGTCTCTAATGTTGGTGATCACCAACATTAGAGACTC0.014100.002000.586200.500001.000001.00000


Target Position: 252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
252AGAUCUACGAUGAACUUUA93.80172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
241270AGATCTACGATGAACTTTATAAAGTTCATCGTAGATCT0.579700.075900.689700.750001.000001.00000


Target Position: 441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
441CCUCUCGUGGUAUGGCAGA73.247831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482459CCTCTCGTGGTATGGCAGATCTGCCATACCACGAGAGG0.060800.001600.620700.750001.000001.00000


Target Position: 953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
953UGCUCCGAAUAAAUUUGAA81.0972484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
270971TGCTCCGAATAAATTTGAATTCAAATTTATTCGGAGCA0.115200.018600.681000.750001.000001.00000


Target Position: 484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
484UGAAUGUAAAUGAAGUCAU76.5551681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
430502TGAATGTAAATGAAGTCATATGACTTCATTTACATTCA0.032100.018800.569000.750001.000001.00000


Target Position: 256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
256CUACGAUGAACUUUAAGAU87.6883223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
459274CTACGATGAACTTTAAGATATCTTAAAGTTCATCGTAG0.062500.027700.491400.750001.000001.00000


Target Position: 1688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1688AUUUGAUCAGUAUAUAAAA91.6025113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3871706ATTTGATCAGTATATAAAATTTTATATACTGATCAAAT0.322200.130700.508600.500001.000001.00000


Target Position: 556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
556UGCAUCCCAACGAUCAUGU60.35821384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
410574TGCATCCCAACGATCATGTACATGATCGTTGGGATGCA0.208100.047500.646600.500000.951100.87500


Target Position: 1227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1227AGCAAUGGACAUUUUGAGU72.3795874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791245AGCAATGGACATTTTGAGTACTCAAAATGTCCATTGCT0.059600.002500.646600.500001.000001.00000


Target Position: 467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
467AGGAACUCAGACAAAUAUG69.72991006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
335485AGGAACTCAGACAAATATGCATATTTGTCTGAGTTCCT0.213000.050000.689700.500001.000001.00000


Target Position: 1053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053GAUAUUCGAUUUUUGGGUU81.6905458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4061071GATATTCGATTTTTGGGTTAACCCAAAAATCGAATATC0.040100.026400.534500.750001.000001.00000


Target Position: 874, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
874CAGGUUUAAAUACUAGAAU82.6905408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
117892CAGGTTTAAATACTAGAATATTCTAGTATTTAAACCTG0.282400.146800.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
872-894TACAGGTTTAAATACTAGAATTGAUUCUAGUAUUUAAACCUGUACAGGUUUAAAUACUAGAAUUGU18.918.621


Target Position: 1492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1492UCGAACUUGGCUAUCUCAC53.48361585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691510TCGAACTTGGCTATCTCACGTGAGATAGCCAAGTTCGA0.090200.037500.500000.500001.000001.00000


Target Position: 357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
357GAUUAUGGUCUUGAUCCAA93.892470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
502375GATTATGGTCTTGATCCAATTGGATCAAGACCATAATC0.023000.001000.534500.750000.956500.62500


Target Position: 519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
519GAAAUGUUAGGAGGUGAAC67.38991104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484537GAAATGTTAGGAGGTGAACGTTCACCTCCTAACATTTC0.016600.007100.525900.500001.000001.00000


Target Position: 1249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1249AUGUUUUCAAGCCAAUGAU72.0885890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4751267ATGTTTTCAAGCCAATGATATCATTGGCTTGAAAACAT0.072700.003400.474100.500000.967400.62500


Target Position: 1229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1229CAAUGGACAUUUUGAGUUG78.984568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241247CAATGGACATTTTGAGTTGCAACTCAAAATGTCCATTG0.034800.022000.500000.500001.000001.00000


Target Position: 1008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1008GGAGCCAUGAACACUACUG75.3968735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3011026GGAGCCATGAACACTACTGCAGTAGTGTTCATGGCTCC0.443000.042400.586200.750001.000001.00000


Target Position: 780, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
780GGUUAUGUUCAACAAGUAA98.877217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
241798GGTTATGTTCAACAAGTAATTACTTGTTGAACATAACC0.309700.019300.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
778-800GTGGTTATGTTCAACAAGTAAAAUUACUUGUUGAACAUAACCACGGUUAUGUUCAACAAGUAAAAU19.014.632


Target Position: 335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
335AGCGGCCGCUGAAGUAAAC60.66561373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364353AGCGGCCGCTGAAGTAAACGTTTACTTCAGCGGCCGCT0.291800.012500.706900.500000.934800.62500


Target Position: 1337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1337GGUGGGAAUCCAGGCCAAU77.4381636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4881355GGTGGGAATCCAGGCCAATATTGGCCTGGATTCCCACC0.080900.001400.844801.000000.918500.75000


Target Position: 1043, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1043GAUAGCAAAUGAUAUUCGA90.0338157

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1041-1063AAGATAGCAAATGATATTCGATTUCGAAUAUCAUUUGCUAUCUUGAUAGCAAAUGAUAUUCGAUUU8.819.723


Target Position: 1348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1348AGGCCAAUACAGAAAGGAU86.6909251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2881366AGGCCAATACAGAAAGGATATCCTTTCTGTATTGGCCT0.109100.012200.663800.750001.000001.00000


Target Position: 1607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1607AAAAAAACAGACUCCCAUU79.6568539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4561625AAAAAAACAGACTCCCATTAATGGGAGTCTGTTTTTTT0.228900.196700.491400.500001.000001.00000


Target Position: 867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
867GUUGGUACAGGUUUAAAUA93.236780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
290885GTTGGTACAGGTTTAAATATATTTAAACCTGTACCAAC0.258000.011800.603400.750001.000001.00000


Target Position: 279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
279GGUGUGACAGAACGCAUGC66.7541133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
493297GGTGTGACAGAACGCATGCGCATGCGTTCTGTCACACC0.014100.009100.500000.500001.000001.00000


Target Position: 1507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1507UCACAGCAGAGCAGUUUGA73.7336807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341525TCACAGCAGAGCAGTTTGATCAAACTGCTCTGCTGTGA0.031500.003900.500000.500000.978300.75000


Target Position: 1481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1481GGAAACUGCUAUCGAACUU82.7141406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3481499GGAAACTGCTATCGAACTTAAGTTCGATAGCAGTTTCC0.309200.006700.732801.000001.000001.00000


Target Position: 344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
344UGAAGUAAACCAGGAUUAU75.729720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
446362TGAAGTAAACCAGGATTATATAATCCTGGTTTACTTCA0.026400.006900.681000.750001.000001.00000


Target Position: 216, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
216GUGCCAAAUGAUAAGUAUU86.1581271

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_521619GTGCCAAATGATAAGTATT1/1/0/094.96FHNM_000143.21NANANA1:241680547..241680565(-)00FH(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
355234GTGCCAAATGATAAGTATTAATACTTATCATTTGGCAC0.087100.006300.784500.750001.000001.00000


Target Position: 587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
587GAGCUCAAAUGAUACUUUU88.4854196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
226605GAGCTCAAATGATACTTTTAAAAGTATCATTTGAGCTC0.163000.062400.810300.750001.000001.00000


Target Position: 462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
462GGAUCAGGAACUCAGACAA98.669418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
263480GGATCAGGAACTCAGACAATTGTCTGAGTTCCTGATCC0.206800.015100.724101.000001.000001.00000


Target Position: 1338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1338GUGGGAAUCCAGGCCAAUA86.1565272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381356GTGGGAATCCAGGCCAATATATTGGCCTGGATTCCCAC0.094500.003000.750000.750000.918500.62500


Target Position: 421, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
421GUAAAUUAAAUGAUCAUUU82.1712432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
263439GTAAATTAAATGATCATTTAAATGATCATTTAATTTAC0.122600.091300.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
419-441AGGTAAATTAAATGATCATTTTCAAAUGAUCAUUUAAUUUACCUGUAAAUUAAAUGAUCAUUUUCU16.2-7.522


Target Position: 552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
552CCUGUGCAUCCCAACGAUC67.46921095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
261570CCTGTGCATCCCAACGATCGATCGTTGGGATGCACAGG0.276900.015200.663800.750000.951100.62500


Target Position: 1345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1345UCCAGGCCAAUACAGAAAG53.30571590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3761363TCCAGGCCAATACAGAAAGCTTTCTGTATTGGCCTGGA0.359400.028400.732800.500001.000001.00000


Target Position: 513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
513GCAAUUGAAAUGUUAGGAG73.0508840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
421531GCAATTGAAATGTTAGGAGCTCCTAACATTTCAATTGC0.035300.018900.543100.750001.000001.00000


Target Position: 943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
943CUUUUGUCACUGCUCCGAA86.3315263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
493961CTTTTGTCACTGCTCCGAATTCGGAGCAGTGACAAAAG0.057500.040200.465500.750001.000001.00000


Target Position: 1574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1574AAUUUAUAAUGAAAAUAAA95.938136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4651592AATTTATAATGAAAATAAATTTATTTTCATTATAAATT0.828500.042600.508600.500001.000001.00000


Target Position: 1456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1456CACACAAAAAUGGAUCAAC70.9553955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3411474CACACAAAAATGGATCAACGTTGATCCATTTTTGTGTG0.170300.151700.646600.500001.000001.00000


Target Position: 1620, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1620CCCAUUUCUUAAAAACGGA78.5943585

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1618-1640CTCCCATTTCTTAAAAACGGATAUCCGUUUUUAAGAAAUGGGAGCCCAUUUCUUAAAAACGGAUAU19.420.122


Target Position: 296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
296GCCAACCCCAGUUAUUAAA79.6994537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
166314GCCAACCCCAGTTATTAAATTTAATAACTGGGGTTGGC0.210000.064701.000001.000001.000001.00000


Target Position: 1493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1493CGAACUUGGCUAUCUCACA91.8923107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3041511CGAACTTGGCTATCTCACATGTGAGATAGCCAAGTTCG0.099100.022000.586200.750001.000001.00000


Target Position: 662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
662ACUACAGAAGUUACAUGAU82.2153430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
375680ACTACAGAAGTTACATGATATCATGTAACTTCTGTAGT0.226400.052300.525900.750001.000001.00000


Target Position: 875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
875AGGUUUAAAUACUAGAAUU89.0823184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
242893AGGTTTAAATACTAGAATTAATTCTAGTATTTAAACCT0.263000.144000.836200.750001.000001.00000


Target Position: 1145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1145GGUGAACCCUACUCAGUGU87.2977235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3761163GGTGAACCCTACTCAGTGTACACTGAGTAGGGTTCACC0.053000.010800.646600.750000.983700.75000


Target Position: 478, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
478CAAAUAUGAAUGUAAAUGA93.171784

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
476-498GACAAATATGAATGTAAATGAAGUCAUUUACAUUCAUAUUUGUCCAAAUAUGAAUGUAAAUGAAGU6.9-1.822


Target Position: 413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
413AGCUGAAGGUAAAUUAAAU89.757166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
209431AGCTGAAGGTAAATTAAATATTTAATTTACCTTCAGCT0.338700.028400.844800.750001.000001.00000


Target Position: 1524, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1524GACGAAUGGGUAAAACCUA91.8993106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901542GACGAATGGGTAAAACCTATAGGTTTTACCCATTCGTC0.014600.002400.646600.750000.967400.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1522-1544TTGACGAATGGGTAAAACCTAAGUAGGUUUUACCCAUUCGUCAAGACGAAUGGGUAAAACCUAAGU17.321.131


Target Position: 1258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258AGCCAAUGAUGAUUAAAAA95.078752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1331276AGCCAATGATGATTAAAAATTTTTAATCATCATTGGCT0.629200.087700.853400.750001.000001.00000


Target Position: 1372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1372AGCUGAUGAAUGAGUCUCU82.124434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741390AGCTGATGAATGAGTCTCTAGAGACTCATTCATCAGCT0.020300.002800.629300.500001.000001.00000


Target Position: 1159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159AGUGUGAAGCAAUGACCAU83.1388388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641177AGTGTGAAGCAATGACCATATGGTCATTGCTTCACACT0.024700.002200.551700.750001.000001.00000


Target Position: 1558, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1558CAAAGUGAUUUACAUAAAU90.1813153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3001576CAAAGTGATTTACATAAATATTTATGTAAATCACTTTG0.102400.059500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1556-1578TCCAAAGTGATTTACATAAATTTAUUUAUGUAAAUCACUUUGGACAAAGUGAUUUACAUAAAUUUU6.919.222


Target Position: 929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
929ACUUACAGGCUUGCCUUUU63.63171267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
248947ACTTACAGGCTTGCCTTTTAAAAGGCAAGCCTGTAAGT0.133500.024000.706900.750000.918500.87500


Target Position: 866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
866UGUUGGUACAGGUUUAAAU79.626541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
306884TGTTGGTACAGGTTTAAATATTTAAACCTGTACCAACA0.247600.010600.698300.750001.000001.00000


Target Position: 1581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1581AAUGAAAAUAAACAUGUAU81.7217455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911599AATGAAAATAAACATGTATATACATGTTTATTTTCATT0.168600.076200.465500.500001.000001.00000


Target Position: 444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
444CUCGUGGUAUGGCAGACUG68.47351051

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
407462CTCGTGGTATGGCAGACTGCAGTCTGCCATACCACGAG0.039800.006800.525900.500001.000001.00000


Target Position: 500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
500CAUUAGCAAUAGAGCAAUU89.9765161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
275518CATTAGCAATAGAGCAATTAATTGCTCTATTGCTAATG0.299100.013500.646600.750000.929301.00000


Target Position: 1308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1308GCUUCAGUUUCCUUUACAG82.5174413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4251326GCTTCAGTTTCCTTTACAGCTGTAAAGGAAACTGAAGC0.095900.003600.569000.750001.000001.00000


