Input target sequence

Length: 1127
CACGGGCGGGGCGGGGCCTGGGTCCACCGGGGTTCTGAGGGGAGACTGAGGTCCTGAGCCGACAGCCTCAGCTCCCTGCCAGGCCAGACCCGGCAGACAGATGAGGGCCCAGGAGGCCTGGCGGGCCTGGGGGCGCTACGGTGGGAGAGGAAGCCAGGGGTACCTGCCTCTGCCTTCCAGGGCCACCGTTGGCCCCAGCTGTGCCTTGACTACGTAACATCTTGTCCTCACAGCCCAGAGCATGTTCCAGATCCCAGAGTTTGAGCCGAGTGAGCAGGAAGACTCCAGCTCTGCAGAGAGGGGCCTGGGCCCCAGCCCCGCAGGGGACGGGCCCTCAGGCTCCGGCAAGCATCATCGCCAGGCCCCAGGCCTCCTGTGGGACGCCAGTCACCAGCAGGAGCAGCCAACCAGCAGCAGCCATCATGGAGGCGCTGGGGCTGTGGAGATCCGGAGTCGCCACAGCTCCTACCCCGCGGGGACGGAGGACGACGAAGGGATGGGGGAGGAGCCCAGCCCCTTTCGGGGCCGCTCGCGCTCGGCGCCCCCCAACCTCTGGGCAGCACAGCGCTATGGCCGCGAGCTCCGGAGGATGAGTGACGAGTTTGTGGACTCCTTTAAGAAGGGACTTCCTCGCCCGAAGAGCGCGGGCACAGCAACGCAGATGCGGCAAAGCTCCAGCTGGACGCGAGTCTTCCAGTCCTGGTGGGATCGGAACTTGGGCAGGGGAAGCTCCGCCCCCTCCCAGTGACCTTCGCTCCACATCCCGAAACTCCACCCGTTCCCACTGCCCTGGGCAGCCATCTTGAATATGGGCGGAAGTACTTCCCTCAGGCCTATGCAAAAAGAGGATCCGTGCTGTCTCCTTTGGAGGGAGGGCTGACCCAGATTCCCTTCCGGTGCGTGTGAAGCCACGGAAGGCTTGGTCCCATCGGAAGTTTTGGGTTTTCCGCCCACAGCCGCCGGAAGTGGCTCCGTGGCCCCGCCCTCAGGCTCCGGGCTTTCCCCCAGGCGCCTGCGCTAAGTCGCGAGCCAGGTTTAACCGTTGCGTCACCGGGACCCGAGCCCCCGCGATGCCCTGGGGGCCGTGCTCACTACCAAATGTTAATAAAGCCCGCGTCTGTGCCGCC