siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Sidirect 805  
Biltr, Rnaxs, Sidirect 205  
Biltr, Ernai, Rnaxs 244   792   825   1082   1087   1088   1090  
Biltr, Ernai 234   599   927  
Biltr, Rnaxs 18   19   20   21   128   129   130   132   133   134   135   157   158   159   194   195   197   198   199   200  
201   202   203   204   207   208   212   214   238   239   243   254   263   264   265   349   384   385   443   472  
473   474   475   476   477   480   481   487   579   580   582   583   584   585   586   587   588   735   736   737  
738   739   741   756   757   762   763   788   789   790   791   819   823   824   826   827   828   829   831   832  
833   837   848   875   1031   1033   1084   1085   1086   1089   1091   1092  


Target Position: 443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
443GAGAUCCGGAGUCGCCACA76.1637133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
92461GAGATCCGGAGTCGCCACATGTGGCGACTCCGGATCTC0.026500.001400.603400.500000.983700.62500


Target Position: 1090, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1090CACUACCAAAUGUUAAUAA92.10327

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9109019CACTACCAAATGTTAATAA1/1/0/087.68BADNM_032989.2+NM_004322.31+1NANANA11:64037321..64037339(-)00BAD(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
521108CACTACCAAATGTTAATAATTATTAACATTTGGTAGTG0.331000.305000.758600.750001.000001.00000


Target Position: 384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
384CCAGUCACCAGCAGGAGCA78.46997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95402CCAGTCACCAGCAGGAGCATGCTCCTGCTGGTGACTGG0.020100.004900.491400.750000.934800.87500


Target Position: 264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
264AGCCGAGUGAGCAGGAAGA77.9793106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
91282AGCCGAGTGAGCAGGAAGATCTTCCTGCTCACTCGGCT0.028300.010200.629300.500000.940200.62500


Target Position: 756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756UCCACAUCCCGAAACUCCA72.8358199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88774TCCACATCCCGAAACTCCATGGAGTTTCGGGATGTGGA0.506500.406600.525900.500001.000001.00000


Target Position: 159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
159GGUACCUGCCUCUGCCUUC68.622291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
49177GGTACCTGCCTCTGCCTTCGAAGGCAGAGGCAGGTACC0.120100.028800.681000.750000.967401.00000


Target Position: 20, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
20GGGUCCACCGGGGUUCUGA75.4607147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6538GGGTCCACCGGGGTTCTGATCAGAACCCCGGTGGACCC0.112500.004000.767200.750001.000001.00000


Target Position: 585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
585GGAGGAUGAGUGACGAGUU91.72519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
46603GGAGGATGAGTGACGAGTTAACTCGTCACTCATCCTCC0.119400.015000.724101.000001.000001.00000


Target Position: 789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
789CCUGGGCAGCCAUCUUGAA84.99334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
58807CCTGGGCAGCCATCTTGAATTCAAGATGGCTGCCCAGG0.410400.005000.672401.000000.956500.75000


Target Position: 199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
199CUGUGCCUUGACUACGUAA89.240813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
44217CTGTGCCTTGACTACGTAATTACGTAGTCAAGGCACAG0.129800.009900.750000.750001.000001.00000


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737CCCUCCCAGUGACCUUCGC50.7909804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
87755CCCTCCCAGTGACCTTCGCGCGAAGGTCACTGGGAGGG0.082200.001700.569000.500001.000001.00000


Target Position: 739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
739CUCCCAGUGACCUUCGCUC62.3718458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
89757CTCCCAGTGACCTTCGCTCGAGCGAAGGTCACTGGGAG0.090300.002000.500000.500000.994600.62500


Target Position: 1091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1091ACUACCAAAUGUUAAUAAA88.836614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
331109ACTACCAAATGTTAATAAATTTATTAACATTTGGTAGT0.320100.273300.706900.750001.000001.00000


Target Position: 1092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1092CUACCAAAUGUUAAUAAAG77.2163117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801110CTACCAAATGTTAATAAAGCTTTATTAACATTTGGTAG0.247600.181600.534500.500001.000001.00000


Target Position: 197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
197AGCUGUGCCUUGACUACGU76.0209135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
94215AGCTGTGCCTTGACTACGTACGTAGTCAAGGCACAGCT0.062100.011800.577600.500001.000001.00000