Target Position: 1035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1035CUGAUGAAGAUAGCAAAUG63.48881274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3981053CTGATGAAGATAGCAAATGCATTTGCTATCTTCATCAG0.063400.004400.629300.500001.000001.00000


Target Position: 721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
721AGAUUGGACGUACUCAUAC71.692913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
449739AGATTGGACGTACTCATACGTATGAGTACGTCCAATCT0.103200.039200.543100.500001.000001.00000


Target Position: 1363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1363GGAUCAACAAGCUGAUGAA103.6834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3371381GGATCAACAAGCTGATGAATTCATCAGCTTGTTGATCC0.075600.007800.698301.000000.956500.62500


Target Position: 1731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1731UGGAUUAAACAAGUAUAAA83.6365369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2571749TGGATTAAACAAGTATAAATTTATACTTGTTTAATCCA0.386100.234300.844800.750001.000001.00000


Target Position: 937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
937GCUUGCCUUUUGUCACUGC65.16371207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
474955GCTTGCCTTTTGTCACTGCGCAGTGACAAAAGGCAAGC0.081200.001700.500000.500000.978300.75000


Target Position: 1755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1755AUACAUUUAUAAAAUAAAA90.656137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3421773ATACATTTATAAAATAAAATTTTATTTTATAAATGTAT0.778700.111500.543100.500001.000001.00000


Target Position: 1259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1259GCCAAUGAUGAUUAAAAAU83.3445380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
671277GCCAATGATGATTAAAAATATTTTTAATCATCATTGGC0.618100.133300.991401.000001.000001.00000


Target Position: 1459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1459ACAAAAAUGGAUCAACCUU74.8133763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3121477ACAAAAATGGATCAACCTTAAGGTTGATCCATTTTTGT0.182800.140300.569000.750000.962000.75000


Target Position: 295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
295UGCCAACCCCAGUUAUUAA85.0931306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
232313TGCCAACCCCAGTTATTAATTAATAACTGGGGTTGGCA0.200100.026300.819000.750001.000001.00000


Target Position: 1511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1511AGCAGAGCAGUUUGACGAA87.2552236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3071529AGCAGAGCAGTTTGACGAATTCGTCAAACTGCTCTGCT0.106600.010500.681000.750001.000001.00000


Target Position: 461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
461UGGAUCAGGAACUCAGACA76.7751671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
455479TGGATCAGGAACTCAGACATGTCTGAGTTCCTGATCCA0.209500.008900.637900.500001.000001.00000


Target Position: 476, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
476GACAAAUAUGAAUGUAAAU89.9922160

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_947619GACAAATATGAATGTAAAT1/1/0/093.97FHNM_000143.21NANANA9:30158650..30158668(+)|1:241675360..241675378(-)00FH(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
219494GACAAATATGAATGTAAATATTTACATTCATATTTGTC0.156300.058500.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
474-496CAGACAAATATGAATGTAAATGAAUUUACAUUCAUAUUUGUCUGGACAAAUAUGAAUGUAAAUGAU6.96.922


Target Position: 1565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1565AUUUACAUAAAUUUAUAAU76.5473682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121583ATTTACATAAATTTATAATATTATAAATTTATGTAAAT0.115500.046300.500000.500001.000001.00000


Target Position: 247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
247CCGUGAGAUCUACGAUGAA94.663256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
332265CCGTGAGATCTACGATGAATTCATCGTAGATCTCACGG0.253000.007800.741401.000000.978300.62500


Target Position: 1754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1754AAUACAUUUAUAAAAUAAA90.7789133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3911772AATACATTTATAAAATAAATTTATTTTATAAATGTATT0.784100.129600.508600.500001.000001.00000


Target Position: 663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
663CUACAGAAGUUACAUGAUG75.7799717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
383681CTACAGAAGTTACATGATGCATCATGTAACTTCTGTAG0.247500.054500.517200.500001.000001.00000


Target Position: 1549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1549UGCUGGGUCCAAAGUGAUU71.1119946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4141567TGCTGGGTCCAAAGTGATTAATCACTTTGGACCCAGCA0.323200.003800.844800.750001.000001.00000


Target Position: 1352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1352CAAUACAGAAAGGAUCAAC72.3732875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111370CAATACAGAAAGGATCAACGTTGATCCTTTCTGTATTG0.124700.066700.500000.500001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781GUUAUGUUCAACAAGUAAA89.6845167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
227799GTTATGTTCAACAAGTAAATTTACTTGTTGAACATAAC0.317700.022500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
779-801TGGTTATGTTCAACAAGTAAAATUUUACUUGUUGAACAUAACCAGUUAUGUUCAACAAGUAAAAUU11.86.932


Target Position: 419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
419AGGUAAAUUAAAUGAUCAU85.562290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
220437AGGTAAATTAAATGATCATATGATCATTTAATTTACCT0.186500.097600.689700.750001.000001.00000


Target Position: 1590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1590AAACAUGUAUAAAAUUUAA93.845771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901608AAACATGTATAAAATTTAATTAAATTTTATACATGTTT0.377900.184500.465500.500001.000001.00000


Target Position: 1257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257AAGCCAAUGAUGAUUAAAA89.8785164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4191275AAGCCAATGATGATTAAAATTTTAATCATCATTGGCTT0.315000.069800.637900.500001.000001.00000


Target Position: 1482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1482GAAACUGCUAUCGAACUUG72.3417877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3981500GAAACTGCTATCGAACTTGCAAGTTCGATAGCAGTTTC0.279700.004600.525900.500001.000001.00000


Target Position: 785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
785UGUUCAACAAGUAAAAUAU82.7966403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
262803TGTTCAACAAGTAAAATATATATTTTACTTGTTGAACA0.342600.178500.663800.750001.000001.00000


Target Position: 585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
585CAGAGCUCAAAUGAUACUU75.9989709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
228603CAGAGCTCAAATGATACTTAAGTATCATTTGAGCTCTG0.148700.054400.646600.750001.000001.00000


Target Position: 218, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
218GCCAAAUGAUAAGUAUUAU88.0463210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
439236GCCAAATGATAAGTATTATATAATACTTATCATTTGGC0.028800.012900.956901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
216-238GTGCCAAATGATAAGTATTATGGAUAAUACUUAUCAUUUGGCACGCCAAAUGAUAAGUAUUAUGGU6.317.733


Target Position: 927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
927GCACUUACAGGCUUGCCUU82.2459429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
354945GCACTTACAGGCTTGCCTTAAGGCAAGCCTGTAAGTGC0.065600.019700.715501.000000.918500.62500


Target Position: 1032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1032AGUCUGAUGAAGAUAGCAA92.517692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4601050AGTCTGATGAAGATAGCAATTGCTATCTTCATCAGACT0.022700.002700.560300.750001.000001.00000


Target Position: 583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
583GCCAGAGCUCAAAUGAUAC76.4651688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
254601GCCAGAGCTCAAATGATACGTATCATTTGAGCTCTGGC0.147400.016700.819000.750001.000001.00000


Target Position: 801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
801UAUGCAAUGACAAGAAUAA86.4222259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
393819TATGCAATGACAAGAATAATTATTCTTGTCATTGCATA0.596900.244300.508600.500001.000001.00000


Target Position: 1686, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1686CAAUUUGAUCAGUAUAUAA105.1511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2741704CAATTTGATCAGTATATAATTATATACTGATCAAATTG0.276400.150700.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1684-1706AGCAATTTGATCAGTATATAAAAUUAUAUACUGAUCAAAUUGCUCAAUUUGAUCAGUAUAUAAAAU2.87.422


Target Position: 670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
670AGUUACAUGAUGCUCUUGA80.1914523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471688AGTTACATGATGCTCTTGATCAAGAGCATCATGTAACT0.048400.006500.482800.500001.000001.00000


Target Position: 297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
297CCAACCCCAGUUAUUAAAG64.42621231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
345315CCAACCCCAGTTATTAAAGCTTTAATAACTGGGGTTGG0.071900.025100.706900.750001.000001.00000


Target Position: 1261, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1261CAAUGAUGAUUAAAAAUGU90.2741150

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1259-1281GCCAATGATGATTAAAAATGTGTACAUUUUUAAUCAUCAUUGGCCAAUGAUGAUUAAAAAUGUGUU-3.313.602


Target Position: 486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
486AAUGUAAAUGAAGUCAUUA88.1384204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
485504AATGTAAATGAAGTCATTATAATGACTTCATTTACATT0.039300.015400.474100.500001.000001.00000


Target Position: 667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667AGAAGUUACAUGAUGCUCU80.4804511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
474685AGAAGTTACATGATGCTCTAGAGCATCATGTAACTTCT0.057000.004100.500000.500001.000001.00000


Target Position: 1684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1684AGCAAUUUGAUCAGUAUAU79.1428560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1491702AGCAATTTGATCAGTATATATATACTGATCAAATTGCT0.256000.168400.810300.750001.000001.00000


Target Position: 1251, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1251GUUUUCAAGCCAAUGAUGA79.5846542

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1249-1271ATGTTTTCAAGCCAATGATGATTUCAUCAUUGGCUUGAAAACAUGUUUUCAAGCCAAUGAUGAUUU13.67.702


Target Position: 1593, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593CAUGUAUAAAAUUUAAAAA95.123550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2011611CATGTATAAAATTTAAAAATTTTTAAATTTTATACATG0.533100.245500.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1591-1613AACATGTATAAAATTTAAAAAAAUUUUUAAAUUUUAUACAUGUUCAUGUAUAAAAUUUAAAAAAAU-9.18.211


Target Position: 1473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1473ACCUUAAAGGAAACUGCUA81.3511473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4161491ACCTTAAAGGAAACTGCTATAGCAGTTTCCTTTAAGGT0.037300.010300.681000.750000.989100.62500


Target Position: 791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791ACAAGUAAAAUAUGCAAUG66.8611129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
423809ACAAGTAAAATATGCAATGCATTGCATATTTTACTTGT0.316100.117200.551700.500001.000001.00000


Target Position: 358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
358AUUAUGGUCUUGAUCCAAA85.5144292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
490376ATTATGGTCTTGATCCAAATTTGGATCAAGACCATAAT0.035300.001300.508600.500000.956500.75000


Target Position: 408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
408GAGGUAGCUGAAGGUAAAU82.2778428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
255426GAGGTAGCTGAAGGTAAATATTTACCTTCAGCTACCTC0.322300.015600.801700.750001.000001.00000


Target Position: 434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
434UCAUUUUCCUCUCGUGGUA76.237695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
489452TCATTTTCCTCTCGTGGTATACCACGAGAGGAAAATGA0.112200.001300.543100.750000.972800.75000


Target Position: 630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
630GCAAUAGAAGUUCAUGAAG74.581776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
419648GCAATAGAAGTTCATGAAGCTTCATGAACTTCTATTGC0.180700.003700.715500.750001.000001.00000


Target Position: 1461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1461AAAAAUGGAUCAACCUUAA87.9406215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991479AAAAATGGATCAACCTTAATTAAGGTTGATCCATTTTT0.197200.134500.465500.500000.962001.00000


Target Position: 1569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1569ACAUAAAUUUAUAAUGAAA96.073935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2681587ACATAAATTTATAATGAAATTTCATTATAAATTTATGT0.115700.069000.706900.750001.000001.00000


Target Position: 776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
776UAGUGGUUAUGUUCAACAA90.0489155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
371794TAGTGGTTATGTTCAACAATTGTTGAACATAACCACTA0.081000.006200.525900.500001.000001.00000


Target Position: 1644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1644UUGAAAGGAAACUGCUAUU67.40811101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3891662TTGAAAGGAAACTGCTATTAATAGCAGTTTCCTTTCAA0.068200.009400.637900.500001.000001.00000


Target Position: 1038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1038AUGAAGAUAGCAAAUGAUA84.6075326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4181056ATGAAGATAGCAAATGATATATCATTTGCTATCTTCAT0.157400.008600.612100.500001.000001.00000


Target Position: 855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
855GGAGGCACUGCUGUUGGUA85.3094296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
444873GGAGGCACTGCTGTTGGTATACCAACAGCAGTGCCTCC0.050400.002800.689701.000001.000001.00000


Target Position: 475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
475AGACAAAUAUGAAUGUAAA99.97813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
290493AGACAAATATGAATGTAAATTTACATTCATATTTGTCT0.106400.058500.724100.750001.000001.00000


Target Position: 1551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1551CUGGGUCCAAAGUGAUUUA85.6065287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2021569CTGGGTCCAAAGTGATTTATAAATCACTTTGGACCCAG0.250400.030900.750000.750001.000001.00000


Target Position: 711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
711CAGAUCAUCAAGAUUGGAC71.8405903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
489729CAGATCATCAAGATTGGACGTCCAATCTTGATGATCTG0.029600.004500.465500.500000.994600.87500


Target Position: 1373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1373GCUGAUGAAUGAGUCUCUA93.994167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711391GCTGATGAATGAGTCTCTATAGAGACTCATTCATCAGC0.021100.002800.681001.000001.000001.00000


Target Position: 410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410GGUAGCUGAAGGUAAAUUA95.568342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
224428GGTAGCTGAAGGTAAATTATAATTTACCTTCAGCTACC0.330100.024100.819001.000001.000001.00000


Target Position: 1397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1397GGUGACAGCUCUCAAUCCU83.1594386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641415GGTGACAGCTCTCAATCCTAGGATTGAGAGCTGTCACC0.022100.011600.508600.750000.967400.62500


Target Position: 416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
416UGAAGGUAAAUUAAAUGAU76.7737672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
351434TGAAGGTAAATTAAATGATATCATTTAATTTACCTTCA0.313500.116400.543100.750001.000001.00000


Target Position: 405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
405GAUGAGGUAGCUGAAGGUA89.2289180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475423GATGAGGTAGCTGAAGGTATACCTTCAGCTACCTCATC0.036000.001700.500000.750001.000001.00000


Target Position: 777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777AGUGGUUAUGUUCAACAAG71.7181910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
499795AGTGGTTATGTTCAACAAGCTTGTTGAACATAACCACT0.177800.004500.569000.500001.000001.00000


