siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Sidirect 19   125   134   184   304   314   315   316   323   326   385   418   459   533   542   605   647   735   736   737  
742   748   764   795   797   799   804   818   856   909   937   940   1007   1009   1048   1075   1166   1169   1172   1213  
1223   1232   1245   1347   1397   1400   1403   1437   1449   1473   1529   1556   1568   1668   1712   1714   1717   1723   1733   1747  
1757   1784   1795   1804   1849   1850   1872   1965   1976   1978   1985   1990   1993   2005   2124   2146   2156   2159   2166   2167  
2171   2179   2211   2220   2224   2255   2258   2262   2265   2293   2330   2339   2341   2349   2350   2354   2383   2422   2441   2449  
2455   2457   2480   2507   2540   2549   2623   2636   2646   2655   2659   2684   2685   2689   2695   2714   2722   2723   2729   2734  
2755   2762   2772   2783   2791   2820   2829   2830   2895   2896   2951   2997   3004   3007   3008   3019   3035   3038   3120   3121  
3179   3188   3190   3194   3196   3216   3283   3318   3356   3366   3367   3368   3373   3396   3455   3460   3490   3498   3502   3507  
3511   3512   3519   3570   3648   3728   3754   3818   3822   3853   3855   3864   3944   3984   4022   4042   4046   4094   4099   4103  
4106   4111   4176   4184   4205   4217   4291   4295   4347   4351   4358   4368   4378   4379   4436   4446   4448   4474   4476   4541  
4567   4568   4569   4575   4592   4637   4639   4652   4764   4774   4775   4800   4803   4804   4809   4839   4840   4879   4881   4886  
4890   4929   4945   4948   4964   4985   5056   5057   5113   5121   5154   5212   5214   5217   5226   5248   5250   5305   5309   5314  
5318   5343   5346   5370   5378   5379   5395   5401   5410   5412   5440   5443   5450   5499   5508   5510   5560   5597   5619   5623  
5624   5633   5636   5639   5667   5676   5677   5689   5691   5717   5718   5771   5774   5781   5790   5791   5793   5798   5834   5835  
5844   5846   5849   5857   5871   5879   5891   5899   5904   5931   5933   5954   5955   5961   5965   5986   6051   6053   6055   6142  
6143   6145   6180   6189   6205   6210   6226   6232   6235   6240   6297   6345   6583   6585   6586   6593   6594   6597   6617   6619  
6623   6627   6642   6644   6652   6656   6663   6671   6672   6680   6699   6703   6707   6718   6720   6724   6764   6766   6777   6811  
6855   6856   6894   6903   6935   6963   6965   6990   7000   7006   7012   7023   7033   7036   7038   7082   7091   7093   7102   7122  
7126   7131   7136   7137   7142   7148   7204   7208   7270   7278   7279   7302   7304   7315   7345   7357   7364   7365   7369   7374  
7378   7410   7412   7418   7420   7421   7426   7458   7465   7469   7475   7477   7481   7488   7494   7549   7557   7559   7562   7565  
7569   7586   7589   7590   7613   7617   7624   7630   7657   7659   7672   7698   7705   7737   7740   7762   7764   7771   7772   7791  
7793   7799   7832   7842   7861   7871   7875   7898   7901   7905   7908   7912   7915   7920   7927   7936   7951   7981   7993   8001  
8005   8016   8021   8025   8036   8070   8074   8085   8113   8123   8127   8133   8134   8147   8148   8154   8157   8158   8164   8179  
8183   8185   8192   8195   8233   8245   8253   8255   8258   8261   8280  
Biltr, Rnaxs 15   118   119   120   143   238   303   388   508   509   510   515   529   594   607   610   666   693   694   760  
930   1115   1116   1117   1294   1299   1663   1664   1779   1780   1781   1992   2013   2120   2121   2307   2308   2315   2320   2445  
2501   2644   2780   3079   3080   3181   3238   3313   3314   3674   3816   3817   4050   4135   4282   4284   4289   4290   4348   4561  
5299   5306   5376   5377   5430   5431   5595   5596   5685   5721   5722   5745   5876   5877   5919   5984   6023   6029   6434   6596  
6711   6797   6889   6998   7080   7088   7095   7195   7196   7201   7205   7219   7338   7430   7443   7453   7468   7556   7561   7564  
7648   7651   7652   7653   7692   7870   7914   7950   7988   8060   8065   8066   8281  
Biltr, Rnaxs, Sidirect 144   359   387   604   608   646   757   758   761   1118   1244   1665   2502   2594   2596   2781   2782   3078   3315   3317  
4165   4214   4349   4870   4889   5369   5488   5489   5744   5985   6712   6773   6999   7010   7081   7431   7454   7473   7615   7695  
7697   8282   8283  


Target Position: 6619, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6619GUAAGAUUCAUUUUUAUUA93.204415

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6617-6639GAGTAAGATTCATTTTTATTAGTUAAUAAAAAUGAAUCUUACUCGUAAGAUUCAUUUUUAUUAGUU-9.76.922


Target Position: 5790, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5790CCUGAUUUGAUAAAUAAUU79.65652817

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5788-5810TTCCTGATTTGATAAATAATTAGAAUUAUUUAUCAAAUCAGGAACCUGAUUUGAUAAAUAAUUAGU-10.312.032


Target Position: 6672, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6672GAUAUAUACAUAUAUAUAA108.3133

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6670-6692TGGATATATACATATATATAATAUUAUAUAUAUGUAUAUAUCCAGAUAUAUACAUAUAUAUAAUAU-6.4-6.410


Target Position: 5876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5876UCCCACAAAAAAAUCCUUU60.19167089

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6495894TCCCACAAAAAAATCCTTTAAAGGATTTTTTTGTGGGA0.498000.412500.870700.750001.000001.00000


Target Position: 3754, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3754GAGAACUUUAUCUAUUCCU79.62682822

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3752-3774CAGAGAACTTTATCTATTCCTGTAGGAAUAGAUAAAGUUCUCUGGAGAACUUUAUCUAUUCCUGUU19.917.723


Target Position: 6720, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6720GAUACUUUAAAAAUGGUAA93.1035421

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6718-6740CAGATACTTTAAAAATGGTAATAUUACCAUUUUUAAAGUAUCUGGAUACUUUAAAAAUGGUAAUAU20.04.622


Target Position: 5508, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5508GCCUUUACCACUGUGUAAU76.47693624

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5506-5528TAGCCTTTACCACTGTGTAATGTAUUACACAGUGGUAAAGGCUAGCCUUUACCACUGUGUAAUGUU20.418.611


Target Position: 7697, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7697CCUUUAUUGACUAAAAAUA90.9614634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7417715CCTTTATTGACTAAAAATATATTTTTAGTCAATAAAGG0.340400.211100.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7695-7717CACCTTTATTGACTAAAAATAATUAUUUUUAGUCAAUAAAGGUGCCUUUAUUGACUAAAAAUAAUU-9.7-4.322


Target Position: 4347, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4347CUCUGUUUUUACAUAUCAU90.7145658

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4345-4367GTCTCTGTTTTTACATATCATAAAUGAUAUGUAAAAACAGAGACCUCUGUUUUUACAUAUCAUAAU14.919.221


Target Position: 5410, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5410GACUUUGAGACAGUACUAU85.00311602

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5408-5430AAGACTTTGAGACAGTACTATGTAUAGUACUGUCUCAAAGUCUUGACUUUGAGACAGUACUAUGUU18.819.223


Target Position: 8157, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8157CCAAAUACUUUAAUUAUAU90.546672

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8155-8177AACCAAATACTTTAATTATATTAAUAUAAUUAAAGUAUUUGGUUCCAAAUACUUUAAUUAUAUUAU-8.06.922


Target Position: 5984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5984UCCAUUAAAAUCCUACAUU68.08195700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9936002TCCATTAAAATCCTACATTAATGTAGGATTTTAATGGA0.679900.575800.862100.750001.000001.00000


Target Position: 3511, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3511GCUUUACAGAUGAUAAAGA90.4401688

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3509-3531TAGCTTTACAGATGATAAAGATTUCUUUAUCAUCUGUAAAGCUAGCUUUACAGAUGAUAAAGAUUU6.911.832


Target Position: 7012, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7012CUUUUUUAAAUGUUAAAAU78.75483033

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7010-7032GTCTTTTTTAAATGTTAAAATGTAUUUUAACAUUUAAAAAAGACCUUUUUUAAAUGUUAAAAUGUU0.0-9.111


Target Position: 594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
594GCCCACUUUUCCAUCUACA84.76961649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
996612GCCCACTTTTCCATCTACATGTAGATGGAAAAGTGGGC0.753800.362200.793100.750001.000001.00000


Target Position: 5919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5919CUAAAUAGUUAAGCCUAAU83.11082009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9955937CTAAATAGTTAAGCCTAATATTAGGCTTAACTATTTAG0.339200.171500.663800.750000.956500.75000


Target Position: 1668, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1668GUAUCAAAUAGAAAAACCU82.20312182

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1666-1688CTGTATCAAATAGAAAAACCTTGAGGUUUUUCUAUUUGAUACAGGUAUCAAAUAGAAAAACCUUGU12.68.912


Target Position: 7102, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7102CAUUUCCUUAAAGUAUGUA84.71571666

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7100-7122AACATTTCCTTAAAGTATGTAAGUACAUACUUUAAGGAAAUGUUCAUUUCCUUAAAGUAUGUAAGU19.018.722


Target Position: 1992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1992AGUAAGCAUAAACCAAUUA84.38071733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9172010AGTAAGCATAAACCAATTATAATTGGTTTATGCTTACT0.635000.241800.672400.750001.000001.00000


Target Position: 2695, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2695GAUAUUCUUCAUAAAGACU86.5571291

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2693-2715TTGATATTCTTCATAAAGACTCAAGUCUUUAUGAAGAAUAUCAAGAUAUUCUUCAUAAAGACUCAU14.66.621


Target Position: 7279, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7279CCUUUUUGCAGUCUAUUAU81.69362325

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7277-7299TGCCTTTTTGCAGTCTATTATGAAUAAUAGACUGCAAAAAGGCACCUUUUUGCAGUCUAUUAUGAU8.42.122


Target Position: 7562, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7562CUACUAUCAAUAAAUUUUA91.4573587

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7560-7582TACTACTATCAATAAATTTTAAAUAAAAUUUAUUGAUAGUAGUACUACUAUCAAUAAAUUUUAAAU-12.015.822


Target Position: 2829, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2829GGUUAAUCUUGCCAAAACU87.961043

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2827-2849TGGGTTAATCTTGCCAAAACTTAAGUUUUGGCAAGAUUAACCCAGGUUAAUCUUGCCAAAACUUAU18.810.033


Target Position: 1232, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1232CAAAAUUGAAGACCAAAUU78.79173024

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1230-1252TACAAAATTGAAGACCAAATTTCAAUUUGGUCUUCAAUUUUGUACAAAAUUGAAGACCAAAUUUCU18.8-3.321


Target Position: 6889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6889GGGAAGAAAUAGAAGAGUU92.2826490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8946907GGGAAGAAATAGAAGAGTTAACTCTTCTATTTCTTCCC0.294600.162600.844801.000001.000001.00000


Target Position: 3188, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3188GACUUAGAGAAGAACUUCU86.81421237

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3186-3208ACGACTTAGAGAAGAACTTCTAAAGAAGUUCUUCUCUAAGUCGUGACUUAGAGAAGAACUUCUAAU21.518.932


Target Position: 7861, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7861GCCUUUAUAUGAAUCUAUA100.35754

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7859-7881CTGCCTTTATATGAATCTATAGGUAUAGAUUCAUAUAAAGGCAGGCCUUUAUAUGAAUCUAUAGGU6.610.921


Target Position: 4652, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4652CUUUCUUCCACCCUUUACU71.46874917

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4650-4672TACTTTCTTCCACCCTTTACTTCAGUAAAGGGUGGAAGAAAGUACUUUCUUCCACCCUUUACUUCU18.614.822


Target Position: 818, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
818CAAAAGUCAGCAAUCUACA89.6881801

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
816-838TTCAAAAGTCAGCAATCTACAGGUGUAGAUUGCUGACUUUUGAACAAAAGUCAGCAAUCUACAGGU14.513.322


Target Position: 5378, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5378CCUAAACUUAAUAUAUACU84.60441695

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5376-5398ACCCTAAACTTAATATATACTAAAGUAUAUAUUAAGUUUAGGGUCCUAAACUUAAUAUAUACUAAU2.89.822


Target Position: 5904, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5904GUAUGAAUUAGUUAUCUAA103.55512

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5902-5924ATGTATGAATTAGTTATCTAAATUUAGAUAACUAAUUCAUACAUGUAUGAAUUAGUUAUCUAAAUU8.48.732


Target Position: 5636, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5636CUACUAAGUAGUUUAUAGA93.3826393

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5634-5656AACTACTAAGTAGTTTATAGAAGUCUAUAAACUACUUAGUAGUUCUACUAAGUAGUUUAUAGAAGU-2.311.332


Target Position: 1714, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1714GUUGAAGAACUCUUAGAUU87.41361131

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1712-1734CTGTTGAAGAACTCTTAGATTCTAAUCUAAGAGUUCUUCAACAGGUUGAAGAACUCUUAGAUUCUU11.620.422


Target Position: 5633, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5633GAACUACUAAGUAGUUUAU91.6962559

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5631-5653AAGAACTACTAAGTAGTTTATAGAUAAACUACUUAGUAGUUCUUGAACUACUAAGUAGUUUAUAGU6.617.623


Target Position: 5250, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5250GAACUUAUAAAGUUAAAUA101.48735

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5248-5270CAGAACTTATAAAGTTAAATATAUAUUUAACUUUAUAAGUUCUGGAACUUAUAAAGUUAAAUAUAU-0.34.622


Target Position: 4889, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4889CCAAACGUAAAACCAAAAU69.81225306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5884907CCAAACGTAAAACCAAAATATTTTGGTTTTACGTTTGG0.403100.195600.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4887-4909ATCCAAACGTAAAACCAAAATTTAUUUUGGUUUUACGUUUGGAUCCAAACGUAAAACCAAAAUUUU18.819.822


Target Position: 7000, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7000GUAUAUGAAUGUCUUUUUU86.49371306

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6998-7020TGGTATATGAATGTCTTTTTTAAAAAAAAGACAUUCAUAUACCAGUAUAUGAAUGUCUUUUUUAAU5.510.222


Target Position: 4881, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4881CAAAACAUCCAAACGUAAA87.8471066

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4879-4901CACAAAACATCCAAACGTAAAACUUUACGUUUGGAUGUUUUGUGCAAAACAUCCAAACGUAAAACU15.05.333


Target Position: 760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
760AGUACAUCAGAAUUUUUAA94.0274341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
866778AGTACATCAGAATTTTTAATTAAAAATTCTGATGTACT0.443000.181000.672400.750001.000001.00000


Target Position: 8021, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8021CAUUCACUUUUGAAACUUA101.45836

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8019-8041AACATTCACTTTTGAAACTTAGAUAAGUUUCAAAAGUGAAUGUUCAUUCACUUUUGAAACUUAGAU13.319.222


Target Position: 742, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742CUAUUUGACAAAAUAGCUA88.9297915

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
740-762AACTATTTGACAAAATAGCTAGTUAGCUAUUUUGUCAAAUAGUUCUAUUUGACAAAAUAGCUAGUU18.38.922


Target Position: 693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
693AGGAAGCUUACCUAUCUAU83.23671978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
704711AGGAAGCTTACCTATCTATATAGATAGGTAAGCTTCCT0.365100.113900.801700.750000.962000.62500


Target Position: 3004, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3004CAAGCUUUGAAAUAUGAAA92.0842517

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3002-3024TACAAGCTTTGAAATATGAAATTUUUCAUAUUUCAAAGCUUGUACAAGCUUUGAAAUAUGAAAUUU8.717.022


Target Position: 3490, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3490GAUCUUCGGCAAGAUAUGU77.76643299

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3488-3510AAGATCTTCGGCAAGATATGTTAACAUAUCUUGCCGAAGAUCUUGAUCUUCGGCAAGAUAUGUUAU13.321.033


Target Position: 5834, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5834GCUUACUAAAGACAAGAAA87.66911090

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5832-5854CAGCTTACTAAAGACAAGAAATTUUUCUUGUCUUUAGUAAGCUGGCUUACUAAAGACAAGAAAUUU19.211.322


Target Position: 6145, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6145GAUUGAACUUUAAUAUAGA101.73333

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6143-6165CAGATTGAACTTTAATATAGACCUCUAUAUUAAAGUUCAAUCUGGAUUGAACUUUAAUAUAGACCU-2.714.822


Target Position: 7695, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7695CACCUUUAUUGACUAAAAA94.0518337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8357713CACCTTTATTGACTAAAAATTTTTAGTCAATAAAGGTG0.310300.230900.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7693-7715CTCACCTTTATTGACTAAAAATAUUUUUAGUCAAUAAAGGUGAGCACCUUUAUUGACUAAAAAUAU4.918.622


Target Position: 1299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1299CACAGCACAAAGAAACAUA91.7798549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6881317CACAGCACAAAGAAACATATATGTTTCTTTGTGCTGTG0.535800.116500.750000.750001.000001.00000


Target Position: 7832, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7832GUAGAACUUGCACUGAUAU86.48271310

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7830-7852ATGTAGAACTTGCACTGATATTTAUAUCAGUGCAAGUUCUACAUGUAGAACUUGCACUGAUAUUUU20.318.933


Target Position: 8280, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8280CUGGAAUAAAAAAAAAAAA84.9181621

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8278-8300TTCTGGAATAAAAAAAAAAAAAAUUUUUUUUUUUUAUUCCAGAACUGGAAUAAAAAAAAAAAAAAU-11.321.201


Target Position: 7764, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7764GUGUUUUGGGAUUUGAAGA80.81932536

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7762-7784CAGTGTTTTGGGATTTGAAGATAUCUUCAAAUCCCAAAACACUGGUGUUUUGGGAUUUGAAGAUAU12.212.212


Target Position: 7901, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7901GUAUGAUCUUUGAUCAUUU94.3259304

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7899-7921ATGTATGATCTTTGATCATTTCTAAAUGAUCAAAGAUCAUACAUGUAUGAUCUUUGAUCAUUUCUU16.217.422


Target Position: 2330, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2330CAUUAGAAUCAGUUCUUCA99.079484

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2328-2350GCCATTAGAATCAGTTCTTCACCUGAAGAACUGAUUCUAAUGGCCAUUAGAAUCAGUUCUUCACCU21.56.932


Target Position: 2179, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2179GAAAAAUACUACUUGAUAU99.798665

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2177-2199ATGAAAAATACTACTTGATATGTAUAUCAAGUAGUAUUUUUCAUGAAAAAUACUACUUGAUAUGUU13.4-9.721


Target Position: 797, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
797CUGAUUUGGAGAUAACAGA82.93452039

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
795-817GACTGATTTGGAGATAACAGATTUCUGUUAUCUCCAAAUCAGUCCUGAUUUGGAGAUAACAGAUUU11.613.822


Target Position: 1048, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048CUUUCUGUGGCAACUGUUA84.82041642

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1046-1068CCCTTTCTGTGGCAACTGTTACAUAACAGUUGCCACAGAAAGGGCUUUCUGUGGCAACUGUUACAU17.819.222


Target Position: 4775, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4775GAAAUGGUACUCUUUUCAU89.3696858

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4773-4795CCGAAATGGTACTCTTTTCATCAAUGAAAAGAGUACCAUUUCGGGAAAUGGUACUCUUUUCAUCAU12.218.832


Target Position: 4569, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4569CAAAAGGAAAAUUGAGUUA87.02181208

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4567-4589GCCAAAAGGAAAATTGAGTTAAAUAACUCAAUUUUCCUUUUGGCCAAAAGGAAAAUUGAGUUAAAU19.218.722


Target Position: 2755, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2755GAGAAACGUUAUUAUUGCU88.3542994

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2753-2775GGGAGAAACGTTATTATTGCTTCAGCAAUAAUAACGUUUCUCCCGAGAAACGUUAUUAUUGCUUCU15.319.733


Target Position: 8255, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8255GUACUACGAUUGUAUUAAA102.17227

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8253-8275CTGTACTACGATTGTATTAAAATUUUAAUACAAUCGUAGUACAGGUACUACGAUUGUAUUAAAAUU1.420.832


Target Position: 7421, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7421GUAAUGUUUUCUCUUAAUU82.03252232

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7419-7441TGGTAATGTTTTCTCTTAATTTAAAUUAAGAGAAAACAUUACCAGUAAUGUUUUCUCUUAAUUUAU6.96.922


Target Position: 3455, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3455GAGAAGAAAUUAAUGUCAU91.6356570

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3453-3475GGGAGAAGAAATTAATGTCATGTAUGACAUUAAUUUCUUCUCCCGAGAAGAAAUUAAUGUCAUGUU20.519.122


Target Position: 7469, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7469CAAACACACAUACAUUUUA93.325401

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7467-7489TTCAAACACACATACATTTTACAUAAAAUGUAUGUGUGUUUGAACAAACACACAUACAUUUUACAU5.319.322


Target Position: 5771, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5771CUUCGUUUCUGAUUUUUUU80.51322618

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5769-5791CACTTCGTTTCTGATTTTTTTCCAAAAAAAUCAGAAACGAAGUGCUUCGUUUCUGAUUUUUUUCCU-12.015.322


Target Position: 2167, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2167GUAUCAAAUUAUGAAAAAU90.6179664

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2165-2187GGGTATCAAATTATGAAAAATACAUUUUUCAUAAUUUGAUACCCGUAUCAAAUUAUGAAAAAUACU7.78.921


Target Position: 4165, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4165GCUACAAUUUUCUUUACUA100.53849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7984183GCTACAATTTTCTTTACTATAGTAAAGAAAATTGTAGC0.386400.418800.681001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4163-4185AAGCTACAATTTTCTTTACTAGGUAGUAAAGAAAAUUGUAGCUUGCUACAAUUUUCUUUACUAGGU9.811.622


Target Position: 4217, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4217CAAAGUUUAACUUCUUCAU83.2421976

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4215-4237CACAAAGTTTAACTTCTTCATTCAUGAAGAAGUUAAACUUUGUGCAAAGUUUAACUUCUUCAUUCU20.43.212


Target Position: 2455, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2455GACUUUAAACGGUUUUUAA96.1444185

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2453-2475TTGACTTTAAACGGTTTTTAACAUUAAAAACCGUUUAAAGUCAAGACUUUAAACGGUUUUUAACAU0.04.923


Target Position: 3315, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3315GUCCUUUUUUCAGAAAAAU75.69893822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6333333GTCCTTTTTTCAGAAAAATATTTTTCTGAAAAAAGGAC0.524900.126100.810300.750000.934800.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3313-3335CAGTCCTTTTTTCAGAAAAATAAAUUUUUCUGAAAAAAGGACUGGUCCUUUUUUCAGAAAAAUAAU5.518.721


Target Position: 3373, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3373GAAUUAAAUAUUAAGUCGU79.95922733

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3371-3393AAGAATTAAATATTAAGTCGTGTACGACUUAAUAUUUAAUUCUUGAAUUAAAUAUUAAGUCGUGUU20.9-9.723


Target Position: 5377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5377CCCUAAACUUAAUAUAUAC83.8831829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3505395CCCTAAACTTAATATATACGTATATATTAAGTTTAGGG0.856800.722500.810300.750001.000001.00000


Target Position: 6297, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6297CUACAGUAACCAGUAAGAA90.2696715

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6295-6317TTCTACAGTAACCAGTAAGAATAUUCUUACUGGUUACUGUAGAACUACAGUAACCAGUAAGAAUAU18.920.222


Target Position: 647, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
647CAUAUUUCUCAUAUCCUUU87.05321206

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
645-667TCCATATTTCTCATATCCTTTGAAAAGGAUAUGAGAAAUAUGGACAUAUUUCUCAUAUCCUUUGAU19.91.832


Target Position: 7698, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7698CUUUAUUGACUAAAAAUAA93.7895361

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7696-7718ACCTTTATTGACTAAAAATAATTUUAUUUUUAGUCAAUAAAGGUCUUUAUUGACUAAAAAUAAUUU-9.7-1.422


Target Position: 2540, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2540CCAAAAAAGGAUAUGUCAU84.10291785

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2538-2560TACCAAAAAAGGATATGTCATGGAUGACAUAUCCUUUUUUGGUACCAAAAAAGGAUAUGUCAUGGU21.5-2.923


Target Position: 3648, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3648GAAAAUCCAAGUGGAAUAU79.27532903

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3646-3668AGGAAAATCCAAGTGGAATATGGAUAUUCCACUUGGAUUUUCCUGAAAAUCCAAGUGGAAUAUGGU21.214.222


Target Position: 7905, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7905GAUCUUUGAUCAUUUCUUU91.2491615

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7903-7925ATGATCTTTGATCATTTCTTTTTAAAGAAAUGAUCAAAGAUCAUGAUCUUUGAUCAUUUCUUUUUU5.312.021


Target Position: 6856, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6856CACAAAUGUUUAAUGUAAA96.2149179

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6854-6876TGCACAAATGTTTAATGTAAATGUUUACAUUAAACAUUUGUGCACACAAAUGUUUAAUGUAAAUGU6.912.122


Target Position: 1723, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1723CUCUUAGAUUCUUAUCACA93.3911392

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1721-1743AACTCTTAGATTCTTATCACAACUGUGAUAAGAAUCUAAGAGUUCUCUUAGAUUCUUAUCACAACU16.120.232


Target Position: 5774, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5774CGUUUCUGAUUUUUUUCCU76.04543715

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5772-5794TTCGTTTCTGATTTTTTTCCTGAAGGAAAAAAAUCAGAAACGAACGUUUCUGAUUUUUUUCCUGAU14.319.222


Target Position: 4046, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4046CAAACCUUUUUCUUAACCU75.73263801

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4044-4066GACAAACCTTTTTCTTAACCTCCAGGUUAAGAAAAAGGUUUGUCCAAACCUUUUUCUUAACCUCCU18.617.322


Target Position: 4840, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4840CCAAAUCCAUAUGUCAAAA88.6479953

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4838-4860ACCCAAATCCATATGTCAAAACAUUUUGACAUAUGGAUUUGGGUCCAAAUCCAUAUGUCAAAACAU20.520.112


Target Position: 4800, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4800GAUGCAUAUCAAAGAUCUU92.3179487

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4798-4820GTGATGCATATCAAAGATCTTGTAAGAUCUUUGAUAUGCAUCACGAUGCAUAUCAAAGAUCUUGUU19.121.123


Target Position: 2224, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2224CUUUUUAAACCUAUUCAAU82.43082143

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2222-2244ATCTTTTTAAACCTATTCAATCAAUUGAAUAGGUUUAAAAAGAUCUUUUUAAACCUAUUCAAUCAU8.9-9.122


Target Position: 4349, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4349CUGUUUUUACAUAUCAUAA94.3101307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7624367CTGTTTTTACATATCATAATTATGATATGTAAAAACAG0.405800.104400.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4347-4369CTCTGTTTTTACATATCATAAGAUUAUGAUAUGUAAAAACAGAGCUGUUUUUACAUAUCAUAAGAU10.25.622


Target Position: 6596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6596UCUUAAAAAAAAAGAAAAA78.03973226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5736614TCTTAAAAAAAAAGAAAAATTTTTCTTTTTTTTTAAGA0.502300.342100.724100.750001.000001.00000


Target Position: 2146, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2146CAUGGAAUUUCAAGUAAUU90.1119740

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2144-2166CTCATGGAATTTCAAGTAATTGGAAUUACUUGAAAUUCCAUGAGCAUGGAAUUUCAAGUAAUUGGU4.620.112


Target Position: 4561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4561GUAGCAGCCAAAAGGAAAA85.24471537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9654579GTAGCAGCCAAAAGGAAAATTTTCCTTTTGGCTGCTAC0.592500.073700.681000.750000.983701.00000


Target Position: 2445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2445ACCUCUUUUUGACUUUAAA85.13741565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5772463ACCTCTTTTTGACTTTAAATTTAAAGTCAAAAAGAGGT0.500600.220500.853400.750001.000001.00000


Target Position: 2734, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2734GAAGAUAAAGCUUUUUUAU89.3896852

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2732-2754AAGAAGATAAAGCTTTTTTATGGAUAAAAAAGCUUUAUCUUCUUGAAGAUAAAGCUUUUUUAUGGU-9.16.923


Target Position: 7565, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7565CUAUCAAUAAAUUUUAAAU88.413983

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7563-7585TACTATCAATAAATTTTAAATCAAUUUAAAAUUUAUUGAUAGUACUAUCAAUAAAUUUUAAAUCAU-9.18.712


Target Position: 1990, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1990CAAGUAAGCAUAAACCAAU88.4121984

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1988-2010TTCAAGTAAGCATAAACCAATTAAUUGGUUUAUGCUUACUUGAACAAGUAAGCAUAAACCAAUUAU18.89.823


Target Position: 7617, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7617CAUUAAAGUAAAUCUAAAA99.19581

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7615-7637GACATTAAAGTAAATCTAAAAAAUUUUAGAUUUACUUUAAUGUCCAUUAAAGUAAAUCUAAAAAAU6.9-4.322


Target Position: 6711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6711AGAAAUACAGAUACUUUAA93.4514385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8036729AGAAATACAGATACTTTAATTAAAGTATCTGTATTTCT0.464700.349500.689700.750001.000001.00000


Target Position: 3313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3313CAGUCCUUUUUUCAGAAAA87.90271057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9673331CAGTCCTTTTTTCAGAAAATTTTCTGAAAAAAGGACTG0.280100.073500.784500.750000.934800.62500


Target Position: 694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
694GGAAGCUUACCUAUCUAUC76.24993668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
730712GGAAGCTTACCTATCTATCGATAGATAGGTAAGCTTCC0.358500.206200.689700.750001.000001.00000


Target Position: 2596, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2596GCAUUUGAUAUUAUUUAUA94.1492326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4702614GCATTTGATATTATTTATATATAAATAATATCAAATGC0.632500.175800.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2594-2616CTGCATTTGATATTATTTATACAUAUAAAUAAUAUCAAAUGCAGGCAUUUGAUAUUAUUUAUACAU-8.013.812


Target Position: 1849, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1849GCCAUUACAGAAUCAGUAA92.7074459

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1847-1869TTGCCATTACAGAATCAGTAAAGUUACUGAUUCUGUAAUGGCAAGCCAUUACAGAAUCAGUAAAGU20.320.022


Target Position: 6680, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6680CAUAUAUAUAAUAAGAACU88.3718991

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6678-6700TACATATATATAATAAGAACTCAAGUUCUUAUUAUAUAUAUGUACAUAUAUAUAAUAAGAACUCAU14.6-6.422


Target Position: 5781, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5781GAUUUUUUUCCUGAUUUGA81.76142300

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5779-5801CTGATTTTTTTCCTGATTTGATAUCAAAUCAGGAAAAAAAUCAGGAUUUUUUUCCUGAUUUGAUAU13.8-12.021


Target Position: 737, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737CAAAACUAUUUGACAAAAU84.70911669

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
735-757GGCAAAACTATTTGACAAAATAGAUUUUGUCAAAUAGUUUUGCCCAAAACUAUUUGACAAAAUAGU14.94.912


Target Position: 2830, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2830GUUAAUCUUGCCAAAACUU78.40323143

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2828-2850GGGTTAATCTTGCCAAAACTTACAAGUUUUGGCAAGAUUAACCCGUUAAUCUUGCCAAAACUUACU10.36.923


Target Position: 4378, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4378CCAGAUAAACAUUAUAUUU89.9234766

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4376-4398ACCCAGATAAACATTATATTTATAAAUAUAAUGUUUAUCUGGGUCCAGAUAAACAUUAUAUUUAUU-8.013.421


Target Position: 7659, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7659CACUAAUUUUUAUGUAUAA100.50350

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7657-7679GACACTAATTTTTATGTATAATCUUAUACAUAAAAAUUAGUGUCCACUAAUUUUUAUGUAUAAUCU8.24.622


Target Position: 5113, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5113GCAACAUACUUGUAAACUA102.8322

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5111-5133CGGCAACATACTTGTAAACTAGTUAGUUUACAAGUAUGUUGCCGGCAACAUACUUGUAAACUAGUU12.913.523


Target Position: 2501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2501GGACUUCAUCACAUACAAA104.8387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2082519GGACTTCATCACATACAAATTTGTATGTGATGAAGTCC0.652000.309000.870701.000001.000001.00000


Target Position: 1779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1779CCGAGCAGUAGAUCAAGUA89.3839853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281797CCGAGCAGTAGATCAAGTATACTTGATCTACTGCTCGG0.643300.093500.732801.000001.000001.00000


Target Position: 2684, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2684GGAAACUUCUUGAUAUUCU86.20521352

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2682-2704AGGGAAACTTCTTGATATTCTTCAGAAUAUCAAGAAGUUUCCCUGGAAACUUCUUGAUAUUCUUCU11.613.331


Target Position: 2349, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2349CCUUACUCUUUUUGGAAUU74.9544012

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2347-2369CACCTTACTCTTTTTGGAATTTTAAUUCCAAAAAGAGUAAGGUGCCUUACUCUUUUUGGAAUUUUU20.118.932


Target Position: 5212, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5212CACUUGUUAAUUUUGUAUA89.6279811

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5210-5232CACACTTGTTAATTTTGTATAGTUAUACAAAAUUAACAAGUGUGCACUUGUUAAUUUUGUAUAGUU6.917.822


Target Position: 1757, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1757CUCUUCAAAUUGAAAACCA82.84592055

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1755-1777GGCTCTTCAAATTGAAAACCAACUGGUUUUCAAUUUGAAGAGCCCUCUUCAAAUUGAAAACCAACU21.220.422


Target Position: 1747, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1747GUAGAACUGGCUCUUCAAA90.1938731

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1745-1767AAGTAGAACTGGCTCTTCAAATTUUUGAAGAGCCAGUUCUACUUGUAGAACUGGCUCUUCAAAUUU20.418.933


Target Position: 184, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
184GCAAAACUGCAAAAGGAUA89.851776

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
182-204TAGCAAAACTGCAAAAGGATAGAUAUCCUUUUGCAGUUUUGCUAGCAAAACUGCAAAAGGAUAGAU18.710.332


Target Position: 2685, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2685GAAACUUCUUGAUAUUCUU91.7379554

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2683-2705GGGAAACTTCTTGATATTCTTCAAAGAAUAUCAAGAAGUUUCCCGAAACUUCUUGAUAUUCUUCAU6.613.321


Target Position: 2729, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2729CUAAAGAAGAUAAAGCUUU77.49123371

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2727-2749TTCTAAAGAAGATAAAGCTTTTTAAAGCUUUAUCUUCUUUAGAACUAAAGAAGAUAAAGCUUUUUU17.07.122


Target Position: 510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
510GCCUUCCACUUAUGCUUUA85.00271603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
509528GCCTTCCACTTATGCTTTATAAAGCATAAGTGGAAGGC0.796000.165900.965501.000001.000001.00000


Target Position: 5121, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5121CUUGUAAACUAGUGAAUGU84.2351762

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5119-5141TACTTGTAAACTAGTGAATGTTTACAUUCACUAGUUUACAAGUACUUGUAAACUAGUGAAUGUUUU20.57.222


Target Position: 5318, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5318CCUUUUUGAAUUUUUGGAA81.86622266

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5316-5338AACCTTTTTGAATTTTTGGAAGCUUCCAAAAAUUCAAAAAGGUUCCUUUUUGAAUUUUUGGAAGCU20.12.122


Target Position: 1784, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1784CAGUAGAUCAAGUAAUUAA103.24715

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1782-1804AGCAGTAGATCAAGTAATTAAAGUUAAUUACUUGAUCUACUGCUCAGUAGAUCAAGUAAUUAAAGU1.418.932


Target Position: 7080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7080UGCUUUUUCCACAGAUCAU76.15853687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9927098TGCTTTTTCCACAGATCATATGATCTGTGGAAAAAGCA0.333400.070100.698300.750001.000001.00000


Target Position: 2422, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2422GAAGCUUUGGGCAAAGUUU81.90442254

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2420-2442CAGAAGCTTTGGGCAAAGTTTCTAAACUUUGCCCAAAGCUUCUGGAAGCUUUGGGCAAAGUUUCUU10.317.022


Target Position: 3396, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3396CUUCUUCAGUUCUAAUGCU78.10183205

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3394-3416TCCTTCTTCAGTTCTAATGCTGTAGCAUUAGAACUGAAGAAGGACUUCUUCAGUUCUAAUGCUGUU19.720.432


Target Position: 4803, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4803GCAUAUCAAAGAUCUUGUU85.33091515

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4801-4823ATGCATATCAAAGATCTTGTTACAACAAGAUCUUUGAUAUGCAUGCAUAUCAAAGAUCUUGUUACU19.214.923


Target Position: 4890, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4890CAAACGUAAAACCAAAAUU79.65272818

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4888-4910TCCAAACGTAAAACCAAAATTTCAAUUUUGGUUUUACGUUUGGACAAACGUAAAACCAAAAUUUCU11.315.021


Target Position: 2308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2308CCUAUCCAGAUAUCACAAU78.35323158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3602326CCTATCCAGATATCACAATATTGTGATATCTGGATAGG0.597300.216100.836201.000001.000001.00000


Target Position: 4985, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4985GAGAACUUCAACUAAGUGU78.55433096

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4983-5005GCGAGAACTTCAACTAAGTGTACACACUUAGUUGAAGUUCUCGCGAGAACUUCAACUAAGUGUACU16.417.732


Target Position: 7412, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7412GAACAAGUGGUAAUGUUUU85.94741404

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7410-7432CAGAACAAGTGGTAATGTTTTCTAAAACAUUACCACUUGUUCUGGAACAAGUGGUAAUGUUUUCUU5.317.823


Target Position: 607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
607UCUACAGAACCUAUAUAUU80.862525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
593625TCTACAGAACCTATATATTAATATATAGGTTCTGTAGA0.725500.518400.715500.750000.962000.75000


Target Position: 6586, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6586CAAAACUCCAUCUUAAAAA87.96621039

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6584-6606AGCAAAACTCCATCTTAAAAAAAUUUUUAAGAUGGAGUUUUGCUCAAAACUCCAUCUUAAAAAAAU-3.813.300


Target Position: 8283, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8283GAAUAAAAAAAAAAAAAAA94.2894309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9128301GAATAAAAAAAAAAAAAAATTTTTTTTTTTTTTTATTC0.990200.676200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8281-8303TGGAATAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUAUUCCAGAAUAAAAAAAAAAAAAAAAAU-11.3-9.700


Target Position: 7365, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7365GAUUCAUAUCUAAGUGUAU96.3511174

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7363-7385TGGATTCATATCTAAGTGTATATAUACACUUAGAUAUGAAUCCAGAUUCAUAUCUAAGUGUAUAUU19.08.733


Target Position: 7006, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7006GAAUGUCUUUUUUAAAUGU86.55451293

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7004-7026ATGAATGTCTTTTTTAAATGTTAACAUUUAAAAAAGACAUUCAUGAAUGUCUUUUUUAAAUGUUAU-1.419.211


Target Position: 542, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
542CUUCUACUUACAGUAAACA82.88442044

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
540-562TCCTTCTACTTACAGTAAACAGGUGUUUACUGUAAGUAGAAGGACUUCUACUUACAGUAAACAGGU12.918.923


Target Position: 7586, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7586GUUGGAUUUUUAAGCAUUU81.24872438

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7584-7606CAGTTGGATTTTTAAGCATTTTTAAAUGCUUAAAAAUCCAACUGGUUGGAUUUUUAAGCAUUUUUU18.520.122


Target Position: 8133, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8133GGUAAUUAAUCUUACCUAU95.2934236

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8131-8153ATGGTAATTAATCTTACCTATAAAUAGGUAAGAUUAAUUACCAUGGUAAUUAAUCUUACCUAUAAU19.81.422


Target Position: 856, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
856GAUAUCAGUAAAUUUGACU81.76582296

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
854-876AGGATATCAGTAAATTTGACTGGAGUCAAAUUUACUGAUAUCCUGAUAUCAGUAAAUUUGACUGGU14.813.332


Target Position: 735, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
735GGCAAAACUAUUUGACAAA91.9471529

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
733-755ATGGCAAAACTATTTGACAAAATUUUGUCAAAUAGUUUUGCCAUGGCAAAACUAUUUGACAAAAUU20.521.122


Target Position: 4368, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4368GAAAUACAACCCAGAUAAA98.899487

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4366-4388AAGAAATACAACCCAGATAAACAUUUAUCUGGGUUGUAUUUCUUGAAAUACAACCCAGAUAAACAU13.46.932


Target Position: 7559, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7559CUACUACUAUCAAUAAAUU91.4469589

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7557-7579CACTACTACTATCAATAAATTTTAAUUUAUUGAUAGUAGUAGUGCUACUACUAUCAAUAAAUUUUU-10.318.822


Target Position: 7762, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7762CAGUGUUUUGGGAUUUGAA95.1288244

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7760-7782GCCAGTGTTTTGGGATTTGAAGAUUCAAAUCCCAAAACACUGGCCAGUGUUUUGGGAUUUGAAGAU16.317.833


Target Position: 7081, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7081GCUUUUUCCACAGAUCAUU75.63283842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8107099GCTTTTTCCACAGATCATTAATGATCTGTGGAAAAAGC0.342900.096900.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7079-7101TTGCTTTTTCCACAGATCATTAAAAUGAUCUGUGGAAAAAGCAAGCUUUUUCCACAGAUCAUUAAU20.45.522


Target Position: 5677, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5677CUUUUUAUUCAUGUCUUUA86.41341314

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5675-5697TGCTTTTTATTCATGTCTTTAAAUAAAGACAUGAAUAAAAAGCACUUUUUAUUCAUGUCUUUAAAU19.2-9.721


Target Position: 5430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5430UCAGUUCAGCCACCUAUUU67.44465855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4745448TCAGTTCAGCCACCTATTTAAATAGGTGGCTGAACTGA0.694100.189100.724100.750000.978300.75000


Target Position: 7556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7556GCACUACUACUAUCAAUAA102.37725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3817574GCACTACTACTATCAATAATTATTGATAGTAGTAGTGC0.729100.208500.819001.000001.000001.00000


Target Position: 937, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
937GAAGAGAAAAAUGUUUCAA89.8171781

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
935-957AGGAAGAGAAAAATGTTTCAAGTUUGAAACAUUUUUCUCUUCCUGAAGAGAAAAAUGUUUCAAGUU20.519.122


Target Position: 7981, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7981CUUUCUAGGAUUCAAAUAU82.87642047

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7979-8001TTCTTTCTAGGATTCAAATATTGAUAUUUGAAUCCUAGAAAGAACUUUCUAGGAUUCAAAUAUUGU8.911.732


Target Position: 6434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6434CGUCUCUACACAAAAAUUA89.4639838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7776452CGTCTCTACACAAAAATTATAATTTTTGTGTAGAGACG0.749200.102500.741401.000001.000001.00000


Target Position: 1403, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1403CUGUAGAAAUCAUUAUAAU92.9215439

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1401-1423TACTGTAGAAATCATTATAATGCAUUAUAAUGAUUUCUACAGUACUGUAGAAAUCAUUAUAAUGCU-8.020.322


Target Position: 8195, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8195GUAUAAUAUUUUUAUUAAU94.6102278

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8193-8215ATGTATAATATTTTTATTAATACAUUAAUAAAAAUAUUAUACAUGUAUAAUAUUUUUAUUAAUACU-7.5-5.912


Target Position: 6593, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6593CCAUCUUAAAAAAAAAGAA90.52674

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6591-6613CTCCATCTTAAAAAAAAAGAAAAUUCUUUUUUUUUAAGAUGGAGCCAUCUUAAAAAAAAAGAAAAU5.513.410


Target Position: 7091, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7091CAGAUCAUUAACAUUUCCU77.99783240

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7089-7111CACAGATCATTAACATTTCCTTAAGGAAAUGUUAAUGAUCUGUGCAGAUCAUUAACAUUUCCUUAU20.120.422


Target Position: 5718, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5718CAAUCACUGAUGUUGUAAA99.327375

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5716-5738GCCAATCACTGATGTTGTAAATAUUUACAACAUCAGUGAUUGGCCAAUCACUGAUGUUGUAAAUAU14.719.222


Target Position: 8245, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8245CUUCAUAACUGUACUACGA86.0631387

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8243-8265GACTTCATAACTGTACTACGATTUCGUAGUACAGUUAUGAAGUCCUUCAUAACUGUACUACGAUUU20.88.933


Target Position: 7494, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7494GUUUAUUUCUUUAUGAAAU85.10591575

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7492-7514TAGTTTATTTCTTTATGAAATGCAUUUCAUAAAGAAAUAAACUAGUUUAUUUCUUUAUGAAAUGCU8.9-9.722


Target Position: 5488, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5488CCUGUUAUGCACCUUUUAU83.43581924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8585506CCTGTTATGCACCTTTTATATAAAAGGTGCATAACAGG0.375900.088200.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5486-5508TTCCTGTTATGCACCTTTTATAGAUAAAAGGUGCAUAACAGGAACCUGUUAUGCACCUUUUAUAGU11.011.612


Target Position: 2644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2644CAGCAACAUAACUUAGAAA98.0915109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7622662CAGCAACATAACTTAGAAATTTCTAAGTTATGTTGCTG0.336500.117300.784500.750000.962000.62500


Target Position: 3728, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3728CUGAAGAAGAAUAUGAAAA88.09251028

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3726-3748CTCTGAAGAAGAATATGAAAAGGUUUUCAUAUUCUUCUUCAGAGCUGAAGAAGAAUAUGAAAAGGU8.920.412


Target Position: 5722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5722CACUGAUGUUGUAAAUAAU97.5754124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7785740CACTGATGTTGTAAATAATATTATTTACAACATCAGTG0.338600.102400.784500.750001.000001.00000


Target Position: 2354, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2354CUCUUUUUGGAAUUUUAAA83.50591907

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2352-2374TACTCTTTTTGGAATTTTAAATCUUUAAAAUUCCAAAAAGAGUACUCUUUUUGGAAUUUUAAAUCU-9.75.522


Target Position: 118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
118CCGGAACCAACAAGAGCAA81.49642379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
417136CCGGAACCAACAAGAGCAATTGCTCTTGTTGGTTCCGG0.531700.468100.767201.000001.000001.00000


Target Position: 1007, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1007CAGCAAAUUGUCAUCUUGA92.1134513

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1005-1027GACAGCAAATTGTCATCTTGAAAUCAAGAUGACAAUUUGCUGUCCAGCAAAUUGUCAUCUUGAAAU18.118.532


Target Position: 7315, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7315CAAAUAAUAGAGCUAAAAA99.265679

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7313-7335CACAAATAATAGAGCTAAAAAATUUUUUAGCUCUAUUAUUUGUGCAAAUAAUAGAGCUAAAAAAUU13.7-10.322


Target Position: 7737, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7737CAUCAGAAGAAUUAUUUCU83.78691856

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7735-7757TGCATCAGAAGAATTATTTCTTCAGAAAUAAUUCUUCUGAUGCACAUCAGAAGAAUUAUUUCUUCU2.120.432


Target Position: 316, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
316CAAAAAAGAGCAUUAGAUA97.9667113

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
314-336CCCAAAAAAGAGCATTAGATATTUAUCUAAUGCUCUUUUUUGGGCAAAAAAGAGCAUUAGAUAUUU6.6-5.922


Target Position: 1804, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1804GCUGUAAGAAAAAUCUGUA95.3021234

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1802-1824AAGCTGTAAGAAAAATCTGTAGTUACAGAUUUUUCUUACAGCUUGCUGUAAGAAAAAUCUGUAGUU19.216.422


Target Position: 8233, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8233GAUUGAAUGUGACUUCAUA105.8745

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8231-8253TGGATTGAATGTGACTTCATAACUAUGAAGUCACAUUCAAUCCAGAUUGAAUGUGACUUCAUAACU19.27.223


Target Position: 3120, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3120GCAUGAUGUACAGUUUAGU81.42732397

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3118-3140CTGCATGATGTACAGTTTAGTACACUAAACUGUACAUCAUGCAGGCAUGAUGUACAGUUUAGUACU9.819.423


Target Position: 5596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5596UGAAAAACAAAGCACAAAU75.72393805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9145614TGAAAAACAAAGCACAAATATTTGTGCTTTGTTTTTCA0.290700.234700.715500.750001.000001.00000


Target Position: 7481, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7481CAUUUUACAUAUAGUUUAU93.3305400

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7479-7501TACATTTTACATATAGTTTATTTAUAAACUAUAUGUAAAAUGUACAUUUUACAUAUAGUUUAUUUU6.6-0.321


Target Position: 303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
303UGAAUCAGAUUCCCAAAAA81.79072289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811321TGAATCAGATTCCCAAAAATTTTTGGGAATCTGATTCA0.322000.108900.724100.750001.000001.00000


Target Position: 4351, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4351GUUUUUACAUAUCAUAAGA90.147736

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4349-4371CTGTTTTTACATATCATAAGAAAUCUUAUGAUAUGUAAAAACAGGUUUUUACAUAUCAUAAGAAAU13.40.022


Target Position: 5791, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5791CUGAUUUGAUAAAUAAUUA94.9053255

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5789-5811TCCTGATTTGATAAATAATTAGTUAAUUAUUUAUCAAAUCAGGACUGAUUUGAUAAAUAAUUAGUU-10.313.822


Target Position: 6855, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6855GCACAAAUGUUUAAUGUAA98.612694

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6853-6875CTGCACAAATGTTTAATGTAAATUUACAUUAAACAUUUGUGCAGGCACAAAUGUUUAAUGUAAAUU8.512.121


Target Position: 1397, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1397GUUCUACUGUAGAAAUCAU92.9819434

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1395-1417GAGTTCTACTGTAGAAATCATTAAUGAUUUCUACAGUAGAACUCGUUCUACUGUAGAAAUCAUUAU16.318.932


Target Position: 8134, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8134GUAAUUAAUCUUACCUAUA94.7508265

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8132-8154TGGTAATTAATCTTACCTATAAGUAUAGGUAAGAUUAAUUACCAGUAAUUAAUCUUACCUAUAAGU19.8-7.513


Target Position: 533, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
533CUAUUUAUCCUUCUACUUA94.438293

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
531-553TTCTATTTATCCTTCTACTTACAUAAGUAGAAGGAUAAAUAGAACUAUUUAUCCUUCUACUUACAU18.9-8.023


Target Position: 4568, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4568CCAAAAGGAAAAUUGAGUU78.55963094

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4566-4588AGCCAAAAGGAAAATTGAGTTAAAACUCAAUUUUCCUUUUGGCUCCAAAAGGAAAAUUGAGUUAAU19.216.122


Target Position: 1400, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1400CUACUGUAGAAAUCAUUAU85.13791564

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1398-1420TTCTACTGTAGAAATCATTATAAAUAAUGAUUUCUACAGUAGAACUACUGUAGAAAUCAUUAUAAU8.720.232


Target Position: 7345, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7345CUUCCAUUAUAAGAAAUCU81.36062412

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7343-7365CACTTCCATTATAAGAAATCTGGAGAUUUCUUAUAAUGGAAGUGCUUCCAUUAUAAGAAAUCUGGU14.820.122


Target Position: 6811, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6811GACAAUCGCCAAUUCAGUU84.76091656

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6809-6831AGGACAATCGCCAATTCAGTTTCAACUGAAUUGGCGAUUGUCCUGACAAUCGCCAAUUCAGUUUCU19.221.133


Target Position: 8065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8065CCCCACUAUCAUAAUCCAU79.61762825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2138083CCCCACTATCATAATCCATATGGATTATGATAGTGGGG0.642900.544700.836201.000001.000001.00000


Target Position: 3512, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3512CUUUACAGAUGAUAAAGAU89.4179846

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3510-3532AGCTTTACAGATGATAAAGATTAAUCUUUAUCAUCUGUAAAGCUCUUUACAGAUGAUAAAGAUUAU6.911.821


Target Position: 2820, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2820CUGGAAAUGGGUUAAUCUU79.56822841

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2818-2840AACTGGAAATGGGTTAATCTTGCAAGAUUAACCCAUUUCCAGUUCUGGAAAUGGGUUAAUCUUGCU6.920.131


Target Position: 666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666GACACCUGCCACACCCUUU79.39722875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
971684GACACCTGCCACACCCTTTAAAGGGTGTGGCAGGTGTC0.428100.366100.819000.750001.000001.00000


Target Position: 3855, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3855CAUGUUUCACAUUGACUUU84.9161622

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3853-3875CACATGTTTCACATTGACTTTGGAAAGUCAAUGUGAAACAUGUGCAUGUUUCACAUUGACUUUGGU19.214.812


Target Position: 7477, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7477CAUACAUUUUACAUAUAGU92.6067465

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7475-7497CACATACATTTTACATATAGTTTACUAUAUGUAAAAUGUAUGUGCAUACAUUUUACAUAUAGUUUU4.96.721


Target Position: 8192, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8192GAUGUAUAAUAUUUUUAUU95.8095202

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8190-8212AAGATGTATAATATTTTTATTAAAAUAAAAAUAUUAUACAUCUUGAUGUAUAAUAUUUUUAUUAAU-9.78.221


Target Position: 7426, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7426GUUUUCUCUUAAUUUAACU78.10623203

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7424-7446ATGTTTTCTCTTAATTTAACTCAAGUUAAAUUAAGAGAAAACAUGUUUUCUCUUAAUUUAACUCAU-0.314.822


Target Position: 3238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3238GGAGUAGCAGAAAAAGUAA99.449473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6163256GGAGTAGCAGAAAAAGTAATTACTTTTTCTGCTACTCC0.657800.132300.836201.000001.000001.00000


Target Position: 5844, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5844GACAAGAAAUUAUGUACAU90.9786632

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5842-5864AAGACAAGAAATTATGTACATGTAUGUACAUAAUUUCUUGUCUUGACAAGAAAUUAUGUACAUGUU20.419.222


Target Position: 4290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4290CCUUUCAUUUUCACCUAAA88.5525970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1964308CCTTTCATTTTCACCTAAATTTAGGTGAAAATGAAAGG0.662800.452200.844801.000001.000001.00000


Target Position: 3121, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3121CAUGAUGUACAGUUUAGUA101.36838

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3119-3141TGCATGATGTACAGTTTAGTACCUACUAAACUGUACAUCAUGCACAUGAUGUACAGUUUAGUACCU12.920.522


Target Position: 1717, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1717GAAGAACUCUUAGAUUCUU88.20341014

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1715-1737TTGAAGAACTCTTAGATTCTTATAAGAAUCUAAGAGUUCUUCAAGAAGAACUCUUAGAUUCUUAUU19.117.722


Target Position: 5395, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5395CUAAUUCCUGAAAAAGACU74.65244096

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5393-5415TACTAATTCCTGAAAAAGACTTTAGUCUUUUUCAGGAAUUAGUACUAAUUCCUGAAAAAGACUUUU13.315.532


Target Position: 7201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7201AGCCACUGUAAUUUAAAAA82.80132064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9047219AGCCACTGTAATTTAAAAATTTTTAAATTACAGTGGCT0.786700.382500.853400.750001.000001.00000


Target Position: 4295, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4295CAUUUUCACCUAAAACAUA94.7366267

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4293-4315TTCATTTTCACCTAAAACATACTUAUGUUUUAGGUGAAAAUGAACAUUUUCACCUAAAACAUACUU5.37.422


Target Position: 5370, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5370CUACAAACCCUAAACUUAA93.5644378

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5368-5390TGCTACAAACCCTAAACTTAATAUUAAGUUUAGGGUUUGUAGCACUACAAACCCUAAACUUAAUAU4.914.733


Target Position: 6965, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6965CUAAUGGUCCAUAUGUAGU76.99983501

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6963-6985CACTAATGGTCCATATGTAGTTAACUACAUAUGGACCAUUAGUGCUAAUGGUCCAUAUGUAGUUAU13.120.032


Target Position: 4575, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4575GAAAAUUGAGUUAAACAGU81.26182435

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4573-4595AGGAAAATTGAGTTAAACAGTTAACUGUUUAACUCAAUUUUCCUGAAAAUUGAGUUAAACAGUUAU11.8-3.322


Target Position: 3314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3314AGUCCUUUUUUCAGAAAAA89.252872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8863332AGTCCTTTTTTCAGAAAAATTTTTCTGAAAAAAGGACT0.296400.090400.706900.750000.934800.62500


Target Position: 3317, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3317CCUUUUUUCAGAAAAAUAA87.75481079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3843335CCTTTTTTCAGAAAAATAATTATTTTTCTGAAAAAAGG0.549600.207300.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3315-3337GTCCTTTTTTCAGAAAAATAAATUUAUUUUUCUGAAAAAAGGACCCUUUUUUCAGAAAAAUAAAUU-9.7-5.921


Target Position: 8074, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8074CAUAAUCCAUACAUUCAUU91.9879524

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8072-8094ATCATAATCCATACATTCATTTCAAUGAAUGUAUGGAUUAUGAUCAUAAUCCAUACAUUCAUUUCU13.615.432


Target Position: 3078, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3078CCAGAUAGCACACAAUUUA92.0585519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7473096CCAGATAGCACACAATTTATAAATTGTGTGCTATCTGG0.339300.178100.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3076-3098ATCCAGATAGCACACAATTTATAUAAAUUGUGUGCUAUCUGGAUCCAGAUAGCACACAAUUUAUAU5.317.823


Target Position: 7793, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7793CUCAAAGAACCUAUUAUUU80.80652538

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7791-7813CACTCAAAGAACCTATTATTTTCAAAUAAUAGGUUCUUUGAGUGCUCAAAGAACCUAUUAUUUUCU-8.020.422


Target Position: 5619, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5619GAUAGCUAAGUUAAGAACU81.10992474

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5617-5639TAGATAGCTAAGTTAAGAACTACAGUUCUUAACUUAGCUAUCUAGAUAGCUAAGUUAAGAACUACU14.619.533


Target Position: 7033, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7033GUUGUCUAUUUAAUGUUAA89.5125830

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7031-7053GTGTTGTCTATTTAATGTTAATTUUAACAUUAAAUAGACAACACGUUGUCUAUUUAAUGUUAAUUU6.920.312


Target Position: 5933, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5933CUAAUACCUGAAUAAGACU81.94082247

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5931-5953GCCTAATACCTGAATAAGACTCAAGUCUUAUUCAGGUAUUAGGCCUAAUACCUGAAUAAGACUCAU14.515.332


Target Position: 2166, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2166GGUAUCAAAUUAUGAAAAA94.9293252

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2164-2186TGGGTATCAAATTATGAAAAATAUUUUUCAUAAUUUGAUACCCAGGUAUCAAAUUAUGAAAAAUAU7.416.132


Target Position: 2315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2315AGAUAUCACAAUUGCCAUU80.48642627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5402333AGATATCACAATTGCCATTAATGGCAATTGTGATATCT0.497700.355000.715500.750000.962000.75000


Target Position: 6210, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6210GUGUGUAAACAUUUUACAU90.294710

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6208-6230ATGTGTGTAAACATTTTACATTCAUGUAAAAUGUUUACACACAUGUGUGUAAACAUUUUACAUUCU7.220.422


Target Position: 7468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7468UCAAACACACAUACAUUUU70.6865101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7917486TCAAACACACATACATTTTAAAATGTATGTGTGTTTGA0.690400.342600.724100.750001.000001.00000


Target Position: 125, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
125CAACAAGAGCAAAAGAUGU82.44182140

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
123-145ACCAACAAGAGCAAAAGATGTGGACAUCUUUUGCUCUUGUUGGUCAACAAGAGCAAAAGAUGUGGU12.019.222


Target Position: 7569, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7569CAAUAAAUUUUAAAUCAGU87.33551146

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7567-7589ATCAATAAATTTTAAATCAGTTGACUGAUUUAAAAUUUAUUGAUCAAUAAAUUUUAAAUCAGUUGU12.0-10.322


Target Position: 418, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
418CCAGUUACUCCUAUUCUGA88.4991975

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
416-438TACCAGTTACTCCTATTCTGAGCUCAGAAUAGGAGUAACUGGUACCAGUUACUCCUAUUCUGAGCU13.419.031


Target Position: 4099, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4099CUUACAAGUAUUCAAGAUU81.34362417

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4097-4119AACTTACAAGTATTCAAGATTTGAAUCUUGAAUACUUGUAAGUUCUUACAAGUAUUCAAGAUUUGU20.411.822


Target Position: 5985, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5985CCAUUAAAAUCCUACAUUU91.893536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1916003CCATTAAAATCCTACATTTAAATGTAGGATTTTAATGG0.666400.574600.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5983-6005TTCCATTAAAATCCTACATTTATAAAUGUAGGAUUUUAAUGGAACCAUUAAAAUCCUACAUUUAUU11.6-1.421


Target Position: 5793, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5793GAUUUGAUAAAUAAUUAGU84.07491789

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5791-5813CTGATTTGATAAATAATTAGTACACUAAUUAUUUAUCAAAUCAGGAUUUGAUAAAUAAUUAGUACU-2.37.222


Target Position: 1347, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1347CAUUGACAUUGAAGGAUUU90.0197754

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1345-1367TCCATTGACATTGAAGGATTTCAAAAUCCUUCAAUGUCAAUGGACAUUGACAUUGAAGGAUUUCAU18.720.522


Target Position: 1780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1780CGAGCAGUAGAUCAAGUAA99.711867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8461798CGAGCAGTAGATCAAGTAATTACTTGATCTACTGCTCG0.656000.090000.758601.000001.000001.00000


Target Position: 610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
610ACAGAACCUAUAUAUUUAA90.9302639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
922628ACAGAACCTATATATTTAATTAAATATATAGGTTCTGT0.712100.503300.672400.750001.000001.00000


Target Position: 385, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
385GACAGUUUCGAGACUAAAA96.507163

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
383-405ATGACAGTTTCGAGACTAAAAAAUUUUAGUCUCGAAACUGUCAUGACAGUUUCGAGACUAAAAAAU14.617.832


Target Position: 7920, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7920CUUUUUUCAAAUUAAAGUU74.7834056

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7918-7940TTCTTTTTTCAAATTAAAGTTGTAACUUUAAUUUGAAAAAAGAACUUUUUUCAAAUUAAAGUUGUU4.90.722


Target Position: 3984, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3984CAUUCGUUUUCAGUUGUUU80.26142674

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3982-4004ACCATTCGTTTTCAGTTGTTTGTAAACAACUGAAAACGAAUGGUCAUUCGUUUUCAGUUGUUUGUU17.815.223


Target Position: 4103, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4103CAAGUAUUCAAGAUUUGAA97.6097123

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4101-4123TACAAGTATTCAAGATTTGAAATUUCAAAUCUUGAAUACUUGUACAAGUAUUCAAGAUUUGAAAUU16.34.622


Target Position: 7488, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7488CAUAUAGUUUAUUUCUUUA100.57147

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7486-7508TACATATAGTTTATTTCTTTATGUAAAGAAAUAAACUAUAUGUACAUAUAGUUUAUUUCUUUAUGU5.56.112


Target Position: 1993, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1993GUAAGCAUAAACCAAUUAA89.244874

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1991-2013AAGTAAGCATAAACCAATTAACTUUAAUUGGUUUAUGCUUACUUGUAAGCAUAAACCAAUUAACUU12.819.732


Target Position: 8185, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8185GAAUAAAGAUGUAUAAUAU105.8386

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8183-8205GTGAATAAAGATGTATAATATTTAUAUUAUACAUCUUUAUUCACGAAUAAAGAUGUAUAAUAUUUU-5.9-4.321


Target Position: 3507, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3507GUUAGCUUUACAGAUGAUA81.73822306

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3505-3527ATGTTAGCTTTACAGATGATAAAUAUCAUCUGUAAAGCUAACAUGUUAGCUUUACAGAUGAUAAAU20.418.323


Target Position: 6797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6797ACCAAGAGAGAAAGGACAA81.59032353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9936815ACCAAGAGAGAAAGGACAATTGTCCTTTCTCTCTTGGT0.268300.173000.706900.750001.000001.00000


Target Position: 7613, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7613CUGACAUUAAAGUAAAUCU83.14651994

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7611-7633AGCTGACATTAAAGTAAATCTAAAGAUUUACUUUAAUGUCAGCUCUGACAUUAAAGUAAAUCUAAU10.020.532


Target Position: 7771, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7771GGGAUUUGAAGAUAAUGGU79.41182873

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7769-7791TTGGGATTTGAAGATAATGGTTCACCAUUAUCUUCAAAUCCCAAGGGAUUUGAAGAUAAUGGUUCU12.620.123


Target Position: 7875, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7875CUAUAGGUAUCUAAAUGUU89.6057815

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7873-7895ATCTATAGGTATCTAAATGTTAAAACAUUUAGAUACCUAUAGAUCUAUAGGUAUCUAAAUGUUAAU6.919.833


Target Position: 5955, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5955CAAUGUGAUUGUACAAUAA104.0979

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5953-5975ACCAATGTGATTGTACAATAAATUUAUUGUACAAUCACAUUGGUCAAUGUGAUUGUACAAUAAAUU8.520.521


Target Position: 7672, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7672GUAUAAUCACAAUAUUUUA100.56948

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7670-7692ATGTATAATCACAATATTTTATAUAAAAUAUUGUGAUUAUACAUGUAUAAUCACAAUAUUUUAUAU-10.33.522


Target Position: 4184, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4184GGCUUAUUGAAUCAAGUUU82.46662136

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4182-4204TAGGCTTATTGAATCAAGTTTGGAAACUUGAUUCAAUAAGCCUAGGCUUAUUGAAUCAAGUUUGGU19.213.632


Target Position: 8164, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8164CUUUAAUUAUAUUAAGAUA100.2657

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8162-8184TACTTTAATTATATTAAGATAGTUAUCUUAAUAUAAUUAAAGUACUUUAAUUAUAUUAAGAUAGUU6.9-9.722


Target Position: 2762, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2762GUUAUUAUUGCUUCAAACA85.2531535

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2760-2782ACGTTATTATTGCTTCAAACACCUGUUUGAAGCAAUAAUAACGUGUUAUUAUUGCUUCAAACACCU14.9-8.033


Target Position: 2441, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2441CUUUACCUCUUUUUGACUU75.01174000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2439-2461TTCTTTACCTCTTTTTGACTTTAAAGUCAAAAAGAGGUAAAGAACUUUACCUCUUUUUGACUUUAU19.218.622


Target Position: 7142, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7142GUACUAGUAAUUUUCACUU83.59131891

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7140-7162ATGTACTAGTAATTTTCACTTAAAAGUGAAAAUUACUAGUACAUGUACUAGUAAUUUUCACUUAAU19.218.822


Target Position: 7630, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7630CUAAAAAAAGUUUAACAAA90.1116741

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7628-7650ATCTAAAAAAAGTTTAACAAACTUUUGUUAAACUUUUUUUAGAUCUAAAAAAAGUUUAACAAACUU7.2-9.122


Target Position: 2783, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2783CAAAUUGUCUUCCUAAAAU86.84971233

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2781-2803CCCAAATTGTCTTCCTAAAATATAUUUUAGGAAGACAAUUUGGGCAAAUUGUCUUCCUAAAAUAUU11.05.322


Target Position: 5510, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5510CUUUACCACUGUGUAAUGU71.71254860

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5508-5530GCCTTTACCACTGTGTAATGTTCACAUUACACAGUGGUAAAGGCCUUUACCACUGUGUAAUGUUCU13.520.003


Target Position: 7615, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7615GACAUUAAAGUAAAUCUAA97.135141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6617633GACATTAAAGTAAATCTAATTAGATTTACTTTAATGTC0.386600.297600.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7613-7635CTGACATTAAAGTAAATCTAAAAUUAGAUUUACUUUAAUGUCAGGACAUUAAAGUAAAUCUAAAAU6.96.922


Target Position: 1733, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1733CUUAUCACAACCAAGUAGA78.06663216

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1731-1753TTCTTATCACAACCAAGTAGAACUCUACUUGGUUGUGAUAAGAACUUAUCACAACCAAGUAGAACU16.416.133


Target Position: 5597, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5597GAAAAACAAAGCACAAAUA94.3683297

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5595-5617CTGAAAAACAAAGCACAAATAATUAUUUGUGCUUUGUUUUUCAGGAAAAACAAAGCACAAAUAAUU12.15.611


Target Position: 6773, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6773CUGACAAAAUAUGCAAUAA92.3685482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7896791CTGACAAAATATGCAATAATTATTGCATATTTTGTCAG0.328100.133600.750000.750000.994600.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6771-6793AACTGACAAAATATGCAATAAAGUUAUUGCAUAUUUUGUCAGUUCUGACAAAAUAUGCAAUAAAGU21.120.522


Target Position: 3822, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3822CAAUGACAAUAUAAUGCUU94.2736312

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3820-3842CACAATGACAATATAATGCTTCGAAGCAUUAUAUUGUCAUUGUGCAAUGACAAUAUAAUGCUUCGU19.720.523


Target Position: 3498, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3498GCAAGAUAUGUUAGCUUUA94.4912290

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3496-3518CGGCAAGATATGTTAGCTTTACAUAAAGCUAACAUAUCUUGCCGGCAAGAUAUGUUAGCUUUACAU18.313.422


Target Position: 119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
119CGGAACCAACAAGAGCAAA81.71932316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
305137CGGAACCAACAAGAGCAAATTTGCTCTTGTTGGTTCCG0.576400.460600.913801.000001.000001.00000


Target Position: 7988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7988GGAUUCAAAUAUUGUGACA93.9225349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9968006GGATTCAAATATTGTGACATGTCACAATATTTGAATCC0.287800.128900.663800.750001.000001.00000


Target Position: 5314, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5314CUAACCUUUUUGAAUUUUU75.8463763

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5312-5334AACTAACCTTTTTGAATTTTTGGAAAAAUUCAAAAAGGUUAGUUCUAACCUUUUUGAAUUUUUGGU0.418.622


Target Position: 6699, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6699CAUGGUUAGAAUAGAAAUA94.1066331

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6697-6719CTCATGGTTAGAATAGAAATACAUAUUUCUAUUCUAACCAUGAGCAUGGUUAGAAUAGAAAUACAU6.920.022


Target Position: 2262, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2262CAAGAAUUUCUUCUAUCUU87.00371209

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2260-2282TACAAGAATTTCTTCTATCTTATAAGAUAGAAGAAAUUCUUGUACAAGAAUUUCUUCUAUCUUAUU20.25.321


Target Position: 6766, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6766GAGAAAACUGACAAAAUAU94.8558259

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6764-6786GTGAGAAAACTGACAAAATATGCAUAUUUUGUCAGUUUUCUCACGAGAAAACUGACAAAAUAUGCU-1.413.312


Target Position: 4639, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4639GAUCUUGUUUGUACUUUCU85.57161473

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4637-4659GTGATCTTGTTTGTACTTTCTTCAGAAAGUACAAACAAGAUCACGAUCUUGUUUGUACUUUCUUCU14.619.222


Target Position: 8060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8060UGAACCCCCACUAUCAUAA77.68983323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7348078TGAACCCCCACTATCATAATTATGATAGTGGGGGTTCA0.734900.275700.689700.750001.000001.00000


Target Position: 3816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3816UCGACACAAUGACAAUAUA87.90821053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9333834TCGACACAATGACAATATATATATTGTCATTGTGTCGA0.609200.076600.750000.750001.000001.00000


Target Position: 7082, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7082CUUUUUCCACAGAUCAUUA91.3576600

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7080-7102TGCTTTTTCCACAGATCATTAACUAAUGAUCUGUGGAAAAAGCACUUUUUCCACAGAUCAUUAACU16.214.322


Target Position: 5214, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5214CUUGUUAAUUUUGUAUAGU73.84154307

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5212-5234CACTTGTTAATTTTGTATAGTATACUAUACAAAAUUAACAAGUGCUUGUUAAUUUUGUAUAGUAUU13.17.222


Target Position: 8253, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8253CUGUACUACGAUUGUAUUA88.3358997

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8251-8273AACTGTACTACGATTGTATTAAAUAAUACAAUCGUAGUACAGUUCUGUACUACGAUUGUAUUAAAU6.920.233


Target Position: 5685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5685UCAUGUCUUUAAAGCCUUU74.70924078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8205703TCATGTCTTTAAAGCCTTTAAAGGCTTTAAAGACATGA0.484100.232900.724100.750001.000001.00000


Target Position: 8025, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8025CACUUUUGAAACUUAGACU81.94612245

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8023-8045TTCACTTTTGAAACTTAGACTTCAGUCUAAGUUUCAAAAGUGAACACUUUUGAAACUUAGACUUCU18.910.313


Target Position: 5691, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5691CUUUAAAGCCUUUUUCAGA84.27971753

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5689-5711GTCTTTAAAGCCTTTTTCAGAATUCUGAAAAAGGCUUUAAAGACCUUUAAAGCCUUUUUCAGAAUU12.2-3.822


Target Position: 2480, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2480GAACUAAACUUCUAUAUCU97.5267125

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2478-2500TGGAACTAAACTTCTATATCTTTAGAUAUAGAAGUUUAGUUCCAGAACUAAACUUCUAUAUCUUUU8.24.932


Target Position: 3519, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3519GAUGAUAAAGAUUAUGGAU92.9764435

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3517-3539CAGATGATAAAGATTATGGATAAAUCCAUAAUCUUUAUCAUCUGGAUGAUAAAGAUUAUGGAUAAU21.28.722


Target Position: 8005, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8005CAUUUAAAAAAGAAAACAU88.2161012

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8003-8025GACATTTAAAAAAGAAAACATTCAUGUUUUCUUUUUUAAAUGUCCAUUUAAAAAAGAAAACAUUCU14.9-9.710


Target Position: 6764, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6764GUGAGAAAACUGACAAAAU89.3561859

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6762-6784CTGTGAGAAAACTGACAAAATATAUUUUGUCAGUUUUCUCACAGGUGAGAAAACUGACAAAAUAUU14.920.422


Target Position: 8281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8281UGGAAUAAAAAAAAAAAAA78.16553193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5788299TGGAATAAAAAAAAAAAAATTTTTTTTTTTTTATTCCA0.986300.569200.844800.750001.000001.00000


Target Position: 459, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
459CUAUUUUAGACCUACUAUU84.67241676

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
457-479CTCTATTTTAGACCTACTATTCAAAUAGUAGGUCUAAAAUAGAGCUAUUUUAGACCUACUAUUCAU11.2-7.531


Target Position: 757, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
757GCUAGUACAUCAGAAUUUU86.73581260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
636775GCTAGTACATCAGAATTTTAAAATTCTGATGTACTAGC0.379100.172300.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
755-777TAGCTAGTACATCAGAATTTTTAAAAAUUCUGAUGUACUAGCUAGCUAGUACAUCAGAAUUUUUAU5.318.821


Target Position: 2258, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2258CUUACAAGAAUUUCUUCUA89.2188876

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2256-2278CACTTACAAGAATTTCTTCTATCUAGAAGAAAUUCUUGUAAGUGCUUACAAGAAUUUCUUCUAUCU19.111.822


Target Position: 8066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8066CCCACUAUCAUAAUCCAUA90.8266649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2738084CCCACTATCATAATCCATATATGGATTATGATAGTGGG0.603200.519500.948301.000001.000001.00000


Target Position: 7374, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7374CUAAGUGUAUAUUAUAAUA102.05529

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7372-7394ATCTAAGTGTATATTATAATACTUAUUAUAAUAUACACUUAGAUCUAAGUGUAUAUUAUAAUACUU-8.019.012


Target Position: 6594, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6594CAUCUUAAAAAAAAAGAAA90.1808732

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6592-6614TCCATCTTAAAAAAAAAGAAAAAUUUCUUUUUUUUUAAGAUGGACAUCUUAAAAAAAAAGAAAAAU5.56.910


Target Position: 5877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5877CCCACAAAAAAAUCCUUUA84.67011677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4265895CCCACAAAAAAATCCTTTATAAAGGATTTTTTTGTGGG0.489300.397400.956901.000001.000001.00000


Target Position: 134, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
134CAAAAGAUGUGGACAAAGA92.1311510

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
132-154AGCAAAAGATGTGGACAAAGAAGUCUUUGUCCACAUCUUUUGCUCAAAAGAUGUGGACAAAGAAGU19.25.320


Target Position: 5689, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5689GUCUUUAAAGCCUUUUUCA84.47751718

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5687-5709ATGTCTTTAAAGCCTTTTTCAGAUGAAAAAGGCUUUAAAGACAUGUCUUUAAAGCCUUUUUCAGAU5.57.122


Target Position: 1075, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1075CAGUCUUUAAAUAUUCGAA94.7064270

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1073-1095GCCAGTCTTTAAATATTCGAACAUUCGAAUAUUUAAAGACUGGCCAGUCUUUAAAUAUUCGAACAU17.917.723


Target Position: 8148, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8148CUAUAAGAACCAAAUACUU86.86381227

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8146-8168ACCTATAAGAACCAAATACTTTAAAGUAUUUGGUUCUUAUAGGUCUAUAAGAACCAAAUACUUUAU4.68.422


Target Position: 6585, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6585GCAAAACUCCAUCUUAAAA92.6383464

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6583-6605GAGCAAAACTCCATCTTAAAAAAUUUUAAGAUGGAGUUUUGCUCGCAAAACUCCAUCUUAAAAAAU7.110.300


Target Position: 5057, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5057CUUUGAAAGAUUUCAACUU79.66492815

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5055-5077GCCTTTGAAAGATTTCAACTTGAAAGUUGAAAUCUUUCAAAGGCCUUUGAAAGAUUUCAACUUGAU19.27.722


Target Position: 5226, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5226GUAUAGUAUUUUUAUACUU91.3197606

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5224-5246TTGTATAGTATTTTTATACTTGGAAGUAUAAAAAUACUAUACAAGUAUAGUAUUUUUAUACUUGGU6.37.912


Target Position: 3674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3674CAGGAUCCUUUAAAGAUAA95.3896227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8893692CAGGATCCTTTAAAGATAATTATCTTTAAAGGATCCTG0.585400.082000.750000.750000.983700.75000


Target Position: 1118, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1118GCCAUAUAUCUCAGAAAGA89.776789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6681136GCCATATATCTCAGAAAGATCTTTCTGAGATATATGGC0.366700.302600.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1116-1138GGGCCATATATCTCAGAAAGACCUCUUUCUGAGAUAUAUGGCCCGCCAUAUAUCUCAGAAAGACCU16.614.023


Target Position: 7204, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7204CACUGUAAUUUAAAAACAA98.946986

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7202-7224GCCACTGTAATTTAAAAACAAACUUGUUUUUAAAUUACAGUGGCCACUGUAAUUUAAAAACAAACU5.619.021


Target Position: 3079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3079CAGAUAGCACACAAUUUAU92.7084457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6943097CAGATAGCACACAATTTATATAAATTGTGTGCTATCTG0.357100.175700.741400.750001.000001.00000


Target Position: 4839, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4839CCCAAAUCCAUAUGUCAAA85.58791467

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4837-4859GACCCAAATCCATATGTCAAAACUUUGACAUAUGGAUUUGGGUCCCCAAAUCCAUAUGUCAAAACU20.520.122


Target Position: 6963, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6963CACUAAUGGUCCAUAUGUA103.22716

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6961-6983AACACTAATGGTCCATATGTAGTUACAUAUGGACCAUUAGUGUUCACUAAUGGUCCAUAUGUAGUU13.311.622


Target Position: 388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
388AGUUUCGAGACUAAAAAAA81.23282443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
649406AGTTTCGAGACTAAAAAAATTTTTTTAGTCTCGAAACT0.686700.122200.706900.750001.000001.00000


Target Position: 143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
143UGGACAAAGAAGAAGCAUU76.50473614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
878161TGGACAAAGAAGAAGCATTAATGCTTCTTCTTTGTCCA0.298500.138600.836200.750001.000001.00000


Target Position: 5248, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5248CAGAACUUAUAAAGUUAAA92.2535494

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5246-5268GACAGAACTTATAAAGTTAAATAUUUAACUUUAUAAGUUCUGUCCAGAACUUAUAAAGUUAAAUAU4.917.723


Target Position: 5717, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5717CCAAUCACUGAUGUUGUAA84.15141781

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5715-5737TGCCAATCACTGATGTTGTAAATUUACAACAUCAGUGAUUGGCACCAAUCACUGAUGUUGUAAAUU20.420.533


Target Position: 608, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
608CUACAGAACCUAUAUAUUU89.3468860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
903626CTACAGAACCTATATATTTAAATATATAGGTTCTGTAG0.746300.518000.672400.750000.962000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
606-628ATCTACAGAACCTATATATTTAAAAAUAUAUAGGUUCUGUAGAUCUACAGAACCUAUAUAUUUAAU-8.620.311


Target Position: 1663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1663CACCUGUAUCAAAUAGAAA95.8743199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9971681CACCTGTATCAAATAGAAATTTCTATTTGATACAGGTG0.634200.069700.793100.750001.000001.00000


Target Position: 4111, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4111CAAGAUUUGAAAUACGUUA90.9731633

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4109-4131TTCAAGATTTGAAATACGTTAGAUAACGUAUUUCAAAUCUUGAACAAGAUUUGAAAUACGUUAGAU14.95.313


Target Position: 3035, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3035GUUCAUUAGUGCAAUUCCU79.15882934

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3033-3055TAGTTCATTAGTGCAATTCCTTTAGGAAUUGCACUAAUGAACUAGUUCAUUAGUGCAAUUCCUUUU20.18.923


Target Position: 5798, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5798GAUAAAUAAUUAGUACAUA101.25139

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5796-5818TTGATAAATAATTAGTACATAGTUAUGUACUAAUUAUUUAUCAAGAUAAAUAAUUAGUACAUAGUU19.0-8.032


Target Position: 3944, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3944CUGAUAUGGCAUAUGUCAU85.92011411

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3942-3964CTCTGATATGGCATATGTCATTAAUGACAUAUGCCAUAUCAGAGCUGAUAUGGCAUAUGUCAUUAU21.514.932


Target Position: 2549, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2549GAUAUGUCAUGGAAAGAAU93.7345365

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2547-2569AGGATATGTCATGGAAAGAATAGAUUCUUUCCAUGACAUAUCCUGAUAUGUCAUGGAAAGAAUAGU14.816.012


Target Position: 2782, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2782CCAAAUUGUCUUCCUAAAA86.63381275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5192800CCAAATTGTCTTCCTAAAATTTTAGGAAGACAATTTGG0.435800.321000.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2780-2802ACCCAAATTGTCTTCCTAAAATAUUUUAGGAAGACAAUUUGGGUCCAAAUUGUCUUCCUAAAAUAU19.94.212


Target Position: 3008, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3008CUUUGAAAUAUGAAAUUUA94.3406301

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3006-3028AGCTTTGAAATATGAAATTTACTUAAAUUUCAUAUUUCAAAGCUCUUUGAAAUAUGAAAUUUACUU0.47.721


Target Position: 4541, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4541GAAGAACACACAUAAAAGA93.2206410

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4539-4561AGGAAGAACACACATAAAAGATGUCUUUUAUGUGUGUUCUUCCUGAAGAACACACAUAAAAGAUGU-4.319.222


Target Position: 1850, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1850CCAUUACAGAAUCAGUAAA92.0988514

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1848-1870TGCCATTACAGAATCAGTAAAGAUUUACUGAUUCUGUAAUGGCACCAUUACAGAAUCAGUAAAGAU20.313.532


Target Position: 1449, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1449CUUGAAUCAAGUAGAUGUU80.07162716

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1447-1469GACTTGAATCAAGTAGATGTTGGAACAUCUACUUGAUUCAAGUCCUUGAAUCAAGUAGAUGUUGGU20.316.323


Target Position: 6055, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6055GUAAAUAAGUGAAAAUUGU81.59622351

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6053-6075CAGTAAATAAGTGAAAATTGTTAACAAUUUUCACUUAUUUACUGGUAAAUAAGUGAAAAUUGUUAU-3.3-7.522


Target Position: 326, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
326CAUUAGAUAUUGAUGUAGA98.863188

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
324-346AGCATTAGATATTGATGTAGAAAUCUACAUCAAUAUCUAAUGCUCAUUAGAUAUUGAUGUAGAAAU20.36.632


Target Position: 5891, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5891CUUUACUUCUGAUGUAUGA85.23291542

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5889-5911TCCTTTACTTCTGATGTATGAATUCAUACAUCAGAAGUAAAGGACUUUACUUCUGAUGUAUGAAUU13.34.933


Target Position: 6345, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6345CCUGUAAUCCCAACACUUU83.14281997

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6343-6365TGCCTGTAATCCCAACACTTTGGAAAGUGUUGGGAUUACAGGCACCUGUAAUCCCAACACUUUGGU17.811.600


Target Position: 7364, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7364GGAUUCAUAUCUAAGUGUA101.01440

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7362-7384CTGGATTCATATCTAAGTGTATAUACACUUAGAUAUGAAUCCAGGGAUUCAUAUCUAAGUGUAUAU19.016.222


Target Position: 7950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7950UCAAUAUCUUGCCUUAAAU77.68783324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5327968TCAATATCTTGCCTTAAATATTTAAGGCAAGATATTGA0.523200.276200.715500.750001.000001.00000


Target Position: 6142, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6142CCAGAUUGAACUUUAAUAU86.23741346

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6140-6162GTCCAGATTGAACTTTAATATAGAUAUUAAAGUUCAAUCUGGACCCAGAUUGAACUUUAAUAUAGU-7.518.132


Target Position: 7549, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7549CCUCUUUGCACUACUACUA88.6107959

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7547-7569AGCCTCTTTGCACTACTACTATCUAGUAGUAGUGCAAAGAGGCUCCUCUUUGCACUACUACUAUCU18.816.622


Target Position: 2895, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2895GGAACUUCUUGAUUCAAAA100.3256

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2893-2915TTGGAACTTCTTGATTCAAAATTUUUUGAAUCAAGAAGUUCCAAGGAACUUCUUGAUUCAAAAUUU7.421.522


Target Position: 1244, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1244CCAAAUUUCCAUAUACCAA91.8238546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6651262CCAAATTTCCATATACCAATTGGTATATGGAAATTTGG0.790900.374700.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1242-1264GACCAAATTTCCATATACCAATCUUGGUAUAUGGAAAUUUGGUCCCAAAUUUCCAUAUACCAAUCU21.1-3.332


Target Position: 2997, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2997GUUUGUACAAGCUUUGAAA92.5081472

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2995-3017CAGTTTGTACAAGCTTTGAAATAUUUCAAAGCUUGUACAAACUGGUUUGUACAAGCUUUGAAAUAU12.214.722


Target Position: 7270, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7270CAUGUACUGCCUUUUUGCA85.43621495

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7268-7290AACATGTACTGCCTTTTTGCAGTUGCAAAAAGGCAGUACAUGUUCAUGUACUGCCUUUUUGCAGUU14.119.023


Target Position: 5623, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5623GCUAAGUUAAGAACUACUA91.4972585

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5621-5643TAGCTAAGTTAAGAACTACTAAGUAGUAGUUCUUAACUUAGCUAGCUAAGUUAAGAACUACUAAGU17.69.832


Target Position: 2159, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2159GUAAUUGGGUAUCAAAUUA92.2124497

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2157-2179AAGTAATTGGGTATCAAATTATGUAAUUUGAUACCCAAUUACUUGUAAUUGGGUAUCAAAUUAUGU7.412.812


Target Position: 7870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7870UGAAUCUAUAGGUAUCUAA88.3652992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7907888TGAATCTATAGGTATCTAATTAGATACCTATAGATTCA0.327700.277000.689700.750001.000001.00000


Target Position: 7137, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7137CAAAUGUACUAGUAAUUUU93.2101413

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7135-7157TGCAAATGTACTAGTAATTTTCAAAAAUUACUAGUACAUUUGCACAAAUGUACUAGUAAUUUUCAU-0.36.932


Target Position: 3038, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3038CAUUAGUGCAAUUCCUUUU81.7932288

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3036-3058TTCATTAGTGCAATTCCTTTTGTAAAAGGAAUUGCACUAAUGAACAUUAGUGCAAUUCCUUUUGUU18.711.612


Target Position: 7912, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7912GAUCAUUUCUUUUUUCAAA96.4077169

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7910-7932TTGATCATTTCTTTTTTCAAATTUUUGAAAAAAGAAAUGAUCAAGAUCAUUUCUUUUUUCAAAUUU7.77.222


Target Position: 5745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5745CCUUAACUUUAUAUGCUUC76.79113547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8875763CCTTAACTTTATATGCTTCGAAGCATATAAAGTTAAGG0.681800.752500.672400.750001.000001.00000


Target Position: 3356, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3356CAAGUCUAGUGGCAAAAGA86.2041353

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3354-3376GCCAAGTCTAGTGGCAAAAGAATUCUUUUGCCACUAGACUUGGCCAAGUCUAGUGGCAAAAGAAUU18.618.922


Target Position: 509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
509GGCCUUCCACUUAUGCUUU79.07762948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
783527GGCCTTCCACTTATGCTTTAAAGCATAAGTGGAAGGCC0.654100.101501.000001.000001.000001.00000


Target Position: 2780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2780ACCCAAAUUGUCUUCCUAA86.71121261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6692798ACCCAAATTGTCTTCCTAATTAGGAAGACAATTTGGGT0.444500.283800.819000.750001.000001.00000


Target Position: 3007, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3007GCUUUGAAAUAUGAAAUUU83.44651922

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3005-3027AAGCTTTGAAATATGAAATTTACAAAUUUCAUAUUUCAAAGCUUGCUUUGAAAUAUGAAAUUUACU7.412.211


Target Position: 1473, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1473CUAUGUUCUAAAAGUUUGU74.83294041

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1471-1493AGCTATGTTCTAAAAGTTTGTGGACAAACUUUUAGAACAUAGCUCUAUGUUCUAAAAGUUUGUGGU10.316.122


Target Position: 508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
508GGGCCUUCCACUUAUGCUU77.91083266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
907526GGGCCTTCCACTTATGCTTAAGCATAAGTGGAAGGCCC0.395500.080200.853401.000001.000001.00000


Target Position: 8258, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8258CUACGAUUGUAUUAAAAUA99.388174

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8256-8278TACTACGATTGTATTAAAATATTUAUUUUAAUACAAUCGUAGUACUACGAUUGUAUUAAAAUAUUU-9.716.522


Target Position: 8282, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8282GGAAUAAAAAAAAAAAAAA92.6027466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1008300GGAATAAAAAAAAAAAAAATTTTTTTTTTTTTTATTCC0.988300.641200.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8280-8302CTGGAATAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUAUUCCAGGGAAUAAAAAAAAAAAAAAAAU-11.32.100


Target Position: 2171, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2171CAAAUUAUGAAAAAUACUA93.0107429

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2169-2191ATCAAATTATGAAAAATACTACTUAGUAUUUUUCAUAAUUUGAUCAAAUUAUGAAAAAUACUACUU4.6-10.322


Target Position: 3181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3181GGAAAACGACUUAGAGAAG79.03722966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8493199GGAAAACGACTTAGAGAAGCTTCTCTAAGTCGTTTTCC0.307000.189000.732800.750001.000001.00000


Target Position: 1223, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1223GAUCCAUUACAAAAUUGAA100.69944

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1221-1243TCGATCCATTACAAAATTGAAGAUUCAAUUUUGUAAUGGAUCGAGAUCCAUUACAAAAUUGAAGAU7.420.122


Target Position: 7430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7430UCUCUUAAUUUAACUCAUU75.69823824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5667448TCTCTTAATTTAACTCATTAATGAGTTAAATTAAGAGA0.671300.199800.715500.750001.000001.00000


Target Position: 736, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736GCAAAACUAUUUGACAAAA90.3235706

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
734-756TGGCAAAACTATTTGACAAAATAUUUUGUCAAAUAGUUUUGCCAGCAAAACUAUUUGACAAAAUAU20.510.322


Target Position: 8183, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8183GUGAAUAAAGAUGUAUAAU84.19641774

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8181-8203TAGTGAATAAAGATGTATAATATAUUAUACAUCUUUAUUCACUAGUGAAUAAAGAUGUAUAAUAUU8.58.921


Target Position: 5346, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5346GUUUUAAAGUCAUUAUGUA98.642793

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5344-5366CTGTTTTAAAGTCATTATGTAGAUACAUAAUGACUUUAAAACAGGUUUUAAAGUCAUUAUGUAGAU6.7-9.111


Target Position: 4022, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4022CCUACAACUUGAUAAGAAA99.915661

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4020-4042GGCCTACAACTTGATAAGAAAGCUUUCUUAUCAAGUUGUAGGCCCCUACAACUUGAUAAGAAAGCU6.919.021


Target Position: 5440, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5440CACCUAUUUUGCAUUGUUU86.22131350

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5438-5460GCCACCTATTTTGCATTGTTTTCAAACAAUGCAAAAUAGGUGGCCACCUAUUUUGCAUUGUUUUCU12.118.532


Target Position: 3817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3817CGACACAAUGACAAUAUAA99.893462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7693835CGACACAATGACAATATAATTATATTGTCATTGTGTCG0.574100.103900.758601.000001.000001.00000


Target Position: 758, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
758CUAGUACAUCAGAAUUUUU88.04911032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
898776CTAGTACATCAGAATTTTTAAAAATTCTGATGTACTAG0.415700.174500.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
756-778AGCTAGTACATCAGAATTTTTAAAAAAAUUCUGAUGUACUAGCUCUAGUACAUCAGAAUUUUUAAU0.420.222


Target Position: 8113, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8113GUGCAUAUAUGAAUGAAUA99.299677

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8111-8133CAGTGCATATATGAATGAATATGUAUUCAUUCAUAUAUGCACUGGUGCAUAUAUGAAUGAAUAUGU7.221.111


Target Position: 7475, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7475CACAUACAUUUUACAUAUA98.533998

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7473-7495CACACATACATTTTACATATAGTUAUAUGUAAAAUGUAUGUGUGCACAUACAUUUUACAUAUAGUU8.220.422


Target Position: 2457, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2457CUUUAAACGGUUUUUAACA82.05662222

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2455-2477GACTTTAAACGGTTTTTAACATGUGUUAAAAACCGUUUAAAGUCCUUUAAACGGUUUUUAACAUGU0.00.023


Target Position: 3853, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3853CACAUGUUUCACAUUGACU82.84592056

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3851-3873GACACATGTTTCACATTGACTTTAGUCAAUGUGAAACAUGUGUCCACAUGUUUCACAUUGACUUUU20.519.322


Target Position: 6205, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6205CUUAUGUGUGUAAACAUUU79.72382798

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6203-6225TACTTATGTGTGTAAACATTTTAAAAUGUUUACACACAUAAGUACUUAUGUGUGUAAACAUUUUAU5.313.522


Target Position: 4176, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4176CUUUACUAGGCUUAUUGAA85.35911505

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4174-4196TTCTTTACTAGGCTTATTGAATCUUCAAUAAGCCUAGUAAAGAACUUUACUAGGCUUAUUGAAUCU8.96.622


Target Position: 6703, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6703GUUAGAAUAGAAAUACAGA94.0454339

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6701-6723TGGTTAGAATAGAAATACAGATAUCUGUAUUUCUAUUCUAACCAGUUAGAAUAGAAAUACAGAUAU11.66.922


Target Position: 5879, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5879CACAAAAAAAUCCUUUACU77.0163492

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5877-5899CCCACAAAAAAATCCTTTACTTCAGUAAAGGAUUUUUUUGUGGGCACAAAAAAAUCCUUUACUUCU18.65.621


Target Position: 1169, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1169GUUCUCUUCUUCAAGAAGU74.91444020

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1167-1189AAGTTCTCTTCTTCAAGAAGTTGACUUCUUGAAGAAGAGAACUUGUUCUCUUCUUCAAGAAGUUGU16.619.122


Target Position: 6053, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6053CAGUAAAUAAGUGAAAAUU84.51091711

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6051-6073CTCAGTAAATAAGTGAAAATTGTAAUUUUCACUUAUUUACUGAGCAGUAAAUAAGUGAAAAUUGUU7.44.623


Target Position: 2449, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2449CUUUUUGACUUUAAACGGU69.35015415

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2447-2469CTCTTTTTGACTTTAAACGGTTTACCGUUUAAAGUCAAAAAGAGCUUUUUGACUUUAAACGGUUUU20.67.722


Target Position: 5560, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5560GAUGUUACCGUAAAAUCCA86.82041236

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5558-5580AGGATGTTACCGTAAAATCCAGCUGGAUUUUACGGUAACAUCCUGAUGUUACCGUAAAAUCCAGCU14.214.633


Target Position: 5306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5306UCACAUAACUAACCUUUUU74.6734091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8005324TCACATAACTAACCTTTTTAAAAAGGTTAGTTATGTGA0.375400.353800.724100.750001.000001.00000


Target Position: 2722, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2722GGACUUUCUAAAGAAGAUA91.3756597

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2720-2742TTGGACTTTCTAAAGAAGATAAAUAUCUUCUUUAGAAAGUCCAAGGACUUUCUAAAGAAGAUAAAU19.121.511


Target Position: 5871, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5871GUUUUUCCCACAAAAAAAU74.57994117

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5869-5891ATGTTTTTCCCACAAAAAAATCCAUUUUUUUGUGGGAAAAACAUGUUUUUCCCACAAAAAAAUCCU-11.314.321


Target Position: 4474, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4474CACAAUAAGCUCAGUAUUA95.2719239

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4472-4494TTCACAATAAGCTCAGTATTATTUAAUACUGAGCUUAUUGUGAACACAAUAAGCUCAGUAUUAUUU11.66.922


Target Position: 6663, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6663GUUAAUUUGGAUAUAUACA89.1453886

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6661-6683TTGTTAATTTGGATATATACATAUGUAUAUAUCCAAAUUAACAAGUUAAUUUGGAUAUAUACAUAU2.8-9.721


Target Position: 3818, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3818GACACAAUGACAAUAUAAU92.3736480

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3816-3838TCGACACAATGACAATATAATGCAUUAUAUUGUCAUUGUGUCGAGACACAAUGACAAUAUAAUGCU-8.019.323


Target Position: 7652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7652GCCAAGACACUAAUUUUUA89.9752757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1977670GCCAAGACACTAATTTTTATAAAAATTAGTGTCTTGGC0.751200.318600.965501.000001.000001.00000


Target Position: 7740, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7740CAGAAGAAUUAUUUCUUCU87.22761172

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7738-7760ATCAGAAGAATTATTTCTTCTTGAGAAGAAAUAAUUCUUCUGAUCAGAAGAAUUAUUUCUUCUUGU14.819.122


Target Position: 7936, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7936GUUGUAUAAAAGUUUCAAU85.99781395

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7934-7956AAGTTGTATAAAAGTTTCAATATAUUGAAACUUUUAUACAACUUGUUGUAUAAAAGUUUCAAUAUU14.98.521


Target Position: 3196, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3196GAAGAACUUCUAAAACAGA94.2683313

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3194-3216GAGAAGAACTTCTAAAACAGACGUCUGUUUUAGAAGUUCUUCUCGAAGAACUUCUAAAACAGACGU10.317.722


Target Position: 304, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
304GAAUCAGAUUCCCAAAAAA101.79732

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
302-324CTGAATCAGATTCCCAAAAAAGAUUUUUUGGGAAUCUGAUUCAGGAAUCAGAUUCCCAAAAAAGAU11.520.422


Target Position: 6627, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6627CAUUUUUAUUAGUUACUCA99.311476

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6625-6647TTCATTTTTATTAGTTACTCAACUGAGUAACUAAUAAAAAUGAACAUUUUUAUUAGUUACUCAACU21.4-9.722


Target Position: 2013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2013UGCAGCAAUUUAUGAUCUU72.90424546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9252031TGCAGCAATTTATGATCTTAAGATCATAAATTGCTGCA0.294700.150300.715500.750001.000001.00000


Target Position: 8127, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8127GAAUAUGGUAAUUAAUCUU91.4515588

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8125-8147ATGAATATGGTAATTAATCTTACAAGAUUAAUUACCAUAUUCAUGAAUAUGGUAAUUAAUCUUACU6.912.622


Target Position: 4945, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4945CUUGUAUACAGUGGAUAUA87.15391187

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4943-4965TGCTTGTATACAGTGGATATAGCUAUAUCCACUGUAUACAAGCACUUGUAUACAGUGGAUAUAGCU21.28.533


Target Position: 8070, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8070CUAUCAUAAUCCAUACAUU96.0105190

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8068-8090CACTATCATAATCCATACATTCAAAUGUAUGGAUUAUGAUAGUGCUAUCAUAAUCCAUACAUUCAU13.310.223


Target Position: 6240, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6240GUUAUUUUCCUUUAUAUAA92.1575501

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6238-6260AAGTTATTTTCCTTTATATAATTUUAUAUAAAGGAAAAUAACUUGUUAUUUUCCUUUAUAUAAUUU-5.9-9.712


Target Position: 7038, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7038CUAUUUAAUGUUAAUUAAA92.8144450

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7036-7058GTCTATTTAATGTTAATTAAAATUUUAAUUAACAUUAAAUAGACCUAUUUAAUGUUAAUUAAAAUU-7.5-7.522


Target Position: 2623, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2623CAAGUUGACAGAAGCAUUA91.0929623

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2621-2643CTCAAGTTGACAGAAGCATTATAUAAUGCUUCUGUCAACUUGAGCAAGUUGACAGAAGCAUUAUAU18.519.221


Target Position: 7590, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7590GAUUUUUAAGCAUUUUUUA91.5701578

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7588-7610TGGATTTTTAAGCATTTTTTAAAUAAAAAAUGCUUAAAAAUCCAGAUUUUUAAGCAUUUUUUAAAU-12.0-9.722


Target Position: 6597, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6597CUUAAAAAAAAAGAAAAAA80.17112693

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6595-6617ATCTTAAAAAAAAAGAAAAAAAGUUUUUUCUUUUUUUUUAAGAUCUUAAAAAAAAAGAAAAAAAGU5.5-9.110


Target Position: 7148, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7148GUAAUUUUCACUUAAGCUU76.98343508

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7146-7168TAGTAATTTTCACTTAAGCTTTTAAGCUUAAGUGAAAAUUACUAGUAAUUUUCACUUAAGCUUUUU18.3-9.722


Target Position: 4135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4135GCACUUCAACCCCAAACUA89.7825786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8354153GCACTTCAACCCCAAACTATAGTTTGGGGTTGAAGTGC0.890700.255500.681001.000001.000001.00000


Target Position: 3216, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3216GAAACUUGUACAGCUUUUA88.12361023

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3214-3236ACGAAACTTGTACAGCTTTTAGGUAAAAGCUGUACAAGUUUCGUGAAACUUGUACAGCUUUUAGGU17.010.323


Target Position: 4205, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4205GAAGCAUUGCCACAAAGUU86.12351372

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4203-4225GGGAAGCATTGCCACAAAGTTTAAACUUUGUGGCAAUGCUUCCCGAAGCAUUGCCACAAAGUUUAU17.818.522


Target Position: 7302, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7302GUGUCUUUUAGCACAAAUA92.1449505

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7300-7322CAGTGTCTTTTAGCACAAATAATUAUUUGUGCUAAAAGACACUGGUGUCUUUUAGCACAAAUAAUU12.119.221


Target Position: 4592, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4592GUUACUUACAGAGUUUGAU79.17682926

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4590-4612CAGTTACTTACAGAGTTTGATGAAUCAAACUCUGUAAGUAACUGGUUACUUACAGAGUUUGAUGAU19.26.622


Target Position: 2507, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2507CAUCACAUACAAAUUCUGU81.89042257

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2505-2527TTCATCACATACAAATTCTGTTCACAGAAUUUGUAUGUGAUGAACAUCACAUACAAAUUCUGUUCU12.020.533


Target Position: 2502, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2502GACUUCAUCACAUACAAAU86.7381259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2792520GACTTCATCACATACAAATATTTGTATGTGATGAAGTC0.645900.375000.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2500-2522TGGACTTCATCACATACAAATTCAUUUGUAUGUGAUGAAGUCCAGACUUCAUCACAUACAAAUUCU6.919.222


Target Position: 4804, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4804CAUAUCAAAGAUCUUGUUA89.3329862

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4802-4824TGCATATCAAAGATCTTGTTACTUAACAAGAUCUUUGAUAUGCACAUAUCAAAGAUCUUGUUACUU19.28.732


Target Position: 7093, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7093GAUCAUUAACAUUUCCUUA98.848789

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7091-7113CAGATCATTAACATTTCCTTAAAUAAGGAAAUGUUAAUGAUCUGGAUCAUUAACAUUUCCUUAAAU18.78.721


Target Position: 238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
238UCAAGCAGCACCAGAAAAA76.57913596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
954256TCAAGCAGCACCAGAAAAATTTTTCTGGTGCTGCTTGA0.700100.074600.724100.750001.000001.00000


Target Position: 3460, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3460GAAAUUAAUGUCAUGUUUA97.025146

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3458-3480AAGAAATTAATGTCATGTTTAAGUAAACAUGACAUUAAUUUCUUGAAAUUAAUGUCAUGUUUAAGU12.1-9.722


Target Position: 7624, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7624GUAAAUCUAAAAAAAGUUU77.90563268

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7622-7644AAGTAAATCTAAAAAAAGTTTAAAAACUUUUUUUAGAUUUACUUGUAAAUCUAAAAAAAGUUUAAU3.26.920


Target Position: 2636, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2636GCAUUAUACAGCAACAUAA100.82842

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2634-2656AAGCATTATACAGCAACATAACTUUAUGUUGCUGUAUAAUGCUUGCAUUAUACAGCAACAUAACUU13.50.032


Target Position: 2723, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2723GACUUUCUAAAGAAGAUAA97.0146147

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2721-2743TGGACTTTCTAAAGAAGATAAAGUUAUCUUCUUUAGAAAGUCCAGACUUUCUAAAGAAGAUAAAGU16.017.702


Target Position: 2896, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2896GAACUUCUUGAUUCAAAAU87.88841060

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2894-2916TGGAACTTCTTGATTCAAAATTTAUUUUGAAUCAAGAAGUUCCAGAACUUCUUGAUUCAAAAUUUU7.717.722


Target Position: 120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
120GGAACCAACAAGAGCAAAA90.5114678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
310138GGAACCAACAAGAGCAAAATTTTGCTCTTGTTGGTTCC0.572800.460300.870701.000001.000001.00000


Target Position: 2005, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2005CAAUUAACUGCAGCAAUUU81.53222371

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2003-2025ACCAATTAACTGCAGCAATTTATAAAUUGCUGCAGUUAAUUGGUCAAUUAACUGCAGCAAUUUAUU18.5-0.321


Target Position: 7561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7561ACUACUAUCAAUAAAUUUU79.87972756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6037579ACTACTATCAATAAATTTTAAAATTTATTGATAGTAGT0.716000.346500.706900.750001.000001.00000


Target Position: 4870, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4870CCAGAUAACCACAAAACAU89.6774803

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7354888CCAGATAACCACAAAACATATGTTTTGTGGTTATCTGG0.761200.636100.689701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4868-4890TTCCAGATAACCACAAAACATCCAUGUUUUGUGGUUAUCUGGAACCAGAUAACCACAAAACAUCCU12.213.422


Target Position: 6935, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6935GGAAAGACUUGAAAUUUUU88.845923

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6933-6955GGGGAAAGACTTGAAATTTTTGGAAAAAUUUCAAGUCUUUCCCCGGAAAGACUUGAAAUUUUUGGU-12.021.522


Target Position: 5056, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5056CCUUUGAAAGAUUUCAACU79.04052965

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5054-5076TGCCTTTGAAAGATTTCAACTTGAGUUGAAAUCUUUCAAAGGCACCUUUGAAAGAUUUCAACUUGU14.912.222


Target Position: 7088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7088CCACAGAUCAUUAACAUUU83.51851905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4397106CCACAGATCATTAACATTTAAATGTTAATGATCTGTGG0.505400.184900.844801.000001.000001.00000


Target Position: 2383, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2383GGAAGUUCCCCUGAUUCUA89.0691900

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2381-2403GTGGAAGTTCCCCTGATTCTAATUAGAAUCAGGGGAACUUCCACGGAAGUUCCCCUGAUUCUAAUU20.421.522


Target Position: 7378, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7378GUGUAUAUUAUAAUACUGU84.36471736

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7376-7398AAGTGTATATTATAATACTGTACACAGUAUUAUAAUAUACACUUGUGUAUAUUAUAAUACUGUACU11.68.222


Target Position: 7772, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7772GGAUUUGAAGAUAAUGGUU87.22971171

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7770-7792TGGGATTTGAAGATAATGGTTCAAACCAUUAUCUUCAAAUCCCAGGAUUUGAAGAUAAUGGUUCAU20.016.322


Target Position: 799, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
799GAUUUGGAGAUAACAGAUU83.44631923

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
797-819CTGATTTGGAGATAACAGATTCAAAUCUGUUAUCUCCAAAUCAGGAUUUGGAGAUAACAGAUUCAU19.220.132


Target Position: 7278, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7278GCCUUUUUGCAGUCUAUUA91.3377603

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7276-7298CTGCCTTTTTGCAGTCTATTATGUAAUAGACUGCAAAAAGGCAGGCCUUUUUGCAGUCUAUUAUGU14.59.522


Target Position: 4886, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4886CAUCCAAACGUAAAACCAA94.6394277

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4884-4906AACATCCAAACGTAAAACCAAAAUUGGUUUUACGUUUGGAUGUUCAUCCAAACGUAAAACCAAAAU18.820.133


Target Position: 2293, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2293GAACUAAUCAUUUUUCCUA96.5608161

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2291-2313ATGAACTAATCATTTTTCCTATCUAGGAAAAAUGAUUAGUUCAUGAACUAAUCAUUUUUCCUAUCU18.74.622


Target Position: 7951, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7951CAAUAUCUUGCCUUAAAUU88.2231010

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7949-7971TTCAATATCTTGCCTTAAATTAGAAUUUAAGGCAAGAUAUUGAACAAUAUCUUGCCUUAAAUUAGU-4.36.612


Target Position: 2220, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2220GGAUCUUUUUAAACCUAUU91.3572601

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2218-2240AAGGATCTTTTTAAACCTATTCAAAUAGGUUUAAAAAGAUCCUUGGAUCUUUUUAAACCUAUUCAU18.514.822


Target Position: 1664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1664ACCUGUAUCAAAUAGAAAA88.7152942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9101682ACCTGTATCAAATAGAAAATTTTCTATTTGATACAGGT0.641000.079400.853400.750001.000001.00000


Target Position: 5899, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5899CUGAUGUAUGAAUUAGUUA91.9143532

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5897-5919TTCTGATGTATGAATTAGTTATCUAACUAAUUCAUACAUCAGAACUGAUGUAUGAAUUAGUUAUCU4.621.532


Target Position: 604, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
604CCAUCUACAGAACCUAUAU89.6388808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
303622CCATCTACAGAACCTATATATATAGGTTCTGTAGATGG0.638600.505900.801701.000000.962000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
602-624TTCCATCTACAGAACCTATATATAUAUAGGUUCUGUAGAUGGAACCAUCUACAGAACCUAUAUAUU19.820.332


Target Position: 3179, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3179GAGGAAAACGACUUAGAGA94.5333284

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3177-3199AGGAGGAAAACGACTTAGAGAAGUCUCUAAGUCGUUUUCCUCCUGAGGAAAACGACUUAGAGAAGU16.318.722


Target Position: 4379, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4379CAGAUAAACAUUAUAUUUA97.6861121

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4377-4399CCCAGATAAACATTATATTTATGUAAAUAUAAUGUUUAUCUGGGCAGAUAAACAUUAUAUUUAUGU-8.06.921


Target Position: 7208, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7208GUAAUUUAAAAACAAACAA85.09621580

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7206-7228CTGTAATTTAAAAACAAACAAACUUGUUUGUUUUUAAAUUACAGGUAAUUUAAAAACAAACAAACU19.3-7.511


Target Position: 359, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
359CUGAACUUGAGAAACUAUU73.7944317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
681377CTGAACTTGAGAAACTATTAATAGTTTCTCAAGTTCAG0.524200.117700.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
357-379AGCTGAACTTGAGAAACTATTGCAAUAGUUUCUCAAGUUCAGCUCUGAACUUGAGAAACUAUUGCU4.619.212


Target Position: 6235, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6235GAAAAGUUAUUUUCCUUUA93.3333399

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6233-6255ATGAAAAGTTATTTTCCTTTATAUAAAGGAAAAUAACUUUUCAUGAAAAGUUAUUUUCCUUUAUAU18.73.212


Target Position: 4964, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4964GCAAAGAAACCCUAAGACA90.8858641

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4962-4984TAGCAAAGAAACCCTAAGACAGCUGUCUUAGGGUUUCUUUGCUAGCAAAGAAACCCUAAGACAGCU18.912.232


Target Position: 7443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7443CUCAUUUUGUGCCUUCUUU75.81713776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3807461CTCATTTTGTGCCTTCTTTAAAGAAGGCACAAAATGAG0.826100.211700.810300.750001.000001.00000


Target Position: 5961, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5961GAUUGUACAAUAAAUUCUA98.54297

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5959-5981GTGATTGTACAATAAATTCTATCUAGAAUUUAUUGUACAAUCACGAUUGUACAAUAAAUUCUAUCU5.314.622


Target Position: 6232, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6232CAUGAAAAGUUAUUUUCCU81.96992242

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6230-6252CACATGAAAAGTTATTTTCCTTTAGGAAAAUAACUUUUCAUGUGCAUGAAAAGUUAUUUUCCUUUU14.27.422


Target Position: 8123, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8123GAAUGAAUAUGGUAAUUAA113.1882

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8121-8143ATGAATGAATATGGTAATTAATCUUAAUUACCAUAUUCAUUCAUGAAUGAAUAUGGUAAUUAAUCU1.47.221


Target Position: 7454, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7454CCUUCUUUACUCAUUCAAA95.3465229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1287472CCTTCTTTACTCATTCAAATTTGAATGAGTAAAGAAGG0.836000.796400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7452-7474TGCCTTCTTTACTCATTCAAACAUUUGAAUGAGUAAAGAAGGCACCUUCUUUACUCAUUCAAACAU13.810.322


Target Position: 5379, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5379CUAAACUUAAUAUAUACUA89.1932880

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5377-5399CCCTAAACTTAATATATACTAATUAGUAUAUAUUAAGUUUAGGGCUAAACUUAAUAUAUACUAAUU6.14.921


Target Position: 7357, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7357GAAAUCUGGAUUCAUAUCU77.29143413

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7355-7377AAGAAATCTGGATTCATATCTAAAGAUAUGAAUCCAGAUUUCUUGAAAUCUGGAUUCAUAUCUAAU17.412.022


Target Position: 5835, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5835CUUACUAAAGACAAGAAAU85.77751435

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5833-5855AGCTTACTAAAGACAAGAAATTAAUUUCUUGUCUUUAGUAAGCUCUUACUAAAGACAAGAAAUUAU12.26.623


Target Position: 7131, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7131CAAAUGCAAAUGUACUAGU79.2632906

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7129-7151TGCAAATGCAAATGTACTAGTAAACUAGUACAUUUGCAUUUGCACAAAUGCAAAUGUACUAGUAAU18.820.022


Target Position: 2594, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2594CUGCAUUUGAUAUUAUUUA87.92741048

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5422612CTGCATTTGATATTATTTATAAATAATATCAAATGCAG0.631600.156000.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2592-2614TCCTGCATTTGATATTATTTATAUAAAUAAUAUCAAAUGCAGGACUGCAUUUGAUAUUAUUUAUAU-10.320.012


Target Position: 6642, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6642CUCAACUUCAGACACAAUU71.57184885

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6640-6662TACTCAACTTCAGACACAATTTTAAUUGUGUCUGAAGUUGAGUACUCAACUUCAGACACAAUUUUU19.319.223


Target Position: 1976, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1976CUGAAAAUCCUGUUCAAGU78.49233110

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1974-1996TCCTGAAAATCCTGTTCAAGTAAACUUGAACAGGAUUUUCAGGACUGAAAAUCCUGUUCAAGUAAU19.27.423


Target Position: 6707, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6707GAAUAGAAAUACAGAUACU96.9033150

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6705-6727TAGAATAGAAATACAGATACTTTAGUAUCUGUAUUUCUAUUCUAGAAUAGAAAUACAGAUACUUUU20.36.912


Target Position: 1985, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1985CUGUUCAAGUAAGCAUAAA85.28351526

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1983-2005TCCTGTTCAAGTAAGCATAAACCUUUAUGCUUACUUGAACAGGACUGUUCAAGUAAGCAUAAACCU19.720.522


Target Position: 1213, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1213GCUUUUUGUCGAUCCAUUA92.0424520

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1211-1233CAGCTTTTTGTCGATCCATTACAUAAUGGAUCGACAAAAAGCUGGCUUUUUGUCGAUCCAUUACAU20.12.133


Target Position: 7993, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7993CAAAUAUUGUGACAUUUAA98.1648106

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7991-8013TTCAAATATTGTGACATTTAAAAUUAAAUGUCACAAUAUUUGAACAAAUAUUGUGACAUUUAAAAU6.9-10.332


Target Position: 5499, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5499CCUUUUAUAGCCUUUACCA86.86011228

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5497-5519CACCTTTTATAGCCTTTACCACTUGGUAAAGGCUAUAAAAGGUGCCUUUUAUAGCCUUUACCACUU18.6-4.332


Target Position: 2121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2121GCUCCAGUUUACUAUUUUU91.6718563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6712139GCTCCAGTTTACTATTTTTAAAAATAGTAAACTGGAGC0.366300.305100.853401.000001.000001.00000


Target Position: 7473, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7473CACACAUACAUUUUACAUA96.5502162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8977491CACACATACATTTTACATATATGTAAAATGTATGTGTG0.609300.362100.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7471-7493AACACACATACATTTTACATATAUAUGUAAAAUGUAUGUGUGUUCACACAUACAUUUUACAUAUAU6.920.422


Target Position: 2646, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2646GCAACAUAACUUAGAAACA92.2453495

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2644-2666CAGCAACATAACTTAGAAACACTUGUUUCUAAGUUAUGUUGCUGGCAACAUAACUUAGAAACACUU14.613.532


Target Position: 2124, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2124CCAGUUUACUAUUUUUGCU80.82922534

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2122-2144CTCCAGTTTACTATTTTTGCTGCAGCAAAAAUAGUAAACUGGAGCCAGUUUACUAUUUUUGCUGCU14.111.832


Target Position: 1529, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1529GAAGUCAUGAGCAUAUUCA92.9171441

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1527-1549TGGAAGTCATGAGCATATTCAAAUGAAUAUGCUCAUGACUUCCAGAAGUCAUGAGCAUAUUCAAAU8.719.222


Target Position: 1437, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1437GGUACAUGAUGACUUGAAU96.0161189

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1435-1457TGGGTACATGATGACTTGAATCAAUUCAAGUCAUCAUGUACCCAGGUACAUGAUGACUUGAAUCAU19.220.433


Target Position: 5857, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5857GUACAUGUACUAAUGUUUU85.26431534

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5855-5877ATGTACATGTACTAATGTTTTTCAAAACAUUAGUACAUGUACAUGUACAUGUACUAAUGUUUUUCU5.320.412


Target Position: 3283, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3283GUUGUUCUCCAAAGAAGUA88.7488935

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3281-3303AGGTTGTTCTCCAAAGAAGTATGUACUUCUUUGGAGAACAACCUGUUGUUCUCCAAAGAAGUAUGU17.719.222


Target Position: 7458, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7458CUUUACUCAUUCAAACACA87.25181167

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7456-7478TTCTTTACTCATTCAAACACACAUGUGUUUGAAUGAGUAAAGAACUUUACUCAUUCAAACACACAU19.314.621


Target Position: 1166, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1166GAAGUUCUCUUCUUCAAGA94.3462300

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1164-1186TGGAAGTTCTCTTCTTCAAGAAGUCUUGAAGAAGAGAACUUCCAGAAGUUCUCUUCUUCAAGAAGU16.617.722


Target Position: 4637, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4637GUGAUCUUGUUUGUACUUU73.90344287

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4635-4657GTGTGATCTTGTTTGTACTTTCTAAAGUACAAACAAGAUCACACGUGAUCUUGUUUGUACUUUCUU19.020.422


Target Position: 5676, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5676GCUUUUUAUUCAUGUCUUU84.76181654

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5674-5696CTGCTTTTTATTCATGTCTTTAAAAAGACAUGAAUAAAAAGCAGGCUUUUUAUUCAUGUCUUUAAU19.2-3.822


Target Position: 4358, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4358CAUAUCAUAAGAAAUACAA93.0611425

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4356-4378TACATATCATAAGAAATACAACCUUGUAUUUCUUAUGAUAUGUACAUAUCAUAAGAAAUACAACCU6.98.531


Target Position: 1978, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1978GAAAAUCCUGUUCAAGUAA91.6685564

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1976-1998CTGAAAATCCTGTTCAAGTAAGCUUACUUGAACAGGAUUUUCAGGAAAAUCCUGUUCAAGUAAGCU20.314.222


Target Position: 761, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
761GUACAUCAGAAUUUUUAAA90.8241650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
792779GTACATCAGAATTTTTAAATTTAAAAATTCTGATGTAC0.438000.175300.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
759-781TAGTACATCAGAATTTTTAAAAAUUUAAAAAUUCUGAUGUACUAGUACAUCAGAAUUUUUAAAAAU-9.121.522


Target Position: 3570, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3570GAUGGUAAUUUUCAAAUGU84.29631746

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3568-3590AGGATGGTAATTTTCAAATGTCTACAUUUGAAAAUUACCAUCCUGAUGGUAAUUUUCAAAUGUCUU13.820.032


Target Position: 6644, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6644CAACUUCAGACACAAUUUU80.84482529

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6642-6664CTCAACTTCAGACACAATTTTGTAAAAUUGUGUCUGAAGUUGAGCAACUUCAGACACAAUUUUGUU5.319.222


Target Position: 5965, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5965GUACAAUAAAUUCUAUCAU86.24221345

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5963-5985TTGTACAATAAATTCTATCATTCAUGAUAGAAUUUAUUGUACAAGUACAAUAAAUUCUAUCAUUCU21.48.522


Target Position: 5299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5299CCAACAGUCACAUAACUAA97.103143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9065317CCAACAGTCACATAACTAATTAGTTATGTGACTGTTGG0.820900.080200.810301.000000.923900.62500


Target Position: 7648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7648ACUGGCCAAGACACUAAUU72.94484534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8647666ACTGGCCAAGACACTAATTAATTAGTGTCTTGGCCAGT0.510900.281800.698300.750001.000001.00000


Target Position: 1712, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1712CUGUUGAAGAACUCUUAGA84.73871660

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1710-1732CCCTGTTGAAGAACTCTTAGATTUCUAAGAGUUCUUCAACAGGGCUGUUGAAGAACUCUUAGAUUU16.320.532


Target Position: 6617, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6617GAGUAAGAUUCAUUUUUAU97.064145

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6615-6637AAGAGTAAGATTCATTTTTATTAAUAAAAAUGAAUCUUACUCUUGAGUAAGAUUCAUUUUUAUUAU-9.718.922


Target Position: 6029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6029CCCUACAUCUAUACUCCAC73.264465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7376047CCCTACATCTATACTCCACGTGGAGTATAGATGTAGGG0.411700.352000.698300.750001.000001.00000


Target Position: 2350, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2350CUUACUCUUUUUGGAAUUU72.41594681

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2348-2370ACCTTACTCTTTTTGGAATTTTAAAAUUCCAAAAAGAGUAAGGUCUUACUCUUUUUGGAAUUUUAU20.118.921


Target Position: 646, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
646CCAUAUUUCUCAUAUCCUU89.5834816

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
807664CCATATTTCTCATATCCTTAAGGATATGAGAAATATGG0.323200.254400.706901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
644-666CTCCATATTTCTCATATCCTTTGAAGGAUAUGAGAAAUAUGGAGCCAUAUUUCUCAUAUCCUUUGU19.9-1.822


Target Position: 8001, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8001GUGACAUUUAAAAAAGAAA89.5753818

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7999-8021TTGTGACATTTAAAAAAGAAAACUUUCUUUUUUAAAUGUCACAAGUGACAUUUAAAAAAGAAAACU5.520.521


Target Position: 4476, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4476CAAUAAGCUCAGUAUUAUU95.8978194

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4474-4496CACAATAAGCTCAGTATTATTTTAAUAAUACUGAGCUUAUUGUGCAAUAAGCUCAGUAUUAUUUUU1.113.621


Target Position: 748, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
748GACAAAAUAGCUAGUACAU89.6288810

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
746-768TTGACAAAATAGCTAGTACATCAAUGUACUAGCUAUUUUGUCAAGACAAAAUAGCUAGUACAUCAU20.25.333


Target Position: 5369, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5369GCUACAAACCCUAAACUUA96.6906157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5685387GCTACAAACCCTAAACTTATAAGTTTAGGGTTTGTAGC0.808400.148500.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5367-5389ATGCTACAAACCCTAAACTTAATUAAGUUUAGGGUUUGUAGCAUGCUACAAACCCUAAACUUAAUU4.911.823


Target Position: 6999, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6999GGUAUAUGAAUGUCUUUUU88.9031919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5417017GGTATATGAATGTCTTTTTAAAAAGACATTCATATACC0.428600.174200.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6997-7019ATGGTATATGAATGTCTTTTTTAAAAAAGACAUUCAUAUACCAUGGUAUAUGAAUGUCUUUUUUAU13.38.222


Target Position: 930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
930CCAUGAGGAAGAGAAAAAU83.67551876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
664948CCATGAGGAAGAGAAAAATATTTTTCTCTTCCTCATGG0.452200.120100.836201.000001.000001.00000


Target Position: 7914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7914UCAUUUCUUUUUUCAAAUU70.75395088

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7827932TCATTTCTTTTTTCAAATTAATTTGAAAAAAGAAATGA0.454500.101900.715500.750001.000001.00000


Target Position: 5595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5595CUGAAAAACAAAGCACAAA82.41032148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8915613CTGAAAAACAAAGCACAAATTTGTGCTTTGTTTTTCAG0.295300.241400.784500.750001.000001.00000


Target Position: 7799, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7799GAACCUAUUAUUUUCUCUA97.4473128

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7797-7819AAGAACCTATTATTTTCTCTACTUAGAGAAAAUAAUAGGUUCUUGAACCUAUUAUUUUCUCUACUU19.118.522


Target Position: 2689, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2689CUUCUUGAUAUUCUUCAUA86.35911322

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2687-2709AACTTCTTGATATTCTTCATAAAUAUGAAGAAUAUCAAGAAGUUCUUCUUGAUAUUCUUCAUAAAU20.420.422


Target Position: 4446, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4446CCGAACAUUUGACGAAUUU74.59594110

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4444-4466TTCCGAACATTTGACGAATTTCAAAAUUCGUCAAAUGUUCGGAACCGAACAUUUGACGAAUUUCAU15.221.133


Target Position: 5412, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5412CUUUGAGACAGUACUAUGU80.10852708

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5410-5432GACTTTGAGACAGTACTATGTCAACAUAGUACUGUCUCAAAGUCCUUUGAGACAGUACUAUGUCAU13.120.433


Target Position: 6143, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6143CAGAUUGAACUUUAAUAUA96.2604178

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6141-6163TCCAGATTGAACTTTAATATAGAUAUAUUAAAGUUCAAUCUGGACAGAUUGAACUUUAAUAUAGAU-8.020.422


Target Position: 6712, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6712GAAAUACAGAUACUUUAAA94.9626249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8896730GAAATACAGATACTTTAAATTTAAAGTATCTGTATTTC0.499100.353300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6710-6732TAGAAATACAGATACTTTAAAAAUUUAAAGUAUCUGUAUUUCUAGAAAUACAGAUACUUUAAAAAU4.96.922


Target Position: 7126, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7126CUUUGCAAAUGCAAAUGUA91.2832609

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7124-7146ACCTTTGCAAATGCAAATGTACTUACAUUUGCAUUUGCAAAGGUCUUUGCAAAUGCAAAUGUACUU12.120.022


Target Position: 5639, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5639CUAAGUAGUUUAUAGAAGU85.30981520

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5637-5659TACTAAGTAGTTTATAGAAGTAGACUUCUAUAAACUACUUAGUACUAAGUAGUUUAUAGAAGUAGU11.611.323


Target Position: 7196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7196CACUUAGCCACUGUAAUUU78.83153016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6287214CACTTAGCCACTGTAATTTAAATTACAGTGGCTAAGTG0.400200.128100.793100.750001.000001.00000


Target Position: 4948, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4948GUAUACAGUGGAUAUAGCA90.9832629

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4946-4968TTGTATACAGTGGATATAGCAAAUGCUAUAUCCACUGUAUACAAGUAUACAGUGGAUAUAGCAAAU14.813.112


Target Position: 2714, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2714CAUCACUUGGACUUUCUAA93.3548396

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2712-2734CTCATCACTTGGACTTTCTAAAGUUAGAAAGUCCAAGUGAUGAGCAUCACUUGGACUUUCUAAAGU11.719.222


Target Position: 3366, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3366GGCAAAAGAAUUAAAUAUU85.39161501

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3364-3386GTGGCAAAAGAATTAAATATTAAAAUAUUUAAUUCUUUUGCCACGGCAAAAGAAUUAAAUAUUAAU-8.018.621


Target Position: 7136, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7136GCAAAUGUACUAGUAAUUU82.42132146

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7134-7156ATGCAAATGTACTAGTAATTTTCAAAUUACUAGUACAUUUGCAUGCAAAUGUACUAGUAAUUUUCU4.612.122


Target Position: 4289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4289UCCUUUCAUUUUCACCUAA78.09833208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9314307TCCTTTCATTTTCACCTAATTAGGTGAAAATGAAAGGA0.657900.451400.836200.750001.000001.00000


Target Position: 7431, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7431CUCUUAAUUUAACUCAUUU85.04161597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5687449CTCTTAATTTAACTCATTTAAATGAGTTAAATTAAGAG0.666800.212600.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7429-7451TTCTCTTAATTTAACTCATTTTGAAAUGAGUUAAAUUAAGAGAACUCUUAAUUUAACUCAUUUUGU19.26.922


Target Position: 5431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5431CAGUUCAGCCACCUAUUUU83.39311930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9535449CAGTTCAGCCACCTATTTTAAAATAGGTGGCTGAACTG0.376000.074700.784500.750000.978300.62500


Target Position: 2655, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2655CUUAGAAACACUAGAGAAU84.16271779

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2653-2675AACTTAGAAACACTAGAGAATGAAUUCUCUAGUGUUUCUAAGUUCUUAGAAACACUAGAGAAUGAU20.27.122


Target Position: 3080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3080AGAUAGCACACAAUUUAUA92.1537502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7743098AGATAGCACACAATTTATATATAAATTGTGTGCTATCT0.360900.171600.681000.750001.000001.00000


Target Position: 5305, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5305GUCACAUAACUAACCUUUU81.96822243

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5303-5325CAGTCACATAACTAACCTTTTTGAAAAGGUUAGUUAUGUGACUGGUCACAUAACUAACCUUUUUGU17.321.532


Target Position: 804, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
804GGAGAUAACAGAUUCAAAA100.46651

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
802-824TTGGAGATAACAGATTCAAAAGTUUUUGAAUCUGUUAUCUCCAAGGAGAUAACAGAUUCAAAAGUU7.416.022


Target Position: 7453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7453GCCUUCUUUACUCAUUCAA82.21822176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
657471GCCTTCTTTACTCATTCAATTGAATGAGTAAAGAAGGC0.858000.811300.853401.000001.000001.00000


Target Position: 2951, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2951GGAUUGAGGCCAUUAGUGA92.8815443

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2949-2971CTGGATTGAGGCCATTAGTGATGUCACUAAUGGCCUCAAUCCAGGGAUUGAGGCCAUUAGUGAUGU11.620.433


Target Position: 5624, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5624CUAAGUUAAGAACUACUAA94.8863257

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5622-5644AGCTAAGTTAAGAACTACTAAGTUUAGUAGUUCUUAACUUAGCUCUAAGUUAAGAACUACUAAGUU18.86.632


Target Position: 3502, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3502GAUAUGUUAGCUUUACAGA91.5054584

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3500-3522AAGATATGTTAGCTTTACAGATGUCUGUAAAGCUAACAUAUCUUGAUAUGUUAGCUUUACAGAUGU11.86.722


Target Position: 7465, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7465CAUUCAAACACACAUACAU90.8172651

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7463-7485CTCATTCAAACACACATACATTTAUGUAUGUGUGUUUGAAUGAGCAUUCAAACACACAUACAUUUU20.47.422


Target Position: 2781, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2781CCCAAAUUGUCUUCCUAAA87.99031036

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5322799CCCAAATTGTCTTCCTAAATTTAGGAAGACAATTTGGG0.430900.287100.991401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2779-2801CACCCAAATTGTCTTCCTAAAATUUUAGGAAGACAAUUUGGGUGCCCAAAUUGUCUUCCUAAAAUU19.911.322


Target Position: 5450, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5450GCAUUGUUUUCUAUAAGGA90.5613669

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5448-5470TTGCATTGTTTTCTATAAGGAGGUCCUUAUAGAAAACAAUGCAAGCAUUGUUUUCUAUAAGGAGGU12.312.132


Target Position: 6051, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6051CUCAGUAAAUAAGUGAAAA89.5356822

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6049-6071CCCTCAGTAAATAAGTGAAAATTUUUUCACUUAUUUACUGAGGGCUCAGUAAAUAAGUGAAAAUUU19.220.332


Target Position: 4348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4348UCUGUUUUUACAUAUCAUA81.50292376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7824366TCTGTTTTTACATATCATATATGATATGTAAAAACAGA0.494600.119700.681000.750001.000001.00000


Target Position: 4774, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4774CGAAAUGGUACUCUUUUCA85.88521420

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4772-4794ACCGAAATGGTACTCTTTTCATCUGAAAAGAGUACCAUUUCGGUCGAAAUGGUACUCUUUUCAUCU14.820.132


Target Position: 7651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7651GGCCAAGACACUAAUUUUU82.73512075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2847669GGCCAAGACACTAATTTTTAAAAATTAGTGTCTTGGCC0.592000.312101.000001.000001.000001.00000


Target Position: 4094, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4094CAGAACUUACAAGUAUUCA85.0531593

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4092-4114ACCAGAACTTACAAGTATTCAAGUGAAUACUUGUAAGUUCUGGUCAGAACUUACAAGUAUUCAAGU14.517.732


Target Position: 7557, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7557CACUACUACUAUCAAUAAA97.9735112

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7555-7577TGCACTACTACTATCAATAAATTUUUAUUGAUAGUAGUAGUGCACACUACUACUAUCAAUAAAUUU8.918.832


Target Position: 4042, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4042CAGACAAACCUUUUUCUUA95.7325207

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4040-4062AGCAGACAAACCTTTTTCTTAACUAAGAAAAAGGUUUGUCUGCUCAGACAAACCUUUUUCUUAACU5.519.222


Target Position: 5343, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5343GCUGUUUUAAAGUCAUUAU85.14911563

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5341-5363TTGCTGTTTTAAAGTCATTATGTAUAAUGACUUUAAAACAGCAAGCUGUUUUAAAGUCAUUAUGUU16.110.321


Target Position: 7095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7095UCAUUAACAUUUCCUUAAA83.65391881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4737113TCATTAACATTTCCTTAAATTTAAGGAAATGTTAATGA0.583700.322500.724100.750001.000001.00000


Target Position: 2791, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2791CUUCCUAAAAUAUUAGCAA88.6946947

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2789-2811GTCTTCCTAAAATATTAGCAAGCUUGCUAAUAUUUUAGGAAGACCUUCCUAAAAUAUUAGCAAGCU19.719.923


Target Position: 8261, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8261CGAUUGUAUUAAAAUAUUU91.9445530

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8259-8281TACGATTGTATTAAAATATTTCTAAAUAUUUUAAUACAAUCGUACGAUUGUAUUAAAAUAUUUCUU-10.316.122


Target Position: 3318, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3318CUUUUUUCAGAAAAAUAAA86.34081327

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3316-3338TCCTTTTTTCAGAAAAATAAATGUUUAUUUUUCUGAAAAAAGGACUUUUUUCAGAAAAAUAAAUGU-9.70.721


Target Position: 2341, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2341GUUCUUCACCUUACUCUUU79.74892789

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2339-2361CAGTTCTTCACCTTACTCTTTTTAAAGAGUAAGGUGAAGAACUGGUUCUUCACCUUACUCUUUUUU18.920.432


Target Position: 7791, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7791CACUCAAAGAACCUAUUAU91.1391622

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7789-7811TTCACTCAAAGAACCTATTATTTAUAAUAGGUUCUUUGAGUGAACACUCAAAGAACCUAUUAUUUU12.319.233


Target Position: 314, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
314CCCAAAAAAGAGCAUUAGA82.43962141

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
312-334TTCCCAAAAAAGAGCATTAGATAUCUAAUGCUCUUUUUUGGGAACCCAAAAAAGAGCAUUAGAUAU19.711.533


Target Position: 7410, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7410CAGAACAAGUGGUAAUGUU87.36441138

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7408-7430TTCAGAACAAGTGGTAATGTTTTAACAUUACCACUUGUUCUGAACAGAACAAGUGGUAAUGUUUUU14.619.232


Target Position: 3019, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3019GAAAUUUACUUGAAUAGUU90.9958628

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3017-3039ATGAAATTTACTTGAATAGTTCAAACUAUUCAAGUAAAUUUCAUGAAAUUUACUUGAAUAGUUCAU14.5-9.723


Target Position: 6023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6023UCACCUCCCUACAUCUAUA89.1118891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8926041TCACCTCCCTACATCTATATATAGATGTAGGGAGGTGA0.796400.495100.681000.750001.000001.00000


Target Position: 2307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2307UCCUAUCCAGAUAUCACAA82.91122041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9452325TCCTATCCAGATATCACAATTGTGATATCTGGATAGGA0.577800.200500.724100.750001.000001.00000


Target Position: 4879, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4879CACAAAACAUCCAAACGUA97.4128132

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4877-4899ACCACAAAACATCCAAACGTAAAUACGUUUGGAUGUUUUGUGGUCACAAAACAUCCAAACGUAAAU19.813.323


Target Position: 3194, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3194GAGAAGAACUUCUAAAACA98.675192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3192-3214TAGAGAAGAACTTCTAAAACAGAUGUUUUAGAAGUUCUUCUCUAGAGAAGAACUUCUAAAACAGAU4.919.122


Target Position: 4764, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4764CAUCUCUUACCGAAAUGGU73.26134464

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4762-4784TCCATCTCTTACCGAAATGGTACACCAUUUCGGUAAGAGAUGGACAUCUCUUACCGAAAUGGUACU20.119.123


Target Position: 2320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2320UCACAAUUGCCAUUAGAAU76.68683568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9972338TCACAATTGCCATTAGAATATTCTAATGGCAATTGTGA0.267400.216800.715500.750001.000001.00000


Target Position: 2772, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2772CUUCAAACACCCAAAUUGU77.16283453

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2770-2792TGCTTCAAACACCCAAATTGTCTACAAUUUGGGUGUUUGAAGCACUUCAAACACCCAAAUUGUCUU4.214.922


Target Position: 4282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4282GAGCCCAUCCUUUCAUUUU79.69262808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9904300GAGCCCATCCTTTCATTTTAAAATGAAAGGATGGGCTC0.612600.070400.810300.750001.000001.00000


Target Position: 6777, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6777CAAAAUAUGCAAUAAAGAA97.8659114

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6775-6797GACAAAATATGCAATAAAGAATAUUCUUUAUUGCAUAUUUUGUCCAAAAUAUGCAAUAAAGAAUAU6.9-10.321


Target Position: 7653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7653CCAAGACACUAAUUUUUAU92.037522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3047671CCAAGACACTAATTTTTATATAAAAATTAGTGTCTTGG0.730500.312100.801701.000001.000001.00000


Target Position: 7564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7564ACUAUCAAUAAAUUUUAAA82.10762207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6507582ACTATCAATAAATTTTAAATTTAAAATTTATTGATAGT0.639400.520800.706900.750001.000001.00000


Target Position: 1568, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1568CAGAAAUUAGACUACAACU88.4567976

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1566-1588CACAGAAATTAGACTACAACTCTAGUUGUAGUCUAAUUUCUGUGCAGAAAUUAGACUACAACUCUU19.05.322


Target Position: 8036, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8036CUUAGACUUCAGAUCAAAA97.1806139

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8034-8056AACTTAGACTTCAGATCAAAAAGUUUUGAUCUGAAGUCUAAGUUCUUAGACUUCAGAUCAAAAAGU16.318.922


Target Position: 7842, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7842CACUGAUAUUUUUAUUACU90.7903652

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7840-7862TGCACTGATATTTTTATTACTGCAGUAAUAAAAAUAUCAGUGCACACUGAUAUUUUUAUUACUGCU1.420.322


Target Position: 2265, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2265GAAUUUCUUCUAUCUUAUU89.9244765

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2263-2285AAGAATTTCTTCTATCTTATTAAAAUAAGAUAGAAGAAAUUCUUGAAUUUCUUCUAUCUUAUUAAU6.65.323


Target Position: 1795, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1795GUAAUUAAAGCUGUAAGAA88.14721020

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1793-1815AAGTAATTAAAGCTGTAAGAAAAUUCUUACAGCUUUAAUUACUUGUAAUUAAAGCUGUAAGAAAAU20.3-7.521


Target Position: 4809, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4809CAAAGAUCUUGUUACUGAA102.65724

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4807-4829ATCAAAGATCTTGTTACTGAAGAUUCAGUAACAAGAUCUUUGAUCAAAGAUCUUGUUACUGAAGAU20.314.813


Target Position: 7589, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7589GGAUUUUUAAGCAUUUUUU83.63241885

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7587-7609TTGGATTTTTAAGCATTTTTTAAAAAAAAUGCUUAAAAAUCCAAGGAUUUUUAAGCAUUUUUUAAU-3.30.422


Target Position: 3367, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3367GCAAAAGAAUUAAAUAUUA97.1432140

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3365-3387TGGCAAAAGAATTAAATATTAAGUAAUAUUUAAUUCUUUUGCCAGCAAAAGAAUUAAAUAUUAAGU-10.312.221


Target Position: 2156, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2156CAAGUAAUUGGGUAUCAAA100.6346

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2154-2176TTCAAGTAATTGGGTATCAAATTUUUGAUACCCAAUUACUUGAACAAGUAAUUGGGUAUCAAAUUU16.14.632


Target Position: 6998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6998UGGUAUAUGAAUGUCUUUU72.37164691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8167016TGGTATATGAATGTCTTTTAAAAGACATTCATATACCA0.471300.177300.844800.750001.000001.00000


Target Position: 387, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
387CAGUUUCGAGACUAAAAAA97.2296138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
886405CAGTTTCGAGACTAAAAAATTTTTTAGTCTCGAAACTG0.678400.082700.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
385-407GACAGTTTCGAGACTAAAAAAACUUUUUUAGUCUCGAAACUGUCCAGUUUCGAGACUAAAAAAACU-3.819.722


Target Position: 6671, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6671GGAUAUAUACAUAUAUAUA114.6421

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6669-6691TTGGATATATACATATATATAATUAUAUAUAUGUAUAUAUCCAAGGAUAUAUACAUAUAUAUAAUU-6.43.211


Target Position: 144, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
144GGACAAAGAAGAAGCAUUA98.1531107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
896162GGACAAAGAAGAAGCATTATAATGCTTCTTCTTTGTCC0.294500.276000.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
142-164GTGGACAAAGAAGAAGCATTACAUAAUGCUUCUUCUUUGUCCACGGACAAAGAAGAAGCAUUACAU18.519.212


Target Position: 3864, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3864CAUUGACUUUGGAAAGUUU91.6076574

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3862-3884CACATTGACTTTGGAAAGTTTTTAAACUUUCCAAAGUCAAUGUGCAUUGACUUUGGAAAGUUUUUU13.319.222


Target Position: 4050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4050CCUUUUUCUUAACCUCCUU76.74373558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5954068CCTTTTTCTTAACCTCCTTAAGGAGGTTAAGAAAAAGG0.528200.159300.706901.000001.000001.00000


Target Position: 605, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
605CAUCUACAGAACCUAUAUA99.239680

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
603-625TCCATCTACAGAACCTATATATTUAUAUAGGUUCUGUAGAUGGACAUCUACAGAACCUAUAUAUUU12.220.332


Target Position: 7418, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7418GUGGUAAUGUUUUCUCUUA93.6592369

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7416-7438AAGTGGTAATGTTTTCTCTTAATUAAGAGAAAACAUUACCACUUGUGGUAAUGUUUUCUCUUAAUU19.120.031


Target Position: 6656, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6656CAAUUUUGUUAAUUUGGAU88.5841964

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6654-6676CACAATTTTGTTAATTTGGATATAUCCAAAUUAACAAAAUUGUGCAAUUUUGUUAAUUUGGAUAUU20.1-3.322


Target Position: 3368, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3368CAAAAGAAUUAAAUAUUAA100.9841

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3366-3388GGCAAAAGAATTAAATATTAAGTUUAAUAUUUAAUUCUUUUGCCCAAAAGAAUUAAAUAUUAAGUU-8.05.521


Target Position: 4448, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4448GAACAUUUGACGAAUUUCA90.3581699

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4446-4468CCGAACATTTGACGAATTTCAGGUGAAAUUCGUCAAAUGUUCGGGAACAUUUGACGAAUUUCAGGU10.45.332


Target Position: 7369, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7369CAUAUCUAAGUGUAUAUUA97.1333142

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7367-7389TTCATATCTAAGTGTATATTATAUAAUAUACACUUAGAUAUGAACAUAUCUAAGUGUAUAUUAUAU1.18.232


Target Position: 6718, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6718CAGAUACUUUAAAAAUGGU83.31381957

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6716-6738TACAGATACTTTAAAAATGGTAAACCAUUUUUAAAGUAUCUGUACAGAUACUUUAAAAAUGGUAAU11.318.921


Target Position: 8085, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8085CAUUCAUUUCCAUGUUGUU87.08781201

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8083-8105TACATTCATTTCCATGTTGTTTGAACAACAUGGAAAUGAAUGUACAUUCAUUUCCAUGUUGUUUGU19.37.222


Target Position: 1115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1115AGGGCCAUAUAUCUCAGAA89.2105877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8761133AGGGCCATATATCTCAGAATTCTGAGATATATGGCCCT0.556000.086000.672400.750001.000001.00000


Target Position: 4567, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4567GCCAAAAGGAAAAUUGAGU71.85464820

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4565-4587CAGCCAAAAGGAAAATTGAGTTAACUCAAUUUUCCUUUUGGCUGGCCAAAAGGAAAAUUGAGUUAU12.016.122


Target Position: 3190, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3190CUUAGAGAAGAACUUCUAA93.6845366

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3188-3210GACTTAGAGAAGAACTTCTAAAAUUAGAAGUUCUUCUCUAAGUCCUUAGAGAAGAACUUCUAAAAU18.920.222


Target Position: 1872, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1872GCUAAAGAGAGCAGUUAAU85.15041562

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1870-1892AAGCTAAAGAGAGCAGTTAATCTAUUAACUGCUCUCUUUAGCUUGCUAAAGAGAGCAGUUAAUCUU11.811.733


Target Position: 4291, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4291CUUUCAUUUUCACCUAAAA90.2834712

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4289-4311TCCTTTCATTTTCACCTAAAACAUUUUAGGUGAAAAUGAAAGGACUUUCAUUUUCACCUAAAACAU18.67.422


Target Position: 1117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1117GGCCAUAUAUCUCAGAAAG80.92882511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6861135GGCCATATATCTCAGAAAGCTTTCTGAGATATATGGCC0.359100.302400.862100.750001.000001.00000


Target Position: 19, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
19GCUACAAGAAAAAAAUAGA90.1657734

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
17-39AAGCTACAAGAAAAAAATAGAGGUCUAUUUUUUUCUUGUAGCUUGCUACAAGAAAAAAAUAGAGGU-4.316.412


Target Position: 7420, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7420GGUAAUGUUUUCUCUUAAU91.5592579

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7418-7440GTGGTAATGTTTTCTCTTAATTTAUUAAGAGAAAACAUUACCACGGUAAUGUUUUCUCUUAAUUUU11.714.623


Target Position: 315, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
315CCAAAAAAGAGCAUUAGAU85.34621508

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
313-335TCCCAAAAAAGAGCATTAGATATAUCUAAUGCUCUUUUUUGGGACCAAAAAAGAGCAUUAGAUAUU13.4-2.932


Target Position: 7304, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7304GUCUUUUAGCACAAAUAAU85.68261451

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7302-7324GTGTCTTTTAGCACAAATAATAGAUUAUUUGUGCUAAAAGACACGUCUUUUAGCACAAAUAAUAGU-1.47.111


Target Position: 7338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7338CCUGUCACUUCCAUUAUAA93.7939359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5757356CCTGTCACTTCCATTATAATTATAATGGAAGTGACAGG0.455500.145400.810301.000001.000001.00000


Target Position: 7657, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7657GACACUAAUUUUUAUGUAU92.9874432

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7655-7677AAGACACTAATTTTTATGTATAAAUACAUAAAAAUUAGUGUCUUGACACUAAUUUUUAUGUAUAAU8.519.022


Target Position: 8147, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8147CCUAUAAGAACCAAAUACU83.85471836

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8145-8167TACCTATAAGAACCAAATACTTTAGUAUUUGGUUCUUAUAGGUACCUAUAAGAACCAAAUACUUUU6.92.822


Target Position: 1781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1781GAGCAGUAGAUCAAGUAAU89.7192798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811799GAGCAGTAGATCAAGTAATATTACTTGATCTACTGCTC0.568300.071900.801700.750001.000001.00000


Target Position: 7915, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7915CAUUUCUUUUUUCAAAUUA86.94151222

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7913-7935ATCATTTCTTTTTTCAAATTAAAUAAUUUGAAAAAAGAAAUGAUCAUUUCUUUUUUCAAAUUAAAU7.45.311


Target Position: 6226, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6226CAUUCACAUGAAAAGUUAU91.5866576

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6224-6246TACATTCACATGAAAAGTTATTTAUAACUUUUCAUGUGAAUGUACAUUCACAUGAAAAGUUAUUUU4.920.522


Target Position: 2255, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2255GCACUUACAAGAAUUUCUU82.85542051

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2253-2275TGGCACTTACAAGAATTTCTTCTAAGAAAUUCUUGUAAGUGCCAGCACUUACAAGAAUUUCUUCUU5.319.022


Target Position: 4436, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4436CAUUUGUCUUCCGAACAUU82.95562035

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4434-4456ATCATTTGTCTTCCGAACATTTGAAUGUUCGGAAGACAAAUGAUCAUUUGUCUUCCGAACAUUUGU21.114.822


Target Position: 5489, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5489CUGUUAUGCACCUUUUAUA92.1823499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7965507CTGTTATGCACCTTTTATATATAAAAGGTGCATAACAG0.546000.099900.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5487-5509TCCTGTTATGCACCTTTTATAGCUAUAAAAGGUGCAUAACAGGACUGUUAUGCACCUUUUAUAGCU-4.313.522


Target Position: 8158, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8158CAAAUACUUUAAUUAUAUU94.0226342

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8156-8178ACCAAATACTTTAATTATATTAAAAUAUAAUUAAAGUAUUUGGUCAAAUACUUUAAUUAUAUUAAU-8.64.622


Target Position: 6724, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6724CUUUAAAAAUGGUAAUAGA93.8824355

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6722-6744TACTTTAAAAATGGTAATAGAAAUCUAUUACCAUUUUUAAAGUACUUUAAAAAUGGUAAUAGAAAU6.3-9.122


Target Position: 909, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
909GGAUAAUGUGGAGGUAUUA97.0108149

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
907-929GTGGATAATGTGGAGGTATTAGAUAAUACCUCCACAUUAUCCACGGAUAAUGUGGAGGUAUUAGAU18.58.733


Target Position: 7705, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7705GACUAAAAAUAAUUAUGCU93.0417427

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7703-7725TTGACTAAAAATAATTATGCTACAGCAUAAUUAUUUUUAGUCAAGACUAAAAAUAAUUAUGCUACU15.24.922


Target Position: 8154, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8154GAACCAAAUACUUUAAUUA100.21158

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8152-8174AAGAACCAAATACTTTAATTATAUAAUUAAAGUAUUUGGUUCUUGAACCAAAUACUUUAAUUAUAU-9.718.821


Target Position: 8179, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8179GAUAGUGAAUAAAGAUGUA102.73623

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8177-8199AAGATAGTGAATAAAGATGTATAUACAUCUUUAUUCACUAUCUUGAUAGUGAAUAAAGAUGUAUAU19.220.333


Target Position: 7898, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7898CAUGUAUGAUCUUUGAUCA98.797990

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7896-7918GGCATGTATGATCTTTGATCATTUGAUCAAAGAUCAUACAUGCCCAUGUAUGAUCUUUGAUCAUUU16.313.333


Target Position: 6189, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6189CUUGUAAACUGUCUUACUU84.68391674

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6187-6209GTCTTGTAAACTGTCTTACTTATAAGUAAGACAGUUUACAAGACCUUGUAAACUGUCUUACUUAUU18.97.232


Target Position: 795, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
795GACUGAUUUGGAGAUAACA92.7968451

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
793-815AGGACTGATTTGGAGATAACAGAUGUUAUCUCCAAAUCAGUCCUGACUGAUUUGGAGAUAACAGAU14.519.223


Target Position: 4106, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4106GUAUUCAAGAUUUGAAAUA86.25751341

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4104-4126AAGTATTCAAGATTTGAAATACGUAUUUCAAAUCUUGAAUACUUGUAUUCAAGAUUUGAAAUACGU7.48.922


Target Position: 4214, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4214CCACAAAGUUUAACUUCUU86.06741386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7514232CCACAAAGTTTAACTTCTTAAGAAGTTAAACTTTGTGG0.338900.116900.706901.000000.967400.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4212-4234TGCCACAAAGTTTAACTTCTTCAAAGAAGUUAAACUUUGUGGCACCACAAAGUUUAACUUCUUCAU17.716.722


Target Position: 5217, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5217GUUAAUUUUGUAUAGUAUU82.2322174

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5215-5237TTGTTAATTTTGTATAGTATTTTAAUACUAUACAAAAUUAACAAGUUAAUUUUGUAUAGUAUUUUU6.1-9.722


Target Position: 7219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7219ACAAACAAACAAACAAAAA80.92122512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6017237ACAAACAAACAAACAAAAATTTTTGTTTGTTTGTTTGT0.476200.292700.706900.750001.000001.00000


Target Position: 5154, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5154CAUGAACAGUUAUAAACGU81.74352303

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5152-5174AGCATGAACAGTTATAAACGTGCACGUUUAUAACUGUUCAUGCUCAUGAACAGUUAUAAACGUGCU6.920.533


Target Position: 1116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1116GGGCCAUAUAUCUCAGAAA98.4306101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3421134GGGCCATATATCTCAGAAATTTCTGAGATATATGGCCC0.549200.297400.991401.000001.000001.00000


Target Position: 7692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7692ACUCACCUUUAUUGACUAA86.34071328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8557710ACTCACCTTTATTGACTAATTAGTCAATAAAGGTGAGT0.348700.299300.672400.750001.000001.00000


Target Position: 7927, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7927CAAAUUAAAGUUGUAUAAA90.0455750

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7925-7947TTCAAATTAAAGTTGTATAAAAGUUUAUACAACUUUAAUUUGAACAAAUUAAAGUUGUAUAAAAGU8.5-9.722


Target Position: 1245, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1245CAAAUUUCCAUAUACCAAU83.47791916

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1243-1265ACCAAATTTCCATATACCAATCAAUUGGUAUAUGGAAAUUUGGUCAAAUUUCCAUAUACCAAUCAU20.00.432


Target Position: 5849, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5849GAAAUUAUGUACAUGUACU92.1818500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5847-5869AAGAAATTATGTACATGTACTAAAGUACAUGUACAUAAUUUCUUGAAAUUAUGUACAUGUACUAAU20.4-10.321


Target Position: 1665, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1665CCUGUAUCAAAUAGAAAAA90.3329704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8481683CCTGTATCAAATAGAAAAATTTTTCTATTTGATACAGG0.649000.089700.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1663-1685CACCTGTATCAAATAGAAAAACCUUUUUCUAUUUGAUACAGGUGCCUGUAUCAAAUAGAAAAACCU7.120.322


Target Position: 2120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2120AGCUCCAGUUUACUAUUUU79.74552792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6322138AGCTCCAGTTTACTATTTTAAAATAGTAAACTGGAGCT0.383100.304200.853400.750001.000001.00000


Target Position: 6583, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6583GAGCAAAACUCCAUCUUAA103.83911

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6581-6603AAGAGCAAAACTCCATCTTAAAAUUAAGAUGGAGUUUUGCUCUUGAGCAAAACUCCAUCUUAAAAU13.418.600


Target Position: 6652, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6652GACACAAUUUUGUUAAUUU92.7201455

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6650-6672CAGACACAATTTTGTTAATTTGGAAAUUAACAAAAUUGUGUCUGGACACAAUUUUGUUAAUUUGGU-0.319.321


Target Position: 940, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
940GAGAAAAAUGUUUCAAGUU86.1221373

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
938-960AAGAGAAAAATGTTTCAAGTTTGAACUUGAAACAUUUUUCUCUUGAGAAAAAUGUUUCAAGUUUGU19.25.522


Target Position: 7023, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7023GUUAAAAUGUGUUGUCUAU88.8064928

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7021-7043ATGTTAAAATGTGTTGTCTATTTAUAGACAACACAUUUUAACAUGUUAAAAUGUGUUGUCUAUUUU20.3-9.722


Target Position: 1556, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1556GAAAAUGGGACACAGAAAU81.80472283

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1554-1576TCGAAAATGGGACACAGAAATTAAUUUCUGUGUCCCAUUUUCGAGAAAAUGGGACACAGAAAUUAU19.211.322


Target Position: 7908, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7908CUUUGAUCAUUUCUUUUUU80.91882513

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7906-7928ATCTTTGATCATTTCTTTTTTCAAAAAAAGAAAUGAUCAAAGAUCUUUGAUCAUUUCUUUUUUCAU5.516.321


Target Position: 5667, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5667CGUAAUACUGCUUUUUAUU84.70181671

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5665-5687AACGTAATACTGCTTTTTATTCAAAUAAAAAGCAGUAUUACGUUCGUAAUACUGCUUUUUAUUCAU-9.79.523


Target Position: 5309, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5309CAUAACUAACCUUUUUGAA88.9838908

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5307-5329CACATAACTAACCTTTTTGAATTUUCAAAAAGGUUAGUUAUGUGCAUAACUAACCUUUUUGAAUUU7.76.322


Target Position: 2211, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2211CAAUGGAAAGGAUCUUUUU85.83051425

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2209-2231CACAATGGAAAGGATCTTTTTAAAAAAAGAUCCUUUCCAUUGUGCAAUGGAAAGGAUCUUUUUAAU5.320.122


Target Position: 5954, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5954CCAAUGUGAUUGUACAAUA98.0415111

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5952-5974CACCAATGTGATTGTACAATAAAUAUUGUACAAUCACAUUGGUGCCAAUGUGAUUGUACAAUAAAU14.618.121


Target Position: 5846, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5846CAAGAAAUUAUGUACAUGU86.49641305

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5844-5866GACAAGAAATTATGTACATGTACACAUGUACAUAAUUUCUUGUCCAAGAAAUUAUGUACAUGUACU20.45.322


Target Position: 6894, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6894GAAAUAGAAGAGUUGAUAA103.07819

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6892-6914AAGAAATAGAAGAGTTGATAATAUUAUCAACUCUUCUAUUUCUUGAAAUAGAAGAGUUGAUAAUAU16.16.922


Target Position: 6990, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6990CAUGAGUAUGGUAUAUGAA100.15760

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6988-7010CCCATGAGTATGGTATATGAATGUUCAUAUACCAUACUCAUGGGCAUGAGUAUGGUAUAUGAAUGU10.220.321


Target Position: 323, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
323GAGCAUUAGAUAUUGAUGU81.94522246

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
321-343AAGAGCATTAGATATTGATGTAGACAUCAAUAUCUAAUGCUCUUGAGCAUUAGAUAUUGAUGUAGU13.619.722


Target Position: 2659, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2659GAAACACUAGAGAAUGAUA103.24814

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2657-2679TAGAAACACTAGAGAATGATATAUAUCAUUCUCUAGUGUUUCUAGAAACACUAGAGAAUGAUAUAU16.217.822


Target Position: 4929, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4929GACAUUCAAUGAAAUGCUU85.08281584

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4927-4949CCGACATTCAATGAAATGCTTGTAAGCAUUUCAUUGAAUGUCGGGACAUUCAAUGAAAUGCUUGUU18.520.531


Target Position: 8016, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8016GAAAACAUUCACUUUUGAA95.4665222

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8014-8036AAGAAAACATTCACTTTTGAAACUUCAAAAGUGAAUGUUUUCUUGAAAACAUUCACUUUUGAAACU12.25.322


Target Position: 1965, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1965CUCACUUAAUCCUGAAAAU84.06351792

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1963-1985GGCTCACTTAATCCTGAAAATCCAUUUUCAGGAUUAAGUGAGCCCUCACUUAAUCCUGAAAAUCCU12.220.322


Target Position: 515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
515CCACUUAUGCUUUACCUUC71.22734988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
853533CCACTTATGCTTTACCTTCGAAGGTAAAGCATAAGTGG0.849500.342200.672400.750001.000001.00000


Target Position: 1009, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1009GCAAAUUGUCAUCUUGAAA92.1365508

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1007-1029CAGCAAATTGTCATCTTGAAAGAUUUCAAGAUGACAAUUUGCUGGCAAAUUGUCAUCUUGAAAGAU20.44.222


Target Position: 5376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5376ACCCUAAACUUAAUAUAUA93.6218372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8735394ACCCTAAACTTAATATATATATATATTAAGTTTAGGGT0.842300.731600.810300.750001.000001.00000


Target Position: 1294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1294CCAGUCACAGCACAAAGAA87.331148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9801312CCAGTCACAGCACAAAGAATTCTTTGTGCTGTGACTGG0.470100.136800.672401.000001.000001.00000


Target Position: 6903, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6903GAGUUGAUAAUAUAUCACU90.0329751

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6901-6923AAGAGTTGATAATATATCACTGGAGUGAUAUAUUAUCAACUCUUGAGUUGAUAAUAUAUCACUGGU16.019.232


Target Position: 4284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4284GCCCAUCCUUUCAUUUUCA85.55841477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3724302GCCCATCCTTTCATTTTCATGAAAATGAAAGGATGGGC0.618200.488500.775900.750001.000001.00000


Target Position: 15, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
15GGAAGCUACAAGAAAAAAA93.3336398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
31633GGAAGCTACAAGAAAAAAATTTTTTTCTTGTAGCTTCC0.568500.264000.870701.000001.000001.00000


Target Position: 764, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
764CAUCAGAAUUUUUAAAAAA96.7124154

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
762-784TACATCAGAATTTTTAAAAAATGUUUUUUAAAAAUUCUGAUGUACAUCAGAAUUUUUAAAAAAUGU-9.120.421


Target Position: 2339, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2339CAGUUCUUCACCUUACUCU80.19742685

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2337-2359ATCAGTTCTTCACCTTACTCTTTAGAGUAAGGUGAAGAACUGAUCAGUUCUUCACCUUACUCUUUU18.917.733


Target Position: 5931, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5931GCCUAAUACCUGAAUAAGA92.1381507

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5929-5951AAGCCTAATACCTGAATAAGACTUCUUAUUCAGGUAUUAGGCUUGCCUAAUACCUGAAUAAGACUU6.912.333


Target Position: 7010, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7010GUCUUUUUUAAAUGUUAAA84.52971706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9867028GTCTTTTTTAAATGTTAAATTTAACATTTAAAAAAGAC0.307700.229000.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7008-7030ATGTCTTTTTTAAATGTTAAAATUUUAACAUUUAAAAAAGACAUGUCUUUUUUAAAUGUUAAAAUU6.95.511


Target Position: 5721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5721UCACUGAUGUUGUAAAUAA91.0837624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8845739TCACTGATGTTGTAAATAATTATTTACAACATCAGTGA0.331600.144000.689700.750001.000001.00000


Target Position: 5443, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5443CUAUUUUGCAUUGUUUUCU68.8025519

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5441-5463ACCTATTTTGCATTGTTTTCTATAGAAAACAAUGCAAAAUAGGUCUAUUUUGCAUUGUUUUCUAUU14.9-1.422


Target Position: 1172, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1172CUCUUCUUCAAGAAGUUGA77.13793460

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1170-1192TTCTCTTCTTCAAGAAGTTGAAGUCAACUUCUUGAAGAAGAGAACUCUUCUUCAAGAAGUUGAAGU19.219.122


Target Position: 7036, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7036GUCUAUUUAAUGUUAAUUA93.3505397

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7034-7056TTGTCTATTTAATGTTAATTAAAUAAUUAACAUUAAAUAGACAAGUCUAUUUAAUGUUAAUUAAAU-0.36.922


Target Position: 6180, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6180CCAGUUUGUCUUGUAAACU75.45543897

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6178-6200GACCAGTTTGTCTTGTAAACTGTAGUUUACAAGACAAACUGGUCCCAGUUUGUCUUGUAAACUGUU14.716.732


Target Position: 6623, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6623GAUUCAUUUUUAUUAGUUA103.1818

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6621-6643AAGATTCATTTTTATTAGTTACTUAACUAAUAAAAAUGAAUCUUGAUUCAUUUUUAUUAGUUACUU4.67.222


Target Position: 7122, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7122GUACCUUUGCAAAUGCAAA89.8211780

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7120-7142AAGTACCTTTGCAAATGCAAATGUUUGCAUUUGCAAAGGUACUUGUACCUUUGCAAAUGCAAAUGU20.018.622


Target Position: 7205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7205ACUGUAAUUUAAAAACAAA91.8467543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8577223ACTGTAATTTAAAAACAAATTTGTTTTTAAATTACAGT0.786300.387800.706900.750001.000001.00000


Target Position: 5401, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5401CCUGAAAAAGACUUUGAGA87.96731038

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5399-5421TTCCTGAAAAAGACTTTGAGACAUCUCAAAGUCUUUUUCAGGAACCUGAAAAAGACUUUGAGACAU16.612.223


Target Position: 7871, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7871GAAUCUAUAGGUAUCUAAA106.2954

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7869-7891ATGAATCTATAGGTATCTAAATGUUUAGAUACCUAUAGAUUCAUGAAUCUAUAGGUAUCUAAAUGU8.46.623


Target Position: 5744, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5744GCCUUAACUUUAUAUGCUU86.51091301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1655762GCCTTAACTTTATATGCTTAAGCATATAAAGTTAAGGC0.685600.754100.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5742-5764GTGCCTTAACTTTATATGCTTCCAAGCAUAUAAAGUUAAGGCACGCCUUAACUUUAUAUGCUUCCU19.718.622


Target Position: 5986, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5986CAUUAAAAUCCUACAUUUA99.185182

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5984-6006TCCATTAAAATCCTACATTTATTUAAAUGUAGGAUUUUAAUGGACAUUAAAAUCCUACAUUUAUUU6.9-9.721


Target Position: 7195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7195UCACUUAGCCACUGUAAUU77.68713325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6737213TCACTTAGCCACTGTAATTAATTACAGTGGCTAAGTGA0.396800.118800.715500.750001.000001.00000


Target Position: 529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
529CCUUCUAUUUAUCCUUCUA94.8173261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
930547CCTTCTATTTATCCTTCTATAGAAGGATAAATAGAAGG0.571200.554600.672401.000001.000001.00000