Target Position: 837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
837UGCAAAAAGAGGAUCCGUG62.0282466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
98855TGCAAAAAGAGGATCCGTGCACGGATCCTCTTTTTGCA0.015000.005200.560300.500001.000001.00000


Target Position: 203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
203GCCUUGACUACGUAACAUC74.3557177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
66221GCCTTGACTACGTAACATCGATGTTACGTAGTCAAGGC0.595300.014400.819000.750000.951100.62500


Target Position: 828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
828UCAGGCCUAUGCAAAAAGA74.6719169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95846TCAGGCCTATGCAAAAAGATCTTTTTGCATAGGCCTGA0.199300.021100.500000.500001.000001.00000


Target Position: 243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
243UGUUCCAGAUCCCAGAGUU75.6099141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
82261TGTTCCAGATCCCAGAGTTAACTCTGGGATCTGGAACA0.045200.022200.560300.750000.923900.75000


Target Position: 833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833CCUAUGCAAAAAGAGGAUC58.7704578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86851CCTATGCAAAAAGAGGATCGATCCTCTTTTTGCATAGG0.055800.001800.663800.750001.000001.00000


Target Position: 239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
239AGCAUGUUCCAGAUCCCAG69.5128265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
68257AGCATGTTCCAGATCCCAGCTGGGATCTGGAACATGCT0.087300.059500.569000.500001.000001.00000


Target Position: 385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
385CAGUCACCAGCAGGAGCAG70.0029250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
94403CAGTCACCAGCAGGAGCAGCTGCTCCTGCTGGTGACTG0.022600.005200.500000.500000.934800.87500


Target Position: 207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
207UGACUACGUAACAUCUUGU76.1945131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
91225TGACTACGTAACATCTTGTACAAGATGTTACGTAGTCA0.067600.043500.517200.500000.962000.62500


Target Position: 487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
487CGACGAAGGGAUGGGGGAG63.6795432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
94505CGACGAAGGGATGGGGGAGCTCCCCCATCCCTTCGTCG0.068400.005700.482800.750001.000001.00000


Target Position: 208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
208GACUACGUAACAUCUUGUC69.9866251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
87226GACTACGTAACATCTTGTCGACAAGATGTTACGTAGTC0.068700.044500.500000.500001.000001.00000


Target Position: 477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
477GGACGGAGGACGACGAAGG66.7864333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
83495GGACGGAGGACGACGAAGGCCTTCGTCGTCCTCCGTCC0.045200.003300.525900.500001.000001.00000


Target Position: 130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
130GGGGCGCUACGGUGGGAGA77.8884107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
85148GGGGCGCTACGGTGGGAGATCTCCCACCGTAGCGCCCC0.148700.001800.767200.750001.000001.00000


Target Position: 134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
134CGCUACGGUGGGAGAGGAA84.22540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
71152CGCTACGGTGGGAGAGGAATTCCTCTCCCACCGTAGCG0.172800.003000.750001.000001.000001.00000


Target Position: 580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
580GCUCCGGAGGAUGAGUGAC65.3108384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
81598GCTCCGGAGGATGAGTGACGTCACTCATCCTCCGGAGC0.204800.002000.534500.750000.918500.62500


Target Position: 831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831GGCCUAUGCAAAAAGAGGA83.959444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
78849GGCCTATGCAAAAAGAGGATCCTCTTTTTGCATAGGCC0.076000.002100.629300.750001.000001.00000


Target Position: 823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
823UUCCCUCAGGCCUAUGCAA71.038228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
82841TTCCCTCAGGCCTATGCAATTGCATAGGCCTGAGGGAA0.145000.004100.525900.500001.000001.00000


Target Position: 481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
481GGAGGACGACGAAGGGAUG75.3122149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
98499GGAGGACGACGAAGGGATGCATCCCTTCGTCGTCCTCC0.047500.001100.715500.750001.000001.00000


Target Position: 875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
875GGCUGACCCAGAUUCCCUU81.974663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
90893GGCTGACCCAGATTCCCTTAAGGGAATCTGGGTCAGCC0.030300.010700.862101.000001.000001.00000


Target Position: 19, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
19UGGGUCCACCGGGGUUCUG44.1778950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9837TGGGTCCACCGGGGTTCTGCAGAACCCCGGTGGACCCA0.072000.002800.560300.500000.994600.75000


Target Position: 1087, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1087GCUCACUACCAAAUGUUAA91.298810

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7108719GCTCACTACCAAATGTTAA1/1/0/088.67BADNM_032989.2+NM_004322.31+1NANANA11:64037324..64037342(-)00BAD(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141105GCTCACTACCAAATGTTAATTAACATTTGGTAGTGAGC0.396700.151400.819001.000000.972800.87500


Target Position: 265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
265GCCGAGUGAGCAGGAAGAC63.4681439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97283GCCGAGTGAGCAGGAAGACGTCTTCCTGCTCACTCGGC0.016000.002300.681000.750001.000001.00000


Target Position: 129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
129GGGGGCGCUACGGUGGGAG52.921750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
90147GGGGGCGCTACGGTGGGAGCTCCCACCGTAGCGCCCCC0.135800.001500.681000.750001.000001.00000


Target Position: 349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
349GCAUCAUCGCCAGGCCCCA76.173132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86367GCATCATCGCCAGGCCCCATGGGGCCTGGCGATGATGC0.076500.006900.508600.750001.000001.00000


Target Position: 157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
157GGGGUACCUGCCUCUGCCU73.9706180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
55175GGGGTACCTGCCTCTGCCTAGGCAGAGGCAGGTACCCC0.090500.008400.646600.750000.967400.75000


Target Position: 599, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
599GAGUUUGUGGACUCCUUUA94.34625

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_359919GAGTTTGTGGACTCCTTTA1/1/0/091.46BADNM_032989.2+NM_004322.31+1NANANANA00BAD(0.002)


Target Position: 1085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1085GUGCUCACUACCAAAUGUU78.2208101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
571103GTGCTCACTACCAAATGTTAACATTTGGTAGTGAGCAC0.431700.121200.646600.750000.972800.75000


Target Position: 158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
158GGGUACCUGCCUCUGCCUU73.1396195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
50176GGGTACCTGCCTCTGCCTTAAGGCAGAGGCAGGTACCC0.105500.018700.853401.000000.967400.87500


Target Position: 1088, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1088CUCACUACCAAAUGUUAAU79.505785

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4108819CTCACTACCAAATGTTAAT1/1/0/091.46BADNM_032989.2+NM_004322.31+1NANANA11:64037323..64037341(-)00BAD(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
241106CTCACTACCAAATGTTAATATTAACATTTGGTAGTGAG0.373700.335600.801700.750000.972800.75000


Target Position: 473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
473GCGGGGACGGAGGACGACG56.5366653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
89491GCGGGGACGGAGGACGACGCGTCGTCCTCCGTCCCCGC0.031100.003000.646600.500001.000001.00000


Target Position: 829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
829CAGGCCUAUGCAAAAAGAG69.6156258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
96847CAGGCCTATGCAAAAAGAGCTCTTTTTGCATAGGCCTG0.041900.001200.474100.500001.000001.00000


Target Position: 1089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1089UCACUACCAAAUGUUAAUA77.6935111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
611107TCACTACCAAATGTTAATATATTAACATTTGGTAGTGA0.352300.317300.681000.750000.972800.62500


Target Position: 738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
738CCUCCCAGUGACCUUCGCU71.6621221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
92756CCTCCCAGTGACCTTCGCTAGCGAAGGTCACTGGGAGG0.080500.001900.491400.750001.000001.00000


Target Position: 475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
475GGGGACGGAGGACGACGAA81.948464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73493GGGGACGGAGGACGACGAATTCGTCGTCCTCCGTCCCC0.101600.002700.819001.000001.000001.00000


Target Position: 204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
204CCUUGACUACGUAACAUCU86.756221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
59222CCTTGACTACGTAACATCTAGATGTTACGTAGTCAAGG0.698700.016500.620700.750000.962000.62500


Target Position: 848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
848GAUCCGUGCUGUCUCCUUU87.469818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
75866GATCCGTGCTGTCTCCTTTAAAGGAGACAGCACGGATC0.071100.002500.681000.750001.000001.00000


Target Position: 1033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1033GGUUUAACCGUUGCGUCAC66.7366334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
851051GGTTTAACCGTTGCGTCACGTGACGCAACGGTTAAACC0.043900.007600.560300.750000.902200.62500


Target Position: 263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
263GAGCCGAGUGAGCAGGAAG76.5388127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97281GAGCCGAGTGAGCAGGAAGCTTCCTGCTCACTCGGCTC0.047800.008300.672400.500000.940200.75000


Target Position: 584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
584CGGAGGAUGAGUGACGAGU72.6326200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
65602CGGAGGATGAGTGACGAGTACTCGTCACTCATCCTCCG0.119500.009900.706900.750001.000001.00000


Target Position: 1082, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1082GCCGUGCUCACUACCAAAU75.9169137

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6108219GCCGTGCTCACTACCAAAT1/1/0/088.67BADNM_032989.2+NM_004322.31+1NANANA11:64037329..64037347(-)00BAD(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
271100GCCGTGCTCACTACCAAATATTTGGTAGTGAGCACGGC0.856100.019000.991401.000001.000001.00000


Target Position: 212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
212ACGUAACAUCUUGUCCUCA81.053971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
87230ACGTAACATCTTGTCCTCATGAGGACAAGATGTTACGT0.035500.023600.551700.500000.983701.00000


Target Position: 480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
480CGGAGGACGACGAAGGGAU78.02105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
82498CGGAGGACGACGAAGGGATATCCCTTCGTCGTCCTCCG0.057600.001900.732801.000001.000001.00000


Target Position: 826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
826CCUCAGGCCUAUGCAAAAA83.638448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
31844CCTCAGGCCTATGCAAAAATTTTTGCATAGGCCTGAGG0.173300.016700.844801.000001.000001.00000


Target Position: 587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
587AGGAUGAGUGACGAGUUUG67.871309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
89605AGGATGAGTGACGAGTTTGCAAACTCGTCACTCATCCT0.053700.025000.698300.500001.000001.00000


Target Position: 234, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
234CCCAGAGCAUGUUCCAGAU84.491939

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_523419CCCAGAGCATGTTCCAGAT1/1/0/089.21BADNM_032989.2+NM_004322.31+1NANANA11:64051830..64051848(-)00BAD(0.002)


Target Position: 788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
788CCCUGGGCAGCCAUCUUGA77.4624114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
62806CCCTGGGCAGCCATCTTGATCAAGATGGCTGCCCAGGG0.373400.004700.767200.750000.956500.87500


Target Position: 1084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1084CGUGCUCACUACCAAAUGU85.022133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
681102CGTGCTCACTACCAAATGTACATTTGGTAGTGAGCACG0.449600.102800.569000.750000.972800.62500


Target Position: 741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
741CCCAGUGACCUUCGCUCCA75.1285157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
66759CCCAGTGACCTTCGCTCCATGGAGCGAAGGTCACTGGG0.105200.003900.646600.750000.978300.87500


Target Position: 736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736CCCCUCCCAGUGACCUUCG51.5487786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
89754CCCCTCCCAGTGACCTTCGCGAAGGTCACTGGGAGGGG0.044000.001500.698300.500001.000001.00000


Target Position: 132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
132GGCGCUACGGUGGGAGAGG54.6488703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95150GGCGCTACGGTGGGAGAGGCCTCTCCCACCGTAGCGCC0.130600.001200.655200.500001.000001.00000


Target Position: 476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
476GGGACGGAGGACGACGAAG67.2933325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
72494GGGACGGAGGACGACGAAGCTTCGTCGTCCTCCGTCCC0.060800.004600.853400.750001.000001.00000


Target Position: 586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
586GAGGAUGAGUGACGAGUUU85.660524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
48604GAGGATGAGTGACGAGTTTAAACTCGTCACTCATCCTC0.115200.026600.810300.750001.000001.00000


Target Position: 792, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792GGGCAGCCAUCUUGAAUAU87.681816

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_279219GGGCAGCCATCTTGAATAT1/1/0/093.71BADNM_032989.2+NM_004322.31+1NANANA11:64037619..64037637(-)00BAD(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
57810GGGCAGCCATCTTGAATATATATTCAAGATGGCTGCCC0.142800.005100.948301.000001.000001.00000


Target Position: 824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
824UCCCUCAGGCCUAUGCAAA70.6236237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
63842TCCCTCAGGCCTATGCAAATTTGCATAGGCCTGAGGGA0.167400.013100.870700.750001.000001.00000


Target Position: 762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
762UCCCGAAACUCCACCCGUU68.7519287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
32780TCCCGAAACTCCACCCGTTAACGGGTGGAGTTTCGGGA0.306200.201300.724100.750000.913000.62500


Target Position: 583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
583CCGGAGGAUGAGUGACGAG71.9196214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
62601CCGGAGGATGAGTGACGAGCTCGTCACTCATCCTCCGG0.121900.005500.603400.750001.000001.00000


Target Position: 735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
735CCCCCUCCCAGUGACCUUC52.6475759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
93753CCCCCTCCCAGTGACCTTCGAAGGTCACTGGGAGGGGG0.026400.002000.819000.750001.000001.00000


Target Position: 200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
200UGUGCCUUGACUACGUAAC56.0886664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
72218TGTGCCTTGACTACGTAACGTTACGTAGTCAAGGCACA0.606600.009000.560300.500001.000001.00000


Target Position: 819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819GUACUUCCCUCAGGCCUAU76.5114128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
77837GTACTTCCCTCAGGCCTATATAGGCCTGAGGGAAGTAC0.097700.002100.637900.750001.000001.00000


Target Position: 588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
588GGAUGAGUGACGAGUUUGU85.371529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
75606GGATGAGTGACGAGTTTGTACAAACTCGTCACTCATCC0.057300.025800.663800.750001.000001.00000


Target Position: 790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
790CUGGGCAGCCAUCUUGAAU74.4505175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
61808CTGGGCAGCCATCTTGAATATTCAAGATGGCTGCCCAG0.404000.004900.775900.750000.956500.62500


Target Position: 825, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
825CCCUCAGGCCUAUGCAAAA87.530817

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_182519CCCTCAGGCCTATGCAAAA1/1/0/097.75BADNM_032989.2+NM_004322.31+1NANANA11:64037586..64037604(-)00BAD(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
26843CCCTCAGGCCTATGCAAAATTTTGCATAGGCCTGAGGG0.199900.019200.991401.000001.000001.00000


Target Position: 791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791UGGGCAGCCAUCUUGAAUA81.049572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
60809TGGGCAGCCATCTTGAATATATTCAAGATGGCTGCCCA0.352500.004900.801700.750000.983700.62500


Target Position: 763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
763CCCGAAACUCCACCCGUUC58.7069584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
46781CCCGAAACTCCACCCGTTCGAACGGGTGGAGTTTCGGG0.288600.187100.819000.750000.913000.62500


Target Position: 205, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
205CUUGACUACGUAACAUCUU75.132156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88223CTTGACTACGTAACATCTTAAGATGTTACGTAGTCAAG0.567700.020500.500000.750000.962000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
203-225GCCTTGACTACGTAACATCTTGTAAGAUGUUACGUAGUCAAGGCCUUGACUACGUAACAUCUUGUU19.220.333


Target Position: 128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
128UGGGGGCGCUACGGUGGGA61.2366493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97146TGGGGGCGCTACGGTGGGATCCCACCGTAGCGCCCCCA0.115900.001300.474100.500001.000001.00000


Target Position: 135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
135GCUACGGUGGGAGAGGAAG62.4907454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
60153GCTACGGTGGGAGAGGAAGCTTCCTCTCCCACCGTAGC0.119900.020600.715500.750001.000001.00000


Target Position: 133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
133GCGCUACGGUGGGAGAGGA79.767382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97151GCGCTACGGTGGGAGAGGATCCTCTCCCACCGTAGCGC0.127000.001100.551700.750001.000001.00000


Target Position: 21, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
21GGUCCACCGGGGUUCUGAG74.0759179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7939GGTCCACCGGGGTTCTGAGCTCAGAACCCCGGTGGACC0.103400.003400.543100.750001.000001.00000


Target Position: 194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
194CCCAGCUGUGCCUUGACUA83.071550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73212CCCAGCTGTGCCTTGACTATAGTCAAGGCACAGCTGGG0.060400.017800.819001.000000.972800.75000


Target Position: 254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
254CCAGAGUUUGAGCCGAGUG67.7696314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
99272CCAGAGTTTGAGCCGAGTGCACTCGGCTCAAACTCTGG0.012700.001200.551700.750001.000001.00000


Target Position: 805, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
805GAAUAUGGGCGGAAGUACU85.34530

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
803-825TTGAATATGGGCGGAAGTACTTCAGUACUUCCGCCCAUAUUCAAGAAUAUGGGCGGAAGUACUUCU21.412.633


Target Position: 582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
582UCCGGAGGAUGAGUGACGA71.323225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
82600TCCGGAGGATGAGTGACGATCGTCACTCATCCTCCGGA0.128100.003300.577600.500000.994600.62500


Target Position: 195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
195CCAGCUGUGCCUUGACUAC71.7098219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
63213CCAGCTGTGCCTTGACTACGTAGTCAAGGCACAGCTGG0.074500.015100.663800.750000.994600.75000


Target Position: 927, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
927CAUCGGAAGUUUUGGGUUU78.543596

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1092719CATCGGAAGTTTTGGGTTT1/1/0/087.05BADNM_032989.2+NM_004322.31+1NANANA11:64037484..64037502(-)00BAD(0.002)


Target Position: 827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
827CUCAGGCCUAUGCAAAAAG64.0188426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
83845CTCAGGCCTATGCAAAAAGCTTTTTGCATAGGCCTGAG0.126500.017600.672400.500001.000001.00000


Target Position: 202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
202UGCCUUGACUACGUAACAU75.8241139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
37220TGCCTTGACTACGTAACATATGTTACGTAGTCAAGGCA0.598100.014000.698300.750001.000001.00000


Target Position: 757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
757CCACAUCCCGAAACUCCAC66.3142345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
78775CCACATCCCGAAACTCCACGTGGAGTTTCGGGATGTGG0.488000.350500.551700.750001.000001.00000


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832GCCUAUGCAAAAAGAGGAU77.5483112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
84850GCCTATGCAAAAAGAGGATATCCTCTTTTTGCATAGGC0.062100.001900.819001.000001.000001.00000


Target Position: 244, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
244GUUCCAGAUCCCAGAGUUU82.720454

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_824419GTTCCAGATCCCAGAGTTT1/1/0/088.31BADNM_032989.2+NM_004322.31+1NANANA11:64051820..64051838(-)00BAD(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88262GTTCCAGATCCCAGAGTTTAAACTCTGGGATCTGGAAC0.034500.015000.646600.750000.923900.75000


Target Position: 18, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
18CUGGGUCCACCGGGGUUCU59.4611553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8836CTGGGTCCACCGGGGTTCTAGAACCCCGGTGGACCCAG0.051900.001600.560300.500000.994600.75000


Target Position: 201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
201GUGCCUUGACUACGUAACA85.372828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
99219GTGCCTTGACTACGTAACATGTTACGTAGTCAAGGCAC0.598600.012200.586200.500001.000001.00000


Target Position: 198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
198GCUGUGCCUUGACUACGUA92.92146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
44216GCTGTGCCTTGACTACGTATACGTAGTCAAGGCACAGC0.152700.010800.672401.000001.000001.00000


Target Position: 1086, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1086UGCUCACUACCAAAUGUUA87.068619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181104TGCTCACTACCAAATGTTATAACATTTGGTAGTGAGCA0.415500.129100.819000.750000.972800.87500


Target Position: 238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
238GAGCAUGUUCCAGAUCCCA85.627225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
98256GAGCATGTTCCAGATCCCATGGGATCTGGAACATGCTC0.158900.067600.465500.500001.000001.00000


Target Position: 214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
214GUAACAUCUUGUCCUCACA91.88738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95232GTAACATCTTGTCCTCACATGTGAGGACAAGATGTTAC0.053200.009700.474100.500000.972800.62500


Target Position: 1031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1031CAGGUUUAACCGUUGCGUC68.7996285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
991049CAGGTTTAACCGTTGCGTCGACGCAACGGTTAAACCTG0.019200.001400.465500.500000.945700.75000


Target Position: 474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
474CGGGGACGGAGGACGACGA78.739393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
74492CGGGGACGGAGGACGACGATCGTCGTCCTCCGTCCCCG0.078000.002500.620700.750001.000001.00000


Target Position: 472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472CGCGGGGACGGAGGACGAC57.804614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
69490CGCGGGGACGGAGGACGACGTCGTCCTCCGTCCCCGCG0.065100.007600.603400.750001.000001.00000


Target Position: 579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
579AGCUCCGGAGGAUGAGUGA75.2609152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
99597AGCTCCGGAGGATGAGTGATCACTCATCCTCCGGAGCT0.296200.001000.629300.500000.918500.62500