Target Position: 1350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1350GCCAAUACAGAAAGGAUCA84.8125318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2231368GCCAATACAGAAAGGATCATGATCCTTTCTGTATTGGC0.151600.062100.775900.750001.000001.00000


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682AGAGCAAUUUGAUCAGUAU92.292497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2141700AGAGCAATTTGATCAGTATATACTGATCAAATTGCTCT0.248400.135600.681000.750001.000001.00000


Target Position: 564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
564AACGAUCAUGUUAAUAAAA85.6679284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
321582AACGATCATGTTAATAAAATTTTATTAACATGATCGTT0.283300.109600.646600.500001.000001.00000


Target Position: 160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
160GAAUGGCAAGCCAAAAUUC75.0886749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
440178GAATGGCAAGCCAAAATTCGAATTTTGGCTTGCCATTC0.052400.002900.500000.500000.934800.87500


Target Position: 1657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1657GCUAUUGAACUUAAGCAUC71.0594950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4271675GCTATTGAACTTAAGCATCGATGCTTAAGTTCAATAGC0.035500.003500.672400.750001.000001.00000


Target Position: 1404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1404GCUCUCAAUCCUCAUAUAG75.7219722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951422GCTCTCAATCCTCATATAGCTATATGAGGATTGAGAGC0.013700.001800.681000.750001.000001.00000


Target Position: 1571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1571AUAAAUUUAUAAUGAAAAU80.181524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541589ATAAATTTATAATGAAAATATTTTCATTATAAATTTAT0.124400.062800.534500.500001.000001.00000


Target Position: 1037, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1037GAUGAAGAUAGCAAAUGAU94.007966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321055GATGAAGATAGCAAATGATATCATTTGCTATCTTCATC0.082700.007300.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1035-1057CTGATGAAGATAGCAAATGATATAUCAUUUGCUAUCUUCAUCAGGAUGAAGAUAGCAAAUGAUAUU13.820.413


Target Position: 466, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
466CAGGAACUCAGACAAAUAU88.0855207

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_646619CAGGAACTCAGACAAATAT1/1/0/094.96FHNM_000143.21NANANA1:241675370..241675388(-)00FH(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185484CAGGAACTCAGACAAATATATATTTGTCTGAGTTCCTG0.219300.038300.741400.750001.000001.00000


Target Position: 629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
629UGCAAUAGAAGUUCAUGAA84.4125334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
396647TGCAATAGAAGTTCATGAATTCATGAACTTCTATTGCA0.045800.004400.681000.750001.000001.00000


Target Position: 1454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1454AGCACACAAAAAUGGAUCA81.5855460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3161472AGCACACAAAAATGGATCATGATCCATTTTTGTGTGCT0.429900.263900.629300.500001.000001.00000


Target Position: 1045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1045UAGCAAAUGAUAUUCGAUU74.587775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3681063TAGCAAATGATATTCGATTAATCGAATATCATTTGCTA0.274700.031400.663800.500001.000001.00000


Target Position: 250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
250UGAGAUCUACGAUGAACUU79.4798549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
303268TGAGATCTACGATGAACTTAAGTTCATCGTAGATCTCA0.372400.059900.586200.750001.000001.00000


Target Position: 1508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1508CACAGCAGAGCAGUUUGAC67.2151115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771526CACAGCAGAGCAGTTTGACGTCAAACTGCTCTGCTGTG0.042400.004800.474100.500000.978300.75000


Target Position: 185, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
185GAUAGAAUAUGAUACCUUU100.34311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
435203GATAGAATATGATACCTTTAAAGGTATCATATTCTATC0.030500.027800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
183-205CGGATAGAATATGATACCTTTGGAAAGGUAUCAUAUUCUAUCCGGAUAGAAUAUGAUACCUUUGGU18.56.622


Target Position: 473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
473UCAGACAAAUAUGAAUGUA81.3364474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
347491TCAGACAAATATGAATGTATACATTCATATTTGTCTGA0.109400.059500.543100.750001.000001.00000


Target Position: 1040, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1040GAAGAUAGCAAAUGAUAUU90.9908128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3091058GAAGATAGCAAATGATATTAATATCATTTGCTATCTTC0.476700.010500.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1038-1060ATGAAGATAGCAAATGATATTCGAAUAUCAUUUGCUAUCUUCAUGAAGAUAGCAAAUGAUAUUCGU8.511.622


Target Position: 811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
811CAAGAAUAAAAGCUGCCAU83.9686359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
481829CAAGAATAAAAGCTGCCATATGGCAGCTTTTATTCTTG0.018200.014500.491400.750001.000001.00000


Target Position: 406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
406AUGAGGUAGCUGAAGGUAA84.0938351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
464424ATGAGGTAGCTGAAGGTAATTACCTTCAGCTACCTCAT0.052100.002800.620700.500001.000001.00000


Target Position: 469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
469GAACUCAGACAAAUAUGAA100.28812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
419487GAACTCAGACAAATATGAATTCATATTTGTCTGAGTTC0.405100.106900.500000.750001.000001.00000


Target Position: 1748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1748AAAUAAAAUACAUUUAUAA95.535845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961766AAATAAAATACATTTATAATTATAAATGTATTTTATTT0.469700.112600.465500.500001.000001.00000


Target Position: 1421, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1421AGGGUAUGACAAGGCAGCA79.0027567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851439AGGGTATGACAAGGCAGCATGCTGCCTTGTCATACCCT0.022000.001500.491400.500001.000001.00000


Target Position: 1236, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1236CAUUUUGAGUUGAAUGUUU85.9392279

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1234-1256GACATTTTGAGTTGAATGTTTTCAAACAUUCAACUCAAAAUGUCCAUUUUGAGUUGAAUGUUUUCU14.87.402


Target Position: 1737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1737AAACAAGUAUAAAAUAAAA95.466846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4141755AAACAAGTATAAAATAAAATTTTATTTTATACTTGTTT0.293700.201300.500000.500001.000001.00000


Target Position: 1374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1374CUGAUGAAUGAGUCUCUAA95.575841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611392CTGATGAATGAGTCTCTAATTAGAGACTCATTCATCAG0.022300.005000.750000.750001.000001.00000


Target Position: 803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
803UGCAAUGACAAGAAUAAAA83.0677391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
127821TGCAATGACAAGAATAAAATTTTATTCTTGTCATTGCA0.273200.118500.853400.750001.000001.00000


Target Position: 565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
565ACGAUCAUGUUAAUAAAAG67.10881121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
315583ACGATCATGTTAATAAAAGCTTTTATTAACATGATCGT0.218200.066100.637900.500001.000001.00000


Target Position: 786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
786GUUCAACAAGUAAAAUAUG74.8537759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
446804GTTCAACAAGTAAAATATGCATATTTTACTTGTTGAAC0.199200.070300.491400.500001.000001.00000


Target Position: 380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
380UGCUAAUGCAAUAAUGAAG67.9811074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
407398TGCTAATGCAATAATGAAGCTTCATTATTGCATTAGCA0.216100.006200.715500.500000.940200.62500


Target Position: 722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
722GAUUGGACGUACUCAUACU94.155763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484740GATTGGACGTACTCATACTAGTATGAGTACGTCCAATC0.110200.031500.474100.500001.000001.00000


Target Position: 799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
799AAUAUGCAAUGACAAGAAU81.5586464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
420817AATATGCAATGACAAGAATATTCTTGTCATTGCATATT0.417300.232500.500000.500001.000001.00000


Target Position: 821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
821AGCUGCCAUGCCAAGAAUC62.14371324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
399839AGCTGCCATGCCAAGAATCGATTCTTGGCATGGCAGCT0.205000.004300.672400.500000.929300.62500


Target Position: 948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
948GUCACUGCUCCGAAUAAAU83.1692385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
314966GTCACTGCTCCGAATAAATATTTATTCGGAGCAGTGAC0.094100.022800.810300.750001.000001.00000


Target Position: 492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
492AAUGAAGUCAUUAGCAAUA86.0967276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487510AATGAAGTCATTAGCAATATATTGCTAATGACTTCATT0.023700.004000.465500.500001.000001.00000


Target Position: 586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
586AGAGCUCAAAUGAUACUUU83.7216367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
226604AGAGCTCAAATGATACTTTAAAGTATCATTTGAGCTCT0.150200.055100.724100.750001.000001.00000


Target Position: 1572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1572UAAAUUUAUAAUGAAAAUA78.4179595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571590TAAATTTATAATGAAAATATATTTTCATTATAAATTTA0.126200.055300.491400.500001.000001.00000


Target Position: 734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
734UCAUACUCAGGAUGCUGUU69.8141002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487752TCATACTCAGGATGCTGTTAACAGCATCCTGAGTATGA0.015600.003700.577600.750000.978300.75000


Target Position: 584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
584CCAGAGCUCAAAUGAUACU79.0726563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
249602CCAGAGCTCAAATGATACTAGTATCATTTGAGCTCTGG0.147100.017000.637900.750001.000001.00000


Target Position: 1694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1694UCAGUAUAUAAAACCCUAG66.98571126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3381712TCAGTATATAAAACCCTAGCTAGGGTTTTATATACTGA0.319800.029300.551700.500001.000001.00000


Target Position: 1728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1728AGAUGGAUUAAACAAGUAU86.1039275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1661746AGATGGATTAAACAAGTATATACTTGTTTAATCCATCT0.378500.185100.681000.750001.000001.00000


Target Position: 655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
655UACCAGGACUACAGAAGUU77.9838615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
357673TACCAGGACTACAGAAGTTAACTTCTGTAGTCCTGGTA0.079600.006300.534500.500001.000001.00000


Target Position: 562, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
562CCAACGAUCAUGUUAAUAA95.576240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
53580CCAACGATCATGTTAATAATTATTAACATGATCGTTGG0.500300.169600.810301.000000.962000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
560-582TCCCAACGATCATGTTAATAAAAUUAUUAACAUGAUCGUUGGGACCAACGAUCAUGUUAAUAAAAU1.421.132


Target Position: 1563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1563UGAUUUACAUAAAUUUAUA93.193783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2051581TGATTTACATAAATTTATATATAAATTTATGTAAATCA0.174800.039400.681000.750001.000001.00000


Target Position: 210, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
210CUAAAGGUGCCAAAUGAUA85.6334286

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
208-230AACTAAAGGTGCCAAATGATAAGUAUCAUUUGGCACCUUUAGUUCUAAAGGUGCCAAAUGAUAAGU7.218.633


Target Position: 1553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1553GGGUCCAAAGUGAUUUACA90.746134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1661571GGGTCCAAAGTGATTTACATGTAAATCACTTTGGACCC0.282300.045900.784500.750001.000001.00000


Target Position: 1447, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1447CUAAGACAGCACACAAAAA95.396647

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7144719CTAAGACAGCACACAAAAA1/1/0/094.96FHNM_000143.21NANANA1:241661228..241661246(-)00FH(0.002)&RBBP4(0.007)&GRPEL2(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1671465CTAAGACAGCACACAAAAATTTTTGTGTGCTGTCTTAG0.652100.265000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1445-1467TGCTAAGACAGCACACAAAAATGUUUUUGUGUGCUGUCUUAGCACUAAGACAGCACACAAAAAUGU12.220.302


Target Position: 303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
303CCAGUUAUUAAAGCUUUUG63.89731255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
465321CCAGTTATTAAAGCTTTTGCAAAAGCTTTAATAACTGG0.023000.002100.698300.750001.000001.00000


Target Position: 683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
683UCUUGAUGCAAAAUCCAAA83.4165377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
401701TCTTGATGCAAAATCCAAATTTGGATTTTGCATCAAGA0.138900.004200.724100.750001.000001.00000


Target Position: 1614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1614CAGACUCCCAUUUCUUAAA88.2213201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2081632CAGACTCCCATTTCTTAAATTTAAGAAATGGGAGTCTG0.170400.083000.784500.750001.000001.00000


Target Position: 448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
448UGGUAUGGCAGACUGGAUC59.95251393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
468466TGGTATGGCAGACTGGATCGATCCAGTCTGCCATACCA0.021400.003800.663800.500001.000001.00000


Target Position: 631, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
631CAAUAGAAGUUCAUGAAGU87.5654227

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
629-651TGCAATAGAAGTTCATGAAGTACACUUCAUGAACUUCUAUUGCACAAUAGAAGUUCAUGAAGUACU18.16.922


Target Position: 769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769AGGAAUUUAGUGGUUAUGU69.61181012

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
499787AGGAATTTAGTGGTTATGTACATAACCACTAAATTCCT0.012400.005200.637900.500001.000001.00000


Target Position: 1586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1586AAAUAAACAUGUAUAAAAU91.7411110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4541604AAATAAACATGTATAAAATATTTTATACATGTTTATTT0.242200.133000.491400.500001.000001.00000


Target Position: 1568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1568UACAUAAAUUUAUAAUGAA91.4443116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4401586TACATAAATTTATAATGAATTCATTATAAATTTATGTA0.112100.077500.508600.500001.000001.00000


Target Position: 1414, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1414CUCAUAUAGGGUAUGACAA90.0305158

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1412-1434TCCTCATATAGGGTATGACAAGGUUGUCAUACCCUAUAUGAGGACUCAUAUAGGGUAUGACAAGGU21.510.223


Target Position: 1595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1595UGUAUAAAAUUUAAAAAAA87.6319225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1741613TGTATAAAATTTAAAAAAATTTTTTTAAATTTTATACA0.572100.287200.706900.750001.000001.00000


Target Position: 219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
219CCAAAUGAUAAGUAUUAUG76.9234662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
489237CCAAATGATAAGTATTATGCATAATACTTATCATTTGG0.014700.010800.689700.750001.000001.00000


Target Position: 460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
460CUGGAUCAGGAACUCAGAC67.59651090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
494478CTGGATCAGGAACTCAGACGTCTGAGTTCCTGATCCAG0.207900.006800.465500.500001.000001.00000


