Input target sequence

Length: 822
GCGAGGGCGCGCCCCGGCTGGGCGTGGACACTGTTCTCCGGCCGCGTCGGGCCGGGCGGGTGGGGCGTTCCTGCGGGTTGGGCGGCTGGGCCCTCCGGGGTGTGGCCACCCCGCGCTCCGCCCTGCGCCCCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCACCAGCTCTCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAACCTGGAGCGCACCTTCATCGCCATCAAGCCGGACGGCGTGCAGCGCGGCCTGGTGGGCGAGATCATCAAGCGCTTCGAGCAGAAGGGATTCCGCCTCGTGGCCATGAAGTTCCTCCGGGCCTCTGAAGAACACCTGAAGCAGCACTACATTGACCTGAAAGACCGACCATTCTTCCCTGGGCTGGTGAAGTACATGAACTCAGGGCCGGTTGTGGCCATGGTCTGGGAGGGGCTGAACGTGGTGAAGACAGGCCGAGTGATGