Input target sequence

Length: 4772
GCTCAGTTGCCGGGCGGGGGAGGGCGCGTCCGGTTTTTCTCAGGGGACGTTGAAATTATTTTTGTAACGGGAGTCGGGAGAGGACGGGGCGTGCCCCGACGTGCGCGCGCGTCGTCCTCCCCGGCGCTCCTCCACAGCTCGCTGGCTCCCGCCGCGGAAAGGCGTCATGCCGCCCAAAACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGGAACCCCCGGCACCGCCGCCGCCGCCCCCTCCTGAGGAGGACCCAGAGCAGGACAGCGGCCCGGAGGACCTGCCTCTCGTCAGGCTTGAGTTTGAAGAAACAGAAGAACCTGATTTTACTGCATTATGTCAGAAATTAAAGATACCAGATCATGTCAGAGAGAGAGCTTGGTTAACTTGGGAGAAAGTTTCATCTGTGGATGGAGTATTGGGAGGTTATATTCAAAAGAAAAAGGAACTGTGGGGAATCTGTATCTTTATTGCAGCAGTTGACCTAGATGAGATGTCGTTCACTTTTACTGAGCTACAGAAAAACATAGAAATCAGTGTCCATAAATTCTTTAACTTACTAAAAGAAATTGATACCAGTACCAAAGTTGATAATGCTATGTCAAGACTGTTGAAGAAGTATGATGTATTGTTTGCACTCTTCAGCAAATTGGAAAGGACATGTGAACTTATATATTTGACACAACCCAGCAGTTCGATATCTACTGAAATAAATTCTGCATTGGTGCTAAAAGTTTCTTGGATCACATTTTTATTAGCTAAAGGGGAAGTATTACAAATGGAAGATGATCTGGTGATTTCATTTCAGTTAATGCTATGTGTCCTTGACTATTTTATTAAACTCTCACCTCCCATGTTGCTCAAAGAACCATATAAAACAGCTGTTATACCCATTAATGGTTCACCTCGAACACCCAGGCGAGGTCAGAACAGGAGTGCACGGATAGCAAAACAACTAGAAAATGATACAAGAATTATTGAAGTTCTCTGTAAAGAACATGAATGTAATATAGATGAGGTGAAAAATGTTTATTTCAAAAATTTTATACCTTTTATGAATTCTCTTGGACTTGTAACATCTAATGGACTTCCAGAGGTTGAAAATCTTTCTAAACGATACGAAGAAATTTATCTTAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGACTGATTCTATAGACAGTTTTGAAACACAGAGAACACCACGAAAAAGTAACCTTGATGAAGAGGTGAATGTAATTCCTCCACACACTCCAGTTAGGACTGTTATGAACACTATCCAACAATTAATGATGATTTTAAATTCAGCAAGTGATCAACCTTCAGAAAATCTGATTTCCTATTTTAACAACTGCACAGTGAATCCAAAAGAAAGTATACTGAAAAGAGTGAAGGATATAGGATACATCTTTAAAGAGAAATTTGCTAAAGCTGTGGGACAGGGTTGTGTCGAAATTGGATCACAGCGATACAAACTTGGAGTTCGCTTGTATTACCGAGTAATGGAATCCATGCTTAAATCAGAAGAAGAACGATTATCCATTCAAAATTTTAGCAAACTTCTGAATGACAACATTTTTCATATGTCTTTATTGGCGTGCGCTCTTGAGGTTGTAATGGCCACATATAGCAGAAGTACATCTCAGAATCTTGATTCTGGAACAGATTTGTCTTTCCCATGGATTCTGAATGTGCTTAATTTAAAAGCCTTTGATTTTTACAAAGTGATCGAAAGTTTTATCAAAGCAGAAGGCAACTTGACAAGAGAAATGATAAAACATTTAGAACGATGTGAACATCGAATCATGGAATCCCTTGCATGGCTCTCAGATTCACCTTTATTTGATCTTATTAAACAATCAAAGGACCGAGAAGGACCAACTGATCACCTTGAATCTGCTTGTCCTCTTAATCTTCCTCTCCAGAATAATCACACTGCAGCAGATATGTATCTTTCTCCTGTAAGATCTCCAAAGAAAAAAGGTTCAACTACGCGTGTAAATTCTACTGCAAATGCAGAGACACAAGCAACCTCAGCCTTCCAGACCCAGAAGCCATTGAAATCTACCTCTCTTTCACTGTTTTATAAAAAAGTGTATCGGCTAGCCTATCTCCGGCTAAATACACTTTGTGAACGCCTTCTGTCTGAGCACCCAGAATTAGAACATATCATCTGGACCCTTTTCCAGCACACCCTGCAGAATGAGTATGAACTCATGAGAGACAGGCATTTGGACCAAATTATGATGTGTTCCATGTATGGCATATGCAAAGTGAAGAATATAGACCTTAAATTCAAAATCATTGTAACAGCATACAAGGATCTTCCTCATGCTGTTCAGGAGACATTCAAACGTGTTTTGATCAAAGAAGAGGAGTATGATTCTATTATAGTATTCTATAACTCGGTCTTCATGCAGAGACTGAAAACAAATATTTTGCAGTATGCTTCCACCAGGCCCCCTACCTTGTCACCAATACCTCACATTCCTCGAAGCCCTTACAAGTTTCCTAGTTCACCCTTACGGATTCCTGGAGGGAACATCTATATTTCACCCCTGAAGAGTCCATATAAAATTTCAGAAGGTCTGCCAACACCAACAAAAATGACTCCAAGATCAAGAATCTTAGTATCAATTGGTGAATCATTCGGGACTTCTGAGAAGTTCCAGAAAATAAATCAGATGGTATGTAACAGCGACCGTGTGCTCAAAAGAAGTGCTGAAGGAAGCAACCCTCCTAAACCACTGAAAAAACTACGCTTTGATATTGAAGGATCAGATGAAGCAGATGGAAGTAAACATCTCCCAGGAGAGTCCAAATTTCAGCAGAAACTGGCAGAAATGACTTCTACTCGAACACGAATGCAAAAGCAGAAAATGAATGATAGCATGGATACCTCAAACAAGGAAGAGAAATGAGGATCTCAGGACCTTGGTGGACACTGTGTACACCTCTGGATTCATTGTCTCTCACAGATGTGACTGTATAACTTTCCCAGGTTCTGTTTATGGCCACATTTAATATCTTCAGCTCTTTTTGTGGATATAAAATGTGCAGATGCAATTGTTTGGGTGATTCCTAAGCCACTTGAAATGTTAGTCATTGTTATTTATACAAGATTGAAAATCTTGTGTAAATCCTGCCATTTAAAAAGTTGTAGCAGATTGTTTCCTCTTCCAAAGTAAAATTGCTGTGCTTTATGGATAGTAAGAATGGCCCTAGAGTGGGAGTCCTGATAACCCAGGCCTGTCTGACTACTTTGCCTTCTTTTGTAGCATATAGGTGATGTTTGCTCTTGTTTTTATTAATTTATATGTATATTTTTTTAATTTAACATGAACACCCTTAGAAAATGTGTCCTATCTATCTTCCAAATGCAATTTGATTGACTGCCCATTCACCAAAATTATCCTGAACTCTTCTGCAAAAATGGATATTATTAGAAATTAGAAAAAAATTACTAATTTTACACATTAGATTTTATTTTACTATTGGAATCTGATATACTGTGTGCTTGTTTTATAAAATTTTGCTTTTAATTAAATAAAAGCTGGAAGCAAAGTATAACCATATGATACTATCATACTACTGAAACAGATTTCATACCTCAGAATGTAAAAGAACTTACTGATTATTTTCTTCATCCAACTTATGTTTTTAAATGAGGATTATTGATAGTACTCTTGGTTTTTATACCATTCAGATCACTGAATTTATAAAGTACCCATCTAGTACTTGAAAAAGTAAAGTGTTCTGCCAGATCTTAGGTATAGAGGACCCTAACACAGTATATCCCAAGTGCACTTTCTAATGTTTCTGGGTCCTGAAGAATTAAGATACAAATTAATTTTACTCCATAAACAGACTGTTAATTATAGGAGCCTTAATTTTTTTTTCATAGAGATTTGTCTAATTGCATCTCAAAATTATTCTGCCCTCCTTAATTTGGGAAGGTTTGTGTTTTCTCTGGAATGGTACATGTCTTCCATGTATCTTTTGAACTGGCAATTGTCTATTTATCTTTTATTTTTTTAAGTCAGTATGGTCTAACACTGGCATGTTCAAAGCCACATTATTTCTAGTCCAAAATTACAAGTAATCAAGGGTCATTATGGGTTAGGCATTAATGTTTCTATCTGATTTTGTGCAAAAGCTTCAAATTAAAACAGCTGCATTAGAAAAAGAGGCGCTTCTCCCCTCCCCTACACCTAAAGGTGTATTTAAACTATCTTGTGTGATTAACTTATTTAGAGATGCTGTAACTTAAAATAGGGGATATTTAAGGTAGCTTCAGCTAGCTTTTAGGAAAATCACTTTGTCTAACTCAGAATTATTTTTAAAAAGAAATCTGGTCTTGTTAGAAAACAAAATTTTATTTTGTGCTCATTTAAGTTTCAAACTTACTATTTTGACAGTTATTTTGATAACAATGACACTAGAAAACTTGACTCCATTTCATCATTGTTTCTGCATGAATATCATACAAATCAGTTAGTTTTTAGGTCAAGGGCTTACTATTTCTGGGTCTTTTGCTACTAAGTTCACATTAGAATTAGTGCCAGAATTTTAGGAACTTCAGAGATCGTGTATTGAGATTTCTTAAATAATGCTTCAGATATTATTGCTTTATTGCTTTTTTGTATTGGTTAAAACTGTACATTTAAAATTGCTATGTTACTATTTTCTACAATTAATAGTTTGTCTATTTTAAAATAAATTAGTTGTTAAGAGTCTTAA