Target Position: 666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666CAGAAGUUACAUGAUGCUC69.60211013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483684CAGAAGTTACATGATGCTCGAGCATCATGTAACTTCTG0.075600.006400.474100.500001.000001.00000


Target Position: 1677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1677CUAGCAGAGCAAUUUGAUC73.2139833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531695CTAGCAGAGCAATTTGATCGATCAAATTGCTCTGCTAG0.278000.007000.491400.500001.000001.00000


Target Position: 474, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
474CAGACAAAUAUGAAUGUAA99.840514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
261492CAGACAAATATGAATGTAATTACATTCATATTTGTCTG0.123100.060100.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
472-494CTCAGACAAATATGAATGTAAATUUACAUUCAUAUUUGUCUGAGCAGACAAAUAUGAAUGUAAAUU16.119.232


Target Position: 876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
876GGUUUAAAUACUAGAAUUG80.1442526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181894GGTTTAAATACTAGAATTGCAATTCTAGTATTTAAACC0.242100.137300.706900.750001.000001.00000


Target Position: 957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
957CCGAAUAAAUUUGAAGCUC63.48711275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
291975CCGAATAAATTTGAAGCTCGAGCTTCAAATTTATTCGG0.153900.055200.603400.750001.000001.00000


Target Position: 881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
881AAAUACUAGAAUUGGCUUU71.6032917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
432899AAATACTAGAATTGGCTTTAAAGCCAATTCTAGTATTT0.031800.015100.500000.500001.000001.00000


Target Position: 518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
518UGAAAUGUUAGGAGGUGAA81.4312469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
427536TGAAATGTTAGGAGGTGAATTCACCTCCTAACATTTCA0.033000.011300.551700.750001.000001.00000


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742AGGAUGCUGUUCCACUUAC68.67471041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
489760AGGATGCTGTTCCACTTACGTAAGTGGAACAGCATCCT0.023000.001800.663800.500000.902200.62500


Target Position: 708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
708GCACAGAUCAUCAAGAUUG78.5442587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
434726GCACAGATCATCAAGATTGCAATCTTGATGATCTGTGC0.043600.003200.706900.750000.994600.75000


Target Position: 498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
498GUCAUUAGCAAUAGAGCAA87.5262230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
302516GTCATTAGCAATAGAGCAATTGCTCTATTGCTAATGAC0.293300.010800.672400.750000.929300.75000


Target Position: 1733, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1733GAUUAAACAAGUAUAAAAU93.585176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1711751GATTAAACAAGTATAAAATATTTTATACTTGTTTAATC0.339700.241800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1731-1753TGGATTAAACAAGTATAAAATAAAUUUUAUACUUGUUUAAUCCAGAUUAAACAAGUAUAAAAUAAU-7.5-0.312


Target Position: 1399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1399UGACAGCUCUCAAUCCUCA86.2718267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001417TGACAGCTCTCAATCCTCATGAGGATTGAGAGCTGTCA0.012300.002800.500000.500000.967400.62500


Target Position: 1587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1587AAUAAACAUGUAUAAAAUU82.3372426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811605AATAAACATGTATAAAATTAATTTTATACATGTTTATT0.275100.145900.500000.500001.000001.00000


Target Position: 1087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1087GUCUGGGAGAAUUGAUCUU78.4728589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831105GTCTGGGAGAATTGATCTTAAGATCAATTCTCCCAGAC0.044300.001600.681000.750000.989100.62500


Target Position: 958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958CGAAUAAAUUUGAAGCUCU87.7987221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
431976CGAATAAATTTGAAGCTCTAGAGCTTCAAATTTATTCG0.032000.013300.569000.750001.000001.00000


Target Position: 1059, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1059CGAUUUUUGGGUUCUGGUC66.48231150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761077CGATTTTTGGGTTCTGGTCGACCAGAACCCAAAAATCG0.042400.006300.474100.750001.000001.00000


Target Position: 825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
825GCCAUGCCAAGAAUCUAUG67.46791096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
303843GCCATGCCAAGAATCTATGCATAGATTCTTGGCATGGC0.100000.012600.844800.750001.000001.00000


Target Position: 435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
435CAUUUUCCUCUCGUGGUAU79.5413547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497453CATTTTCCTCTCGTGGTATATACCACGAGAGGAAAATG0.105600.001100.612100.750000.972800.87500


Target Position: 1046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1046AGCAAAUGAUAUUCGAUUU81.9293441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2031064AGCAAATGATATTCGATTTAAATCGAATATCATTTGCT0.207000.061900.853400.750001.000001.00000


Target Position: 1631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1631AAAACGGAUAAGUUUGAAA85.0584307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701649AAAACGGATAAGTTTGAAATTTCAAACTTATCCGTTTT0.024400.001800.500000.500000.994600.62500


Target Position: 159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
159CGAAUGGCAAGCCAAAAUU76.1487697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
380177CGAATGGCAAGCCAAAATTAATTTTGGCTTGCCATTCG0.062200.004900.784501.000000.934801.00000


Target Position: 671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
671GUUACAUGAUGCUCUUGAU93.208981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
492689GTTACATGATGCTCTTGATATCAAGAGCATCATGTAAC0.028200.011100.465500.750001.000001.00000


Target Position: 1655, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1655CUGCUAUUGAACUUAAGCA87.1113242

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1653-1675AACTGCTATTGAACTTAAGCATCUGCUUAAGUUCAAUAGCAGUUCUGCUAUUGAACUUAAGCAUCU18.319.733


Target Position: 1651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1651GAAACUGCUAUUGAACUUA89.6391169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3591669GAAACTGCTATTGAACTTATAAGTTCAATAGCAGTTTC0.102400.006000.637900.750001.000001.00000


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949UCACUGCUCCGAAUAAAUU72.6924860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
249967TCACTGCTCCGAATAAATTAATTTATTCGGAGCAGTGA0.132700.019600.715500.750001.000001.00000


Target Position: 1585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1585AAAAUAAACAUGUAUAAAA92.360695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4091603AAAATAAACATGTATAAAATTTTATACATGTTTATTTT0.234200.122900.500000.500001.000001.00000


Target Position: 977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
977GGCUGCUCAUGACGCUCUG71.7307908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
445995GGCTGCTCATGACGCTCTGCAGAGCGTCATGAGCAGCC0.026700.019900.715500.750000.934801.00000


Target Position: 668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
668GAAGUUACAUGAUGCUCUU91.1988124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
402686GAAGTTACATGATGCTCTTAAGAGCATCATGTAACTTC0.046700.004200.534500.750001.000001.00000


Target Position: 1582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1582AUGAAAAUAAACAUGUAUA87.3234234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4291600ATGAAAATAAACATGTATATATACATGTTTATTTTCAT0.181100.088200.612100.500001.000001.00000


Target Position: 1480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1480AGGAAACUGCUAUCGAACU74.9019756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4451498AGGAAACTGCTATCGAACTAGTTCGATAGCAGTTTCCT0.352100.008700.637900.500001.000001.00000


Target Position: 456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
456CAGACUGGAUCAGGAACUC70.8123963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
478474CAGACTGGATCAGGAACTCGAGTTCCTGATCCAGTCTG0.032200.004500.474100.500001.000001.00000


Target Position: 1474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1474CCUUAAAGGAAACUGCUAU82.9882396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4541492CCTTAAAGGAAACTGCTATATAGCAGTTTCCTTTAAGG0.023700.008000.801701.000001.000001.00000


Target Position: 887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
887UAGAAUUGGCUUUGCAGAA78.4295594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
425905TAGAATTGGCTTTGCAGAATTCTGCAAAGCCAATTCTA0.037600.011700.500000.500001.000001.00000


Target Position: 181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
181UCCGGAUAGAAUAUGAUAC63.57771271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
414199TCCGGATAGAATATGATACGTATCATATTCTATCCGGA0.209200.015500.689700.500001.000001.00000


Target Position: 1560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1560AAGUGAUUUACAUAAAUUU84.049353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3031578AAGTGATTTACATAAATTTAAATTTATGTAAATCACTT0.161500.042800.637900.500001.000001.00000


Target Position: 978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
978GCUGCUCAUGACGCUCUGG63.44121280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473996GCTGCTCATGACGCTCTGGCCAGAGCGTCATGAGCAGC0.020600.013900.508600.500000.934800.87500


Target Position: 1039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1039UGAAGAUAGCAAAUGAUAU85.1694303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3101057TGAAGATAGCAAATGATATATATCATTTGCTATCTTCA0.510100.010300.681000.750001.000001.00000


Target Position: 656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
656ACCAGGACUACAGAAGUUA79.0379564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
337674ACCAGGACTACAGAAGTTATAACTTCTGTAGTCCTGGT0.096800.007700.819000.750001.000001.00000


Target Position: 1732, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1732GGAUUAAACAAGUAUAAAA104.8392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
651750GGATTAAACAAGTATAAAATTTTATACTTGTTTAATCC0.359600.239800.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1730-1752ATGGATTAAACAAGTATAAAATAUUUUAUACUUGUUUAAUCCAUGGAUUAAACAAGUAUAAAAUAU1.42.112


Target Position: 1146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1146GUGAACCCUACUCAGUGUG61.50491344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4481164GTGAACCCTACTCAGTGTGCACACTGAGTAGGGTTCAC0.047900.009700.500000.500000.994600.87500


Target Position: 739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
739CUCAGGAUGCUGUUCCACU78.4059597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
495757CTCAGGATGCTGTTCCACTAGTGGAACAGCATCCTGAG0.039700.001200.603400.500000.902200.87500


Target Position: 1453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1453CAGCACACAAAAAUGGAUC65.88021176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4591471CAGCACACAAAAATGGATCGATCCATTTTTGTGTGCTG0.428300.214600.603400.500001.000001.00000


Target Position: 1364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1364GAUCAACAAGCUGAUGAAU85.5507291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3271382GATCAACAAGCTGATGAATATTCATCAGCTTGTTGATC0.081200.008400.672400.750000.956500.62500


Target Position: 494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
494UGAAGUCAUUAGCAAUAGA86.6788252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473512TGAAGTCATTAGCAATAGATCTATTGCTAATGACTTCA0.028500.005200.500000.500001.000001.00000


Target Position: 1720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1720UAGGUCUAAGAUGGAUUAA75.2123744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831738TAGGTCTAAGATGGATTAATTAATCCATCTTAGACCTA0.401300.003500.637900.500001.000001.00000


Target Position: 1265, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1265GAUGAUUAAAAAUGUGUUA92.388894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2151283GATGATTAAAAATGTGTTATAACACATTTTTAATCATC0.338800.121700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1263-1285ATGATGATTAAAAATGTGTTACAUAACACAUUUUUAAUCAUCAUGAUGAUUAAAAAUGUGUUACAU19.38.702


Target Position: 1086, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1086GGUCUGGGAGAAUUGAUCU84.0187355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3811104GGTCTGGGAGAATTGATCTAGATCAATTCTCCCAGACC0.085500.004900.629300.750001.000001.00000


Target Position: 936, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
936GGCUUGCCUUUUGUCACUG67.83451077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
469954GGCTTGCCTTTTGTCACTGCAGTGACAAAAGGCAAGCC0.090400.001800.715500.750001.000001.00000


Target Position: 1570, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1570CAUAAAUUUAUAAUGAAAA93.203582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2621588CATAAATTTATAATGAAAATTTTCATTATAAATTTATG0.122900.072000.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1568-1590TACATAAATTTATAATGAAAATAUUUUCAUUAUAAAUUUAUGUACAUAAAUUUAUAAUGAAAAUAU7.4-10.312


Target Position: 1756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1756UACAUUUAUAAAAUAAAAA81.0843485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4681774TACATTTATAAAATAAAAATTTTTATTTTATAAATGTA0.756500.411900.681000.500001.000001.00000


Target Position: 1245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1245UUGAAUGUUUUCAAGCCAA76.0618703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931263TTGAATGTTTTCAAGCCAATTGGCTTGAAAACATTCAA0.038700.001300.500000.500000.967400.62500


Target Position: 1562, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1562GUGAUUUACAUAAAUUUAU81.7089456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1911580GTGATTTACATAAATTTATATAAATTTATGTAAATCAC0.186800.040400.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1560-1582AAGTGATTTACATAAATTTATAAAUAAAUUUAUGUAAAUCACUUGUGAUUUACAUAAAUUUAUAAU-9.78.922


Target Position: 1724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1724UCUAAGAUGGAUUAAACAA83.0479393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3061742TCTAAGATGGATTAAACAATTGTTTAATCCATCTTAGA0.587900.299000.577600.750001.000001.00000


Target Position: 639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
639GUUCAUGAAGUACUGUUAC70.9171957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
488657GTTCATGAAGTACTGTTACGTAACAGTACTTCATGAAC0.037300.033700.465500.500001.000001.00000


Target Position: 1034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1034UCUGAUGAAGAUAGCAAAU73.6312812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4231052TCTGATGAAGATAGCAAATATTTGCTATCTTCATCAGA0.044100.003600.715500.750001.000001.00000


Target Position: 800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
800AUAUGCAAUGACAAGAAUA88.0633208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
413818ATATGCAATGACAAGAATATATTCTTGTCATTGCATAT0.436500.237000.500000.500001.000001.00000


Target Position: 660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
660GGACUACAGAAGUUACAUG85.186302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
220678GGACTACAGAAGTTACATGCATGTAACTTCTGTAGTCC0.155900.028100.715500.750001.000001.00000


Target Position: 784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784AUGUUCAACAAGUAAAAUA83.2014383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
311802ATGTTCAACAAGTAAAATATATTTTACTTGTTGAACAT0.352600.058900.612100.500001.000001.00000


Target Position: 1513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1513CAGAGCAGUUUGACGAAUG75.6357725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3631531CAGAGCAGTTTGACGAATGCATTCGTCAAACTGCTCTG0.131200.005800.629300.500001.000001.00000


Target Position: 1349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1349GGCCAAUACAGAAAGGAUC71.6053916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2481367GGCCAATACAGAAAGGATCGATCCTTTCTGTATTGGCC0.165200.059600.819000.750001.000001.00000


Target Position: 1085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1085AGGUCUGGGAGAAUUGAUC66.69131141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4061103AGGTCTGGGAGAATTGATCGATCAATTCTCCCAGACCT0.128900.009100.663800.500001.000001.00000


Target Position: 217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
217UGCCAAAUGAUAAGUAUUA82.3171427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
362235TGCCAAATGATAAGTATTATAATACTTATCATTTGGCA0.069400.005900.819000.750001.000001.00000


Target Position: 449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
449GGUAUGGCAGACUGGAUCA90.3138148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
455467GGTATGGCAGACTGGATCATGATCCAGTCTGCCATACC0.023500.005300.629300.750001.000001.00000


Target Position: 1650, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1650GGAAACUGCUAUUGAACUU85.7674283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3941668GGAAACTGCTATTGAACTTAAGTTCAATAGCAGTTTCC0.103000.004500.732801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1648-1670AAGGAAACTGCTATTGAACTTAAAAGUUCAAUAGCAGUUUCCUUGGAAACUGCUAUUGAACUUAAU19.219.213


Target Position: 1024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1024CUGCCUGCAGUCUGAUGAA89.4327176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961042CTGCCTGCAGTCTGATGAATTCATCAGACTGCAGGCAG0.029500.001200.612100.750000.989100.62500


Target Position: 743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
743GGAUGCUGUUCCACUUACU87.8464218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471761GGATGCTGTTCCACTTACTAGTAAGTGGAACAGCATCC0.024400.001800.663800.750000.967400.62500


Target Position: 422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
422UAAAUUAAAUGAUCAUUUU78.8398574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
359440TAAATTAAATGATCATTTTAAAATGATCATTTAATTTA0.073700.054800.534500.500001.000001.00000


Target Position: 628, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
628CUGCAAUAGAAGUUCAUGA87.1158241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
496646CTGCAATAGAAGTTCATGATCATGAACTTCTATTGCAG0.013600.006200.560300.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
626-648TGCTGCAATAGAAGTTCATGAAGUCAUGAACUUCUAUUGCAGCACUGCAAUAGAAGUUCAUGAAGU20.521.122


Target Position: 1761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1761UUAUAAAAUAAAAAGGAAA79.3736553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3581779TTATAAAATAAAAAGGAAATTTCCTTTTTATTTTATAA0.714900.538200.534500.500001.000001.00000


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779UGGUUAUGUUCAACAAGUA90.4138140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
245797TGGTTATGTTCAACAAGTATACTTGTTGAACATAACCA0.264900.017700.663800.750001.000001.00000


Target Position: 457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
457AGACUGGAUCAGGAACUCA86.8362247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
405475AGACTGGATCAGGAACTCATGAGTTCCTGATCCAGTCT0.055100.005100.500000.500001.000001.00000


Target Position: 1512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1512GCAGAGCAGUUUGACGAAU80.3187519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3491530GCAGAGCAGTTTGACGAATATTCGTCAAACTGCTCTGC0.076400.006700.844801.000001.000001.00000


Target Position: 1267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1267UGAUUAAAAAUGUGUUACA84.0227354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3961285TGATTAAAAATGTGTTACATGTAACACATTTTTAATCA0.261800.225300.517200.500001.000001.00000


Target Position: 1255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1255UCAAGCCAAUGAUGAUUAA81.9044443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2761273TCAAGCCAATGATGATTAATTAATCATCATTGGCTTGA0.256900.046000.689700.750000.994600.62500


Target Position: 1468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1468GAUCAACCUUAAAGGAAAC76.8739665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3551486GATCAACCTTAAAGGAAACGTTTCCTTTAAGGTTGATC0.115900.033900.534500.500000.989101.00000


Target Position: 1231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1231AUGGACAUUUUGAGUUGAA81.5598463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981249ATGGACATTTTGAGTTGAATTCAACTCAAAATGTCCAT0.012500.011300.482800.500001.000001.00000


Target Position: 1462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1462AAAAUGGAUCAACCUUAAA83.4315376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311480AAAATGGATCAACCTTAAATTTAAGGTTGATCCATTTT0.177800.120300.500000.500000.962001.00000


Target Position: 1615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1615AGACUCCCAUUUCUUAAAA83.558372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2161633AGACTCCCATTTCTTAAAATTTTAAGAAATGGGAGTCT0.159700.072200.724100.750001.000001.00000


Target Position: 661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
661GACUACAGAAGUUACAUGA90.6964135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
485679GACTACAGAAGTTACATGATCATGTAACTTCTGTAGTC0.138100.034000.594800.500001.000001.00000


Target Position: 491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
491AAAUGAAGUCAUUAGCAAU90.9497129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475509AAATGAAGTCATTAGCAATATTGCTAATGACTTCATTT0.020100.003900.491400.500001.000001.00000


Target Position: 1466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1466UGGAUCAACCUUAAAGGAA77.4677634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2671484TGGATCAACCTTAAAGGAATTCCTTTAAGGTTGATCCA0.172700.052800.672400.750000.962000.75000


Target Position: 180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
180UUCCGGAUAGAAUAUGAUA80.9616487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
387198TTCCGGATAGAATATGATATATCATATTCTATCCGGAA0.253100.016900.629300.500001.000001.00000


Target Position: 1679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679AGCAGAGCAAUUUGAUCAG68.27191062

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611697AGCAGAGCAATTTGATCAGCTGATCAAATTGCTCTGCT0.214400.013800.569000.500001.000001.00000


Target Position: 1148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1148GAACCCUACUCAGUGUGAA91.9109105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4041166GAACCCTACTCAGTGTGAATTCACACTGAGTAGGGTTC0.061600.010200.500000.750000.994600.75000


Target Position: 503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
503UAGCAAUAGAGCAAUUGAA86.299266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
491521TAGCAATAGAGCAATTGAATTCAATTGCTCTATTGCTA0.313300.024300.500000.500000.929300.75000


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975CUGGCUGCUCAUGACGCUC60.71361372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486993CTGGCTGCTCATGACGCTCGAGCGTCATGAGCAGCCAG0.040500.001700.474100.500000.934800.75000


Target Position: 1084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1084CAGGUCUGGGAGAAUUGAU81.6858459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3881102CAGGTCTGGGAGAATTGATATCAATTCTCCCAGACCTG0.119100.004700.603400.750001.000001.00000


Target Position: 1452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1452ACAGCACACAAAAAUGGAU78.2969601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3771470ACAGCACACAAAAATGGATATCCATTTTTGTGTGCTGT0.429000.211200.525900.750001.000001.00000


Target Position: 888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
888AGAAUUGGCUUUGCAGAAA80.8921489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483906AGAATTGGCTTTGCAGAAATTTCTGCAAAGCCAATTCT0.017000.004400.724100.750001.000001.00000


Target Position: 1738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1738AACAAGUAUAAAAUAAAAU78.788579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361756AACAAGTATAAAATAAAATATTTTATTTTATACTTGTT0.270700.189600.637900.500001.000001.00000


Target Position: 553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
553CUGUGCAUCCCAACGAUCA82.3787423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
377571CTGTGCATCCCAACGATCATGATCGTTGGGATGCACAG0.266100.017100.560300.500000.951100.75000


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766GGCAGGAAUUUAGUGGUUA89.3215179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
393784GGCAGGAATTTAGTGGTTATAACCACTAAATTCCTGCC0.074000.004500.965501.000001.000001.00000


Target Position: 1253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1253UUUCAAGCCAAUGAUGAUU61.29861354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4801271TTTCAAGCCAATGATGATTAATCATCATTGGCTTGAAA0.215800.027600.491400.500000.967400.75000


Target Position: 589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
589GCUCAAAUGAUACUUUUCC66.57571147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
469607GCTCAAATGATACTTTTCCGGAAAAGTATCATTTGAGC0.240300.128700.482800.500001.000001.00000


Target Position: 636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
636GAAGUUCAUGAAGUACUGU80.541507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
502654GAAGTTCATGAAGTACTGTACAGTACTTCATGAACTTC0.067500.002300.465500.500001.000001.00000


Target Position: 926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926UGCACUUACAGGCUUGCCU63.47021276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
490944TGCACTTACAGGCTTGCCTAGGCAAGCCTGTAAGTGCA0.053000.017600.508600.500000.940200.62500


Target Position: 499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
499UCAUUAGCAAUAGAGCAAU70.0893988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
287517TCATTAGCAATAGAGCAATATTGCTCTATTGCTAATGA0.292400.012400.715500.750000.929300.87500


Target Position: 951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951ACUGCUCCGAAUAAAUUUG61.91161332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
470969ACTGCTCCGAATAAATTTGCAAATTTATTCGGAGCAGT0.105700.014000.560300.500001.000001.00000


Target Position: 976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
976UGGCUGCUCAUGACGCUCU66.70761140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
494994TGGCTGCTCATGACGCTCTAGAGCGTCATGAGCAGCCA0.031700.001200.620700.500000.934800.87500


Target Position: 1773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1773AAGGAAAACAGACUUAAAA86.6594253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671791AAGGAAAACAGACTTAAAATTTTAAGTCTGTTTTCCTT0.569500.525400.637900.500001.000001.00000


Target Position: 789, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
789CAACAAGUAAAAUAUGCAA95.033954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
431807CAACAAGTAAAATATGCAATTGCATATTTTACTTGTTG0.330000.113000.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
787-809TTCAACAAGTAAAATATGCAATGUUGCAUAUUUUACUUGUUGAACAACAAGUAAAAUAUGCAAUGU21.117.822


Target Position: 1772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1772AAAGGAAAACAGACUUAAA94.459559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4171790AAAGGAAAACAGACTTAAATTTAAGTCTGTTTTCCTTT0.569400.518100.500000.500001.000001.00000


Target Position: 1264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1264UGAUGAUUAAAAAUGUGUU79.2368557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3081282TGATGATTAAAAATGTGTTAACACATTTTTAATCATCA0.352100.119200.577600.750001.000001.00000


Target Position: 1379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1379GAAUGAGUCUCUAAUGUUG87.5376229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011397GAATGAGTCTCTAATGTTGCAACATTAGAGACTCATTC0.019000.001000.525900.500001.000001.00000


Target Position: 771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771GAAUUUAGUGGUUAUGUUC79.1916558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
452789GAATTTAGTGGTTATGTTCGAACATAACCACTAAATTC0.062600.005700.500000.500001.000001.00000


Target Position: 1455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1455GCACACAAAAAUGGAUCAA82.4656418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1241473GCACACAAAAATGGATCAATTGATCCATTTTTGTGTGC0.431900.343500.706901.000001.000001.00000


Target Position: 1725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1725CUAAGAUGGAUUAAACAAG74.799766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3631743CTAAGATGGATTAAACAAGCTTGTTTAATCCATCTTAG0.364500.177000.534500.500001.000001.00000


Target Position: 1729, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1729GAUGGAUUAAACAAGUAUA100.8118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2431747GATGGATTAAACAAGTATATATACTTGTTTAATCCATC0.369900.177300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1727-1749AAGATGGATTAAACAAGTATAAAUAUACUUGUUUAAUCCAUCUUGAUGGAUUAAACAAGUAUAAAU11.620.122


Target Position: 1564, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1564GAUUUACAUAAAUUUAUAA101.377

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10156419GATTTACATAAATTTATAA1/1/0/093.97FHNM_000143.21NANANA1:241661111..241661129(-)00FH(0.002)&LOC286002(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2531582GATTTACATAAATTTATAATTATAAATTTATGTAAATC0.128600.040600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1562-1584GTGATTTACATAAATTTATAATGUUAUAAAUUUAUGUAAAUCACGAUUUACAUAAAUUUAUAAUGU-8.06.912


Target Position: 1341, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1341GGAAUCCAGGCCAAUACAG70.8619960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3281359GGAATCCAGGCCAATACAGCTGTATTGGCCTGGATTCC0.294000.008100.586200.750001.000001.00000


Target Position: 582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
582AGCCAGAGCUCAAAUGAUA91.6957111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
216600AGCCAGAGCTCAAATGATATATCATTTGAGCTCTGGCT0.202100.026900.810300.750000.956500.62500


Target Position: 637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
637AAGUUCAUGAAGUACUGUU78.3308600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
488655AAGTTCATGAAGTACTGTTAACAGTACTTCATGAACTT0.055900.010200.491400.500001.000001.00000


Target Position: 1351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1351CCAAUACAGAAAGGAUCAA84.1521347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2431369CCAATACAGAAAGGATCAATTGATCCTTTCTGTATTGG0.138800.072800.698301.000001.000001.00000


Target Position: 935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
935AGGCUUGCCUUUUGUCACU71.5435924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
458953AGGCTTGCCTTTTGTCACTAGTGACAAAAGGCAAGCCT0.204600.012800.637900.500000.962000.62500


Target Position: 463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
463GAUCAGGAACUCAGACAAA99.094716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
251481GATCAGGAACTCAGACAAATTTGTCTGAGTTCCTGATC0.200500.016900.681000.750001.000001.00000


Target Position: 1346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1346CCAGGCCAAUACAGAAAGG63.58721270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4231364CCAGGCCAATACAGAAAGGCCTTTCTGTATTGGCCTGG0.358400.039100.500000.500001.000001.00000


Target Position: 409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409AGGUAGCUGAAGGUAAAUU75.4386732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
235427AGGTAGCTGAAGGTAAATTAATTTACCTTCAGCTACCT0.321500.020400.836200.750001.000001.00000


Target Position: 1446, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1446GCUAAGACAGCACACAAAA91.6595112

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1444-1466TTGCTAAGACAGCACACAAAAATUUUUGUGUGCUGUCUUAGCAAGCUAAGACAGCACACAAAAAUU19.318.903


Target Position: 1250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1250UGUUUUCAAGCCAAUGAUG63.82691258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031268TGTTTTCAAGCCAATGATGCATCATTGGCTTGAAAACA0.087700.005400.551700.500000.967400.75000


Target Position: 407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
407UGAGGUAGCUGAAGGUAAA89.9742162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
281425TGAGGTAGCTGAAGGTAAATTTACCTTCAGCTACCTCA0.276400.013000.724100.750001.000001.00000


Target Position: 1749, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1749AAUAAAAUACAUUUAUAAA95.855437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4171767AATAAAATACATTTATAAATTTATAAATGTATTTTATT0.469800.116600.508600.500001.000001.00000


Target Position: 1552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1552UGGGUCCAAAGUGAUUUAC51.12321635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4041570TGGGTCCAAAGTGATTTACGTAAATCACTTTGGACCCA0.263100.036000.663800.500001.000001.00000


Target Position: 464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
464AUCAGGAACUCAGACAAAU75.7029724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
370482ATCAGGAACTCAGACAAATATTTGTCTGAGTTCCTGAT0.200300.021100.672400.500001.000001.00000


Target Position: 823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
823CUGCCAUGCCAAGAAUCUA87.2257238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
291841CTGCCATGCCAAGAATCTATAGATTCTTGGCATGGCAG0.621000.011800.612100.750001.000001.00000


Target Position: 1561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1561AGUGAUUUACAUAAAUUUA92.828987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2221579AGTGATTTACATAAATTTATAAATTTATGTAAATCACT0.151900.041400.672400.750001.000001.00000


Target Position: 1254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1254UUCAAGCCAAUGAUGAUUA72.4526871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121272TTCAAGCCAATGATGATTATAATCATCATTGGCTTGAA0.232300.036200.637900.500000.967400.62500


Target Position: 652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
652UGUUACCAGGACUACAGAA85.0329309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
426670TGTTACCAGGACTACAGAATTCTGTAGTCCTGGTAACA0.033800.004300.534500.750001.000001.00000


Target Position: 465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
465UCAGGAACUCAGACAAAUA90.683136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192483TCAGGAACTCAGACAAATATATTTGTCTGAGTTCCTGA0.668400.034500.681000.750001.000001.00000


Target Position: 505, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
505GCAAUAGAGCAAUUGAAAU87.5203231

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_250519GCAATAGAGCAATTGAAAT1/1/0/097.75FHNM_000143.21NANANA1:241675331..241675349(-)00FH(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
235523GCAATAGAGCAATTGAAATATTTCAATTGCTCTATTGC0.144100.087900.844801.000000.994600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
503-525TAGCAATAGAGCAATTGAAATGTAUUUCAAUUGCUCUAUUGCUAGCAAUAGAGCAAUUGAAAUGUU7.413.422


Target Position: 1646, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1646GAAAGGAAACUGCUAUUGA92.339196

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1644-1666TTGAAAGGAAACTGCTATTGAACUCAAUAGCAGUUUCCUUUCAAGAAAGGAAACUGCUAUUGAACU19.718.722


Target Position: 1744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1744UAUAAAAUAAAAUACAUUU78.3839598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3631762TATAAAATAAAATACATTTAAATGTATTTTATTTTATA0.112600.071800.543100.500001.000001.00000


Target Position: 334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
334GAGCGGCCGCUGAAGUAAA90.2227151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
335352GAGCGGCCGCTGAAGTAAATTTACTTCAGCGGCCGCTC0.261100.007700.810300.750000.918500.62500


Target Position: 158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
158UCGAAUGGCAAGCCAAAAU64.23841241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
281176TCGAATGGCAAGCCAAAATATTTTGGCTTGCCATTCGA0.110400.013200.784500.750000.934801.00000


Target Position: 420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420GGUAAAUUAAAUGAUCAUU83.7126368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
227438GGTAAATTAAATGATCATTAATGATCATTTAATTTACC0.148800.101000.844801.000001.000001.00000


Target Position: 253, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
253GAUCUACGAUGAACUUUAA102.9185

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_325319GATCTACGATGAACTTTAA1/1/0/097.21FHNM_000143.21NANANA1:241680510..241680528(-)00FH(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
223271GATCTACGATGAACTTTAATTAAAGTTCATCGTAGATC0.545600.096700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
251-273GAGATCTACGATGAACTTTAAGAUUAAAGUUCAUCGUAGAUCUCGAUCUACGAUGAACUUUAAGAU4.920.932


Target Position: 215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
215GGUGCCAAAUGAUAAGUAU91.8547108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
462233GGTGCCAAATGATAAGTATATACTTATCATTTGGCACC0.142600.002300.810301.000001.000001.00000


Target Position: 557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
557GCAUCCCAACGAUCAUGUU82.3654425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
175575GCATCCCAACGATCATGTTAACATGATCGTTGGGATGC0.205100.065200.706901.000000.951100.75000


Target Position: 720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
720AAGAUUGGACGUACUCAUA88.4486197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
393738AAGATTGGACGTACTCATATATGAGTACGTCCAATCTT0.105600.016700.594800.500001.000001.00000


Target Position: 1314, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1314GUUUCCUUUACAGAAAACU68.17081066

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1312-1334CAGTTTCCTTTACAGAAAACTGCAGUUUUCUGUAAAGGAAACUGGUUUCCUUUACAGAAAACUGCU13.318.701


Target Position: 1596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1596GUAUAAAAUUUAAAAAAAC78.4504591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3561614GTATAAAATTTAAAAAAACGTTTTTTTAAATTTTATAC0.542500.292700.534500.500001.000001.00000


Target Position: 402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
402GCAGAUGAGGUAGCUGAAG68.36941059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484420GCAGATGAGGTAGCTGAAGCTTCAGCTACCTCATCTGC0.024100.001500.715500.750001.000001.00000


Target Position: 1676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1676UCUAGCAGAGCAAUUUGAU72.1518886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541694TCTAGCAGAGCAATTTGATATCAAATTGCTCTGCTAGA0.289900.006300.543100.750001.000001.00000


Target Position: 1584, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1584GAAAAUAAACAUGUAUAAA96.840232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2661602GAAAATAAACATGTATAAATTTATACATGTTTATTTTC0.205900.110700.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1582-1604ATGAAAATAAACATGTATAAAATUUUAUACAUGUUUAUUUUCAUGAAAAUAAACAUGUAUAAAAUU8.5-9.722


Target Position: 1735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1735UUAAACAAGUAUAAAAUAA81.3997470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4161753TTAAACAAGTATAAAATAATTATTTTATACTTGTTTAA0.330000.283200.500000.500001.000001.00000


Target Position: 1649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1649AGGAAACUGCUAUUGAACU76.8385669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4171667AGGAAACTGCTATTGAACTAGTTCAATAGCAGTTTCCT0.096600.003700.637900.500001.000001.00000


Target Position: 1375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1375UGAUGAAUGAGUCUCUAAU84.4178333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4161393TGATGAATGAGTCTCTAATATTAGAGACTCATTCATCA0.106300.003700.715500.750001.000001.00000


Target Position: 854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
854UGGAGGCACUGCUGUUGGU69.48481016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
447872TGGAGGCACTGCTGTTGGTACCAACAGCAGTGCCTCCA0.045700.003400.491400.500001.000001.00000


Target Position: 687, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
687GAUGCAAAAUCCAAAGAGU87.8089220

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
685-707TTGATGCAAAATCCAAAGAGTTTACUCUUUGGAUUUUGCAUCAAGAUGCAAAAUCCAAAGAGUUUU16.620.032


Target Position: 1645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1645UGAAAGGAAACUGCUAUUG55.8461521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981663TGAAAGGAAACTGCTATTGCAATAGCAGTTTCCTTTCA0.058500.007900.577600.500001.000001.00000


Target Position: 1548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1548AUGCUGGGUCCAAAGUGAU72.2674880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791566ATGCTGGGTCCAAAGTGATATCACTTTGGACCCAGCAT0.327200.002600.474100.500001.000001.00000


Target Position: 1036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1036UGAUGAAGAUAGCAAAUGA93.669775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4271054TGATGAAGATAGCAAATGATCATTTGCTATCTTCATCA0.079900.005900.500000.500001.000001.00000


Target Position: 1486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1486CUGCUAUCGAACUUGGCUA85.0164310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911504CTGCTATCGAACTTGGCTATAGCCAAGTTCGATAGCAG0.080600.001300.612100.750001.000001.00000


Target Position: 1557, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1557CCAAAGUGAUUUACAUAAA94.118464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2451575CCAAAGTGATTTACATAAATTTATGTAAATCACTTTGG0.135400.086200.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1555-1577GTCCAAAGTGATTTACATAAATTUUUAUGUAAAUCACUUUGGACCCAAAGUGAUUUACAUAAAUUU8.516.722


Target Position: 1506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1506CUCACAGCAGAGCAGUUUG69.8556996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951524CTCACAGCAGAGCAGTTTGCAAACTGCTCTGCTGTGAG0.018700.003100.663800.500000.923900.62500


Target Position: 676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676AUGAUGCUCUUGAUGCAAA85.2783297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
478694ATGATGCTCTTGATGCAAATTTGCATCAAGAGCATCAT0.018900.002800.655200.500000.929300.75000


Target Position: 1234, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1234GACAUUUUGAGUUGAAUGU75.3365741

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1232-1254TGGACATTTTGAGTTGAATGTTTACAUUCAACUCAAAAUGUCCAGACAUUUUGAGUUGAAUGUUUU13.85.302


Target Position: 1693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1693AUCAGUAUAUAAAACCCUA89.5511171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3901711ATCAGTATATAAAACCCTATAGGGTTTTATATACTGAT0.334500.038100.508600.500001.000001.00000


Target Position: 930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
930CUUACAGGCUUGCCUUUUG68.0311070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
499948CTTACAGGCTTGCCTTTTGCAAAAGGCAAGCCTGTAAG0.042600.001100.491400.500000.918501.00000


Target Position: 790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
790AACAAGUAAAAUAUGCAAU75.9122714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
408808AACAAGTAAAATATGCAATATTGCATATTTTACTTGTT0.318800.115100.637900.500001.000001.00000


Target Position: 1683, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1683GAGCAAUUUGAUCAGUAUA97.495125

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8168319GAGCAATTTGATCAGTATA1/1/0/094.96FHNM_000143.21NANANA1:241660992..241661010(-)00FH(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2251701GAGCAATTTGATCAGTATATATACTGATCAAATTGCTC0.254900.146000.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1681-1703CAGAGCAATTTGATCAGTATATAUAUACUGAUCAAAUUGCUCUGGAGCAAUUUGAUCAGUAUAUAU20.318.522


Target Position: 1033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1033GUCUGAUGAAGAUAGCAAA96.878630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321051GTCTGATGAAGATAGCAAATTTGCTATCTTCATCAGAC0.032100.003300.819000.750001.000001.00000


Target Position: 824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
824UGCCAUGCCAAGAAUCUAU74.7355769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
284842TGCCATGCCAAGAATCTATATAGATTCTTGGCATGGCA0.134500.012700.810300.750001.000001.00000


Target Position: 178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
178CCUUCCGGAUAGAAUAUGA88.1857203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
266196CCTTCCGGATAGAATATGATCATATTCTATCCGGAAGG0.471800.028600.620700.750000.978300.75000


Target Position: 1554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1554GGUCCAAAGUGAUUUACAU96.670733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2381572GGTCCAAAGTGATTTACATATGTAAATCACTTTGGACC0.141900.033400.698301.000001.000001.00000


Target Position: 454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
454GGCAGACUGGAUCAGGAAC72.2108884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
294472GGCAGACTGGATCAGGAACGTTCCTGATCCAGTCTGCC0.108800.011400.853400.750001.000001.00000


Target Position: 1613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1613ACAGACUCCCAUUUCUUAA83.7695366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2041631ACAGACTCCCATTTCTTAATTAAGAAATGGGAGTCTGT0.176400.094700.672400.750001.000001.00000


Target Position: 1745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1745AUAAAAUAAAAUACAUUUA84.2505345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3921763ATAAAATAAAATACATTTATAAATGTATTTTATTTTAT0.112900.108600.508600.500001.000001.00000


Target Position: 1636, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1636GGAUAAGUUUGAAAGGAAA100.63710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311654GGATAAGTTTGAAAGGAAATTTCCTTTCAAACTTATCC0.146200.003400.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1634-1656ACGGATAAGTTTGAAAGGAAACTUUUCCUUUCAAACUUAUCCGUGGAUAAGUUUGAAAGGAAACUU18.714.533


Target Position: 658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
658CAGGACUACAGAAGUUACA84.8687314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
305676CAGGACTACAGAAGTTACATGTAACTTCTGTAGTCCTG0.147000.014700.577600.500001.000001.00000


Target Position: 1012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1012CCAUGAACACUACUGCCUG76.6974676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3691030CCATGAACACTACTGCCTGCAGGCAGTAGTGTTCATGG0.057100.061500.560300.750000.956500.75000


Target Position: 1256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1256CAAGCCAAUGAUGAUUAAA87.952214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2611274CAAGCCAATGATGATTAAATTTAATCATCATTGGCTTG0.293800.061000.646600.750001.000001.00000


Target Position: 1510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1510CAGCAGAGCAGUUUGACGA86.6027255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521528CAGCAGAGCAGTTTGACGATCGTCAAACTGCTCTGCTG0.067600.007300.491400.500001.000001.00000


Target Position: 1723, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1723GUCUAAGAUGGAUUAAACA92.222699

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1721-1743AGGTCTAAGATGGATTAAACAAGUGUUUAAUCCAUCUUAGACCUGUCUAAGAUGGAUUAAACAAGU-0.320.233


Target Position: 563, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
563CAACGAUCAUGUUAAUAAA104.3053

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_456319CAACGATCATGTTAATAAA1/1/0/096.22FHNM_000143.21NANANA1:241675273..241675291(-)00FH(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
218581CAACGATCATGTTAATAAATTTATTAACATGATCGTTG0.534900.169400.646600.750001.000001.00000


Target Position: 1378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1378UGAAUGAGUCUCUAAUGUU83.7799364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851396TGAATGAGTCTCTAATGTTAACATTAGAGACTCATTCA0.016400.001900.577600.750001.000001.00000


Target Position: 455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
455GCAGACUGGAUCAGGAACU73.832804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
409473GCAGACTGGATCAGGAACTAGTTCCTGATCCAGTCTGC0.039400.005100.646600.750001.000001.00000


Target Position: 873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
873ACAGGUUUAAAUACUAGAA87.0936243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
360891ACAGGTTTAAATACTAGAATTCTAGTATTTAAACCTGT0.289700.073900.534500.750001.000001.00000


Target Position: 1687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1687AAUUUGAUCAGUAUAUAAA93.166185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4011705AATTTGATCAGTATATAAATTTATATACTGATCAAATT0.290400.141500.508600.500001.000001.00000


Target Position: 1246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1246UGAAUGUUUUCAAGCCAAU74.3188787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811264TGAATGTTTTCAAGCCAATATTGGCTTGAAAACATTCA0.050500.001600.715500.750001.000001.00000


Target Position: 1612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1612AACAGACUCCCAUUUCUUA89.4507175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381630AACAGACTCCCATTTCTTATAAGAAATGGGAGTCTGTT0.186100.104600.612100.500001.000001.00000


Target Position: 802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
802AUGCAAUGACAAGAAUAAA85.0576308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
413820ATGCAATGACAAGAATAAATTTATTCTTGTCATTGCAT0.676500.255100.655200.500001.000001.00000


Target Position: 292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
292GCAUGCCAACCCCAGUUAU79.5793543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486310GCATGCCAACCCCAGTTATATAACTGGGGTTGGCATGC0.142800.001500.810301.000001.000001.00000


Target Position: 249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
249GUGAGAUCUACGAUGAACU83.2755381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
357267GTGAGATCTACGATGAACTAGTTCATCGTAGATCTCAC0.290400.020100.586200.500001.000001.00000


Target Position: 778, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778GUGGUUAUGUUCAACAAGU79.9452531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
383796GTGGTTATGTTCAACAAGTACTTGTTGAACATAACCAC0.224200.004800.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
776-798TAGTGGTTATGTTCAACAAGTAAACUUGUUGAACAUAACCACUAGUGGUUAUGUUCAACAAGUAAU16.720.033


Target Position: 196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
196AUACCUUUGGUGAACUAAA84.45331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
443214ATACCTTTGGTGAACTAAATTTAGTTCACCAAAGGTAT0.150600.005300.543100.500000.978300.75000


Target Position: 19, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
19GCUCCCUCAGCACCAUGUA83.3997378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
17837GCTCCCTCAGCACCATGTATACATGGTGCTGAGGGAGC0.362600.091500.672401.000000.929300.62500


Target Position: 333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
333CGAGCGGCCGCUGAAGUAA82.4938416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
420351CGAGCGGCCGCTGAAGTAATTACTTCAGCGGCCGCTCG0.110800.003700.758601.000000.918500.75000


Target Position: 368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
368UGAUCCAAAGAUUGCUAAU76.0651702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
500386TGATCCAAAGATTGCTAATATTAGCAATCTTTGGATCA0.014500.001100.715500.750001.000001.00000


Target Position: 928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
928CACUUACAGGCUUGCCUUU78.6295583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
264946CACTTACAGGCTTGCCTTTAAAGGCAAGCCTGTAAGTG0.122400.021600.793100.750000.918500.75000


Target Position: 414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
414GCUGAAGGUAAAUUAAAUG76.1314698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197432GCTGAAGGTAAATTAAATGCATTTAATTTACCTTCAGC0.305000.032700.698300.750001.000001.00000


Target Position: 477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
477ACAAAUAUGAAUGUAAAUG64.12441248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
331495ACAAATATGAATGTAAATGCATTTACATTCATATTTGT0.148100.058100.551700.500001.000001.00000


Target Position: 302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
302CCCAGUUAUUAAAGCUUUU79.0908562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
353320CCCAGTTATTAAAGCTTTTAAAAGCTTTAATAACTGGG0.066100.007800.991401.000001.000001.00000


Target Position: 301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
301CCCCAGUUAUUAAAGCUUU77.8225621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
273319CCCCAGTTATTAAAGCTTTAAAGCTTTAATAACTGGGG0.113800.020400.991401.000001.000001.00000


Target Position: 1762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1762UAUAAAAUAAAAAGGAAAA80.235522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321780TATAAAATAAAAAGGAAAATTTTCCTTTTTATTTTATA0.747800.595200.543100.500001.000001.00000


Target Position: 1591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1591AACAUGUAUAAAAUUUAAA84.5567327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4351609AACATGTATAAAATTTAAATTTAAATTTTATACATGTT0.427600.199600.646600.500001.000001.00000


Target Position: 1376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1376GAUGAAUGAGUCUCUAAUG84.435332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031394GATGAATGAGTCTCTAATGCATTAGAGACTCATTCATC0.012200.003300.525900.500001.000001.00000


Target Position: 1757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1757ACAUUUAUAAAAUAAAAAG71.4731930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3111775ACATTTATAAAATAAAAAGCTTTTTATTTTATAAATGT0.718400.389200.569000.500001.000001.00000


Target Position: 941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
941GCCUUUUGUCACUGCUCCG66.57621146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
496959GCCTTTTGTCACTGCTCCGCGGAGCAGTGACAAAAGGC0.057900.039800.586200.500001.000001.00000


Target Position: 946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
946UUGUCACUGCUCCGAAUAA79.8938532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
369964TTGTCACTGCTCCGAATAATTATTCGGAGCAGTGACAA0.070500.028600.612100.500001.000001.00000


Target Position: 1520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1520GUUUGACGAAUGGGUAAAA84.9732312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671538GTTTGACGAATGGGTAAAATTTTACCCATTCGTCAAAC0.021400.003100.646600.750001.000001.00000


Target Position: 163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
163UGGCAAGCCAAAAUUCCUU67.11551119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
385181TGGCAAGCCAAAATTCCTTAAGGAATTTTGGCTTGCCA0.064800.004800.706900.750000.967400.62500


Target Position: 294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
294AUGCCAACCCCAGUUAUUA78.5387588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
442312ATGCCAACCCCAGTTATTATAATAACTGGGGTTGGCAT0.177200.014500.620700.500001.000001.00000


Target Position: 1746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1746UAAAAUAAAAUACAUUUAU75.0325752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4441764TAAAATAAAATACATTTATATAAATGTATTTTATTTTA0.114000.109700.491400.500001.000001.00000


Target Position: 468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
468GGAACUCAGACAAAUAUGA91.1536125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
243486GGAACTCAGACAAATATGATCATATTTGTCTGAGTTCC0.245800.099700.646600.750001.000001.00000


Target Position: 794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
794AGUAAAAUAUGCAAUGACA93.926869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
500812AGTAAAATATGCAATGACATGTCATTGCATATTTTACT0.327000.147200.500000.500001.000001.00000


Target Position: 1771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1771AAAAGGAAAACAGACUUAA82.4776417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951789AAAAGGAAAACAGACTTAATTAAGTCTGTTTTCCTTTT0.570200.517400.465500.500001.000001.00000


Target Position: 1011, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1011GCCAUGAACACUACUGCCU72.6994858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2411029GCCATGAACACTACTGCCTAGGCAGTAGTGTTCATGGC0.139100.042700.655200.750000.956500.62500


Target Position: 512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512AGCAAUUGAAAUGUUAGGA73.15835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
474530AGCAATTGAAATGTTAGGATCCTAACATTTCAATTGCT0.047300.026800.482800.500001.000001.00000


Target Position: 956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
956UCCGAAUAAAUUUGAAGCU61.41761347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497974TCCGAATAAATTTGAAGCTAGCTTCAAATTTATTCGGA0.140800.040700.517200.500001.000001.00000


Target Position: 933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
933ACAGGCUUGCCUUUUGUCA74.0973793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487951ACAGGCTTGCCTTTTGTCATGACAAAAGGCAAGCCTGT0.179300.001400.482800.500000.918500.75000


Target Position: 729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
729CGUACUCAUACUCAGGAUG73.0538839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
382747CGTACTCATACTCAGGATGCATCCTGAGTATGAGTACG0.049400.005700.620700.750001.000001.00000


Target Position: 1661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1661UUGAACUUAAGCAUCUCUA73.2222832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821679TTGAACTTAAGCATCTCTATAGAGATGCTTAAGTTCAA0.017300.002900.474100.500001.000001.00000


Target Position: 1114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1114AUGAACCAGGAAGCAGUAU63.00911293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841132ATGAACCAGGAAGCAGTATATACTGCTTCCTGGTTCAT0.026800.013200.612100.500001.000001.00000


Target Position: 1652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1652AAACUGCUAUUGAACUUAA92.765589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981670AAACTGCTATTGAACTTAATTAAGTTCAATAGCAGTTT0.046000.005300.465500.500001.000001.00000


Target Position: 367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
367UUGAUCCAAAGAUUGCUAA70.4856970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
477385TTGATCCAAAGATTGCTAATTAGCAATCTTTGGATCAA0.021200.001700.612100.500001.000001.00000


Target Position: 627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
627GCUGCAAUAGAAGUUCAUG75.2563743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501645GCTGCAATAGAAGTTCATGCATGAACTTCTATTGCAGC0.012300.002300.698300.750001.000001.00000


Target Position: 194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
194UGAUACCUUUGGUGAACUA86.1683270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
389212TGATACCTTTGGTGAACTATAGTTCACCAAAGGTATCA0.046500.005900.551700.750000.978301.00000


Target Position: 1589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1589UAAACAUGUAUAAAAUUUA86.8162248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4621607TAAACATGTATAAAATTTATAAATTTTATACATGTTTA0.348000.171100.500000.500001.000001.00000


Target Position: 1366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1366UCAACAAGCUGAUGAAUGA84.8325316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4061384TCAACAAGCTGATGAATGATCATTCATCAGCTTGTTGA0.139100.020600.500000.500001.000001.00000


Target Position: 1460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1460CAAAAAUGGAUCAACCUUA92.648790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2781478CAAAAATGGATCAACCTTATAAGGTTGATCCATTTTTG0.184500.137500.612100.750000.962000.87500


Target Position: 1305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1305GAUGCUUCAGUUUCCUUUA91.4068117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931323GATGCTTCAGTTTCCTTTATAAAGGAAACTGAAGCATC0.084400.001200.646600.750001.000001.00000


Target Position: 164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
164GGCAAGCCAAAAUUCCUUC64.77951222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340182GGCAAGCCAAAATTCCTTCGAAGGAATTTTGGCTTGCC0.073700.014700.827600.750001.000001.00000


Target Position: 681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
681GCUCUUGAUGCAAAAUCCA85.932280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
452699GCTCTTGATGCAAAATCCATGGATTTTGCATCAAGAGC0.098100.002700.508600.750001.000001.00000


Target Position: 804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
804GCAAUGACAAGAAUAAAAG75.5712728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
168822GCAATGACAAGAATAAAAGCTTTTATTCTTGTCATTGC0.319500.066800.715500.750001.000001.00000


Target Position: 1739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1739ACAAGUAUAAAAUAAAAUA90.903130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1851757ACAAGTATAAAATAAAATATATTTTATTTTATACTTGT0.278300.182300.663800.750001.000001.00000


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783UAUGUUCAACAAGUAAAAU73.446821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
361801TATGTTCAACAAGTAAAATATTTTACTTGTTGAACATA0.340700.049800.534500.500001.000001.00000


Target Position: 510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
510AGAGCAAUUGAAAUGUUAG77.2494649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
437528AGAGCAATTGAAATGTTAGCTAACATTTCAATTGCTCT0.110800.045500.551700.500001.000001.00000


Target Position: 1556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1556UCCAAAGUGAUUUACAUAA78.829575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2541574TCCAAAGTGATTTACATAATTATGTAAATCACTTTGGA0.127700.089300.836200.750001.000001.00000


Target Position: 257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
257UACGAUGAACUUUAAGAUU73.6037814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
427275TACGATGAACTTTAAGATTAATCTTAAAGTTCATCGTA0.034900.016800.672400.500001.000001.00000


Target Position: 1424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1424GUAUGACAAGGCAGCAAAG78.2118604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631442GTATGACAAGGCAGCAAAGCTTTGCTGCCTTGTCATAC0.022200.004100.543100.500001.000001.00000


Target Position: 678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
678GAUGCUCUUGAUGCAAAAU82.7092407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
422696GATGCTCTTGATGCAAAATATTTTGCATCAAGAGCATC0.048000.003600.672400.750000.929300.75000


Target Position: 248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
248CGUGAGAUCUACGAUGAAC78.9472570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
323266CGTGAGATCTACGATGAACGTTCATCGTAGATCTCACG0.253900.008700.629300.750001.000001.00000


Target Position: 765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
765GGGCAGGAAUUUAGUGGUU80.4949509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
480783GGGCAGGAATTTAGTGGTTAACCACTAAATTCCTGCCC0.072300.001700.844801.000001.000001.00000


Target Position: 1751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1751UAAAAUACAUUUAUAAAAU81.5687461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3701769TAAAATACATTTATAAAATATTTTATAAATGTATTTTA0.518600.120700.525900.500001.000001.00000


Target Position: 1685, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1685GCAAUUUGAUCAGUAUAUA95.371848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1301703GCAATTTGATCAGTATATATATATACTGATCAAATTGC0.266600.160500.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1683-1705GAGCAATTTGATCAGTATATAAAUAUAUACUGAUCAAAUUGCUCGCAAUUUGAUCAGUAUAUAAAU6.14.222


Target Position: 1555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1555GUCCAAAGUGAUUUACAUA96.420134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2561573GTCCAAAGTGATTTACATATATGTAAATCACTTTGGAC0.126600.030800.775900.750001.000001.00000


Target Position: 411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
411GUAGCUGAAGGUAAAUUAA94.366360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
263429GTAGCTGAAGGTAAATTAATTAATTTACCTTCAGCTAC0.354100.028000.646600.750001.000001.00000


Target Position: 707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
707UGCACAGAUCAUCAAGAUU78.2057606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
479725TGCACAGATCATCAAGATTAATCTTGATGATCTGTGCA0.034400.001700.844800.750000.994600.62500


Target Position: 782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
782UUAUGUUCAACAAGUAAAA77.9381617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487800TTATGTTCAACAAGTAAAATTTTACTTGTTGAACATAA0.325400.024500.534500.500001.000001.00000


Target Position: 453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
453UGGCAGACUGGAUCAGGAA83.1948384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
314471TGGCAGACTGGATCAGGAATTCCTGATCCAGTCTGCCA0.095000.010000.672400.750001.000001.00000


Target Position: 677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
677UGAUGCUCUUGAUGCAAAA86.1132273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
406695TGATGCTCTTGATGCAAAATTTTGCATCAAGAGCATCA0.042800.004100.724100.750000.929300.75000


Target Position: 1583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1583UGAAAAUAAACAUGUAUAA86.608254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1871601TGAAAATAAACATGTATAATTATACATGTTTATTTTCA0.193500.098500.689700.750001.000001.00000


Target Position: 251, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
251GAGAUCUACGAUGAACUUU79.7552535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
123269GAGATCTACGATGAACTTTAAAGTTCATCGTAGATCTC0.377300.067600.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
249-271GTGAGATCTACGATGAACTTTAAAAAGUUCAUCGUAGAUCUCACGAGAUCUACGAUGAACUUUAAU19.220.223


Target Position: 1398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1398GUGACAGCUCUCAAUCCUC74.8114764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861416GTGACAGCTCTCAATCCTCGAGGATTGAGAGCTGTCAC0.015900.005600.482800.500000.967400.62500


Target Position: 725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
725UGGACGUACUCAUACUCAG73.0483841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352743TGGACGTACTCATACTCAGCTGAGTATGAGTACGTCCA0.269800.013700.560300.500001.000001.00000


Target Position: 1750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1750AUAAAAUACAUUUAUAAAA85.8628281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4031768ATAAAATACATTTATAAAATTTTATAAATGTATTTTAT0.480800.119000.543100.500001.000001.00000


Target Position: 728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
728ACGUACUCAUACUCAGGAU81.7798453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
374746ACGTACTCATACTCAGGATATCCTGAGTATGAGTACGT0.054900.007700.594800.750001.000001.00000


Target Position: 443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
443UCUCGUGGUAUGGCAGACU62.83491299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
502461TCTCGTGGTATGGCAGACTAGTCTGCCATACCACGAGA0.041200.008500.517200.500001.000001.00000


Target Position: 447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
447GUGGUAUGGCAGACUGGAU84.781321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
466465GTGGTATGGCAGACTGGATATCCAGTCTGCCATACCAC0.021800.003200.612100.750001.000001.00000


Target Position: 489, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
489GUAAAUGAAGUCAUUAGCA86.4524257

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
487-509ATGTAAATGAAGTCATTAGCAATUGCUAAUGACUUCAUUUACAUGUAAAUGAAGUCAUUAGCAAUU19.78.922


Target Position: 1588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1588AUAAACAUGUAUAAAAUUU76.5847680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3801606ATAAACATGTATAAAATTTAAATTTTATACATGTTTAT0.329400.158100.543100.500001.000001.00000


Target Position: 1592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1592ACAUGUAUAAAAUUUAAAA91.2125122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1851610ACATGTATAAAATTTAAAATTTTAAATTTTATACATGT0.522800.214300.706900.750001.000001.00000


Target Position: 719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719CAAGAUUGGACGUACUCAU87.8221219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
468737CAAGATTGGACGTACTCATATGAGTACGTCCAATCTTG0.095000.011400.491400.750001.000001.00000


Target Position: 626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
626UGCUGCAAUAGAAGUUCAU72.4304872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497644TGCTGCAATAGAAGTTCATATGAACTTCTATTGCAGCA0.012700.002500.698300.750001.000001.00000


Target Position: 395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
395GAAGGCAGCAGAUGAGGUA91.4504115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
464413GAAGGCAGCAGATGAGGTATACCTCATCTGCTGCCTTC0.453600.013200.491400.750001.000001.00000


Target Position: 726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
726GGACGUACUCAUACUCAGG78.3822599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501744GGACGTACTCATACTCAGGCCTGAGTATGAGTACGTCC0.103900.011100.525900.500001.000001.00000


Target Position: 293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
293CAUGCCAACCCCAGUUAUU78.212603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
439311CATGCCAACCCCAGTTATTAATAACTGGGGTTGGCATG0.158300.003000.646600.750001.000001.00000


Target Position: 1730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1730AUGGAUUAAACAAGUAUAA81.7894452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4461748ATGGATTAAACAAGTATAATTATACTTGTTTAATCCAT0.369400.235000.620700.500001.000001.00000


Target Position: 504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
504AGCAAUAGAGCAAUUGAAA87.5415228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
178522AGCAATAGAGCAATTGAAATTTCAATTGCTCTATTGCT0.241500.040500.853400.750000.929300.75000


Target Position: 795, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
795GUAAAAUAUGCAAUGACAA92.841586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
365813GTAAAATATGCAATGACAATTGTCATTGCATATTTTAC0.406300.225000.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
793-815AAGTAAAATATGCAATGACAAGAUUGUCAUUGCAUAUUUUACUUGUAAAAUAUGCAAUGACAAGAU20.5-7.522


Target Position: 1047, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1047GCAAAUGAUAUUCGAUUUU76.2533693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1881065GCAAATGATATTCGATTTTAAAATCGAATATCATTTGC0.187300.183600.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1045-1067TAGCAAATGATATTCGATTTTTGAAAAUCGAAUAUCAUUUGCUAGCAAAUGAUAUUCGAUUUUUGU16.713.822


Target Position: 1681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1681CAGAGCAAUUUGAUCAGUA97.143929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2881699CAGAGCAATTTGATCAGTATACTGATCAAATTGCTCTG0.197000.143800.603400.750001.000001.00000


Target Position: 558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
558CAUCCCAACGAUCAUGUUA88.5977192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
264576CATCCCAACGATCATGTTATAACATGATCGTTGGGATG0.207400.177100.620700.750000.951100.62500


Target Position: 1007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1007UGGAGCCAUGAACACUACU67.38931105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3251025TGGAGCCATGAACACTACTAGTAGTGTTCATGGCTCCA0.467100.032600.637900.500001.000001.00000


Target Position: 1594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1594AUGUAUAAAAUUUAAAAAA83.6083370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4601612ATGTATAAAATTTAAAAAATTTTTTAAATTTTATACAT0.553000.261800.655200.500001.000001.00000


Target Position: 770, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
770GGAAUUUAGUGGUUAUGUU92.218100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
480788GGAATTTAGTGGTTATGTTAACATAACCACTAAATTCC0.018500.005700.724101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
768-790CAGGAATTTAGTGGTTATGTTCAAACAUAACCACUAAAUUCCUGGGAAUUUAGUGGUUAUGUUCAU14.62.123


Target Position: 638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
638AGUUCAUGAAGUACUGUUA92.801188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
387656AGTTCATGAAGTACTGTTATAACAGTACTTCATGAACT0.046800.046000.672400.750001.000001.00000


Target Position: 1736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1736UAAACAAGUAUAAAAUAAA89.0374186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3621754TAAACAAGTATAAAATAAATTTATTTTATACTTGTTTA0.803400.222500.534500.500001.000001.00000


Target Position: 1362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1362AGGAUCAACAAGCUGAUGA77.5039633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3841380AGGATCAACAAGCTGATGATCATCAGCTTGTTGATCCT0.080900.009700.620700.500000.956500.62500


Target Position: 820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820AAGCUGCCAUGCCAAGAAU76.9802660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
447838AAGCTGCCATGCCAAGAATATTCTTGGCATGGCAGCTT0.106400.003900.629300.500000.913000.62500


Target Position: 2, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2CCAGAAAUUCUACCCAAGC62.53881312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
44820CCAGAAATTCTACCCAAGCGCTTGGGTAGAATTTCTGG0.085300.104600.491400.500001.000001.00000


Target Position: 1770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1770AAAAAGGAAAACAGACUUA84.1742346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001788AAAAAGGAAAACAGACTTATAAGTCTGTTTTCCTTTTT0.533900.515100.465500.500001.000001.00000


Target Position: 588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
588AGCUCAAAUGAUACUUUUC72.0949889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
372606AGCTCAAATGATACTTTTCGAAAAGTATCATTTGAGCT0.170600.072000.681000.500001.000001.00000


Target Position: 950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
950CACUGCUCCGAAUAAAUUU80.7013498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
286968CACTGCTCCGAATAAATTTAAATTTATTCGGAGCAGTG0.108600.015500.793100.750001.000001.00000


Target Position: 195, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
195GAUACCUUUGGUGAACUAA88.5344195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
368213GATACCTTTGGTGAACTAATTAGTTCACCAAAGGTATC0.072600.005600.646600.750000.978300.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
193-215ATGATACCTTTGGTGAACTAAAGUUAGUUCACCAAAGGUAUCAUGAUACCUUUGGUGAACUAAAGU20.318.522


Target Position: 653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
653GUUACCAGGACUACAGAAG67.73461083

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
403671GTTACCAGGACTACAGAAGCTTCTGTAGTCCTGGTAAC0.042100.004600.508600.500001.000001.00000


Target Position: 718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
718UCAAGAUUGGACGUACUCA79.1186561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
422736TCAAGATTGGACGTACTCATGAGTACGTCCAATCTTGA0.096400.012100.500000.500001.000001.00000


Target Position: 1488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1488GCUAUCGAACUUGGCUAUC58.94721429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3561506GCTATCGAACTTGGCTATCGATAGCCAAGTTCGATAGC0.064100.030700.672400.750001.000001.00000


Target Position: 184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
184GGAUAGAAUAUGAUACCUU95.540643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
396202GGATAGAATATGATACCTTAAGGTATCATATTCTATCC0.044100.040500.732801.000001.000001.00000


Target Position: 1448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1448UAAGACAGCACACAAAAAU72.1013888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4751466TAAGACAGCACACAAAAATATTTTTGTGTGCTGTCTTA0.637300.258800.525900.500001.000001.00000


Target Position: 1048, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048CAAAUGAUAUUCGAUUUUU83.1395387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2191066CAAATGATATTCGATTTTTAAAAATCGAATATCATTTG0.162400.154400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1046-1068AGCAAATGATATTCGATTTTTGGAAAAAUCGAAUAUCAUUUGCUCAAAUGAUAUUCGAUUUUUGGU7.47.222


Target Position: 826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
826CCAUGCCAAGAAUCUAUGA84.2933341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
347844CCATGCCAAGAATCTATGATCATAGATTCTTGGCATGG0.086500.006800.620700.750001.000001.00000


Target Position: 1616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1616GACUCCCAUUUCUUAAAAA95.069853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2251634GACTCCCATTTCTTAAAAATTTTTAAGAAATGGGAGTC0.150500.061800.819000.750001.000001.00000


Target Position: 1573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1573AAAUUUAUAAUGAAAAUAA92.1607101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011591AAATTTATAATGAAAATAATTATTTTCATTATAAATTT0.132600.048100.465500.500001.000001.00000


Target Position: 767, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767GCAGGAAUUUAGUGGUUAU93.758373

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_176719GCAGGAATTTAGTGGTTAT1/1/0/0100.00FHNM_000143.21NANANA1:241669454,241671903..241669468,241671906(-)00FH(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
469785GCAGGAATTTAGTGGTTATATAACCACTAAATTCCTGC0.021300.003500.810301.000001.000001.00000


Target Position: 1247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1247GAAUGUUUUCAAGCCAAUG73.2573830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4661265GAATGTTTTCAAGCCAATGCATTGGCTTGAAAACATTC0.057100.002100.517200.500001.000001.00000


Target Position: 1423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1423GGUAUGACAAGGCAGCAAA92.495293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4471441GGTATGACAAGGCAGCAAATTTGCTGCCTTGTCATACC0.026000.004800.853401.000001.000001.00000


Target Position: 509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
509UAGAGCAAUUGAAAUGUUA84.2518344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
456527TAGAGCAATTGAAATGTTATAACATTTCAATTGCTCTA0.100700.056200.637900.500001.000001.00000


Target Position: 952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
952CUGCUCCGAAUAAAUUUGA72.6653861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327970CTGCTCCGAATAAATTTGATCAAATTTATTCGGAGCAG0.110700.014000.560300.500001.000001.00000


Target Position: 657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
657CCAGGACUACAGAAGUUAC80.5341508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
319675CCAGGACTACAGAAGTTACGTAACTTCTGTAGTCCTGG0.127300.009200.663800.750001.000001.00000


Target Position: 1743, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1743GUAUAAAAUAAAAUACAUU90.3654144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2661761GTATAAAATAAAATACATTAATGTATTTTATTTTATAC0.117500.067200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1741-1763AAGTATAAAATAAAATACATTTAAAUGUAUUUUAUUUUAUACUUGUAUAAAAUAAAAUACAUUUAU6.7-7.521


Target Position: 651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
651CUGUUACCAGGACUACAGA85.1643304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
443669CTGTTACCAGGACTACAGATCTGTAGTCCTGGTAACAG0.027600.004000.560300.500000.923900.62500


Target Position: 157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
157CUCGAAUGGCAAGCCAAAA78.5505586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342175CTCGAATGGCAAGCCAAAATTTTGGCTTGCCATTCGAG0.114600.007100.810300.750000.934800.87500


Target Position: 1519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1519AGUUUGACGAAUGGGUAAA77.5169632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761537AGTTTGACGAATGGGTAAATTTACCCATTCGTCAAACT0.037000.001700.706900.750001.000001.00000


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623AUUUCUUAAAAACGGAUAA76.4711687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5021641ATTTCTTAAAAACGGATAATTATCCGTTTTTAAGAAAT0.012300.005200.474100.500001.000001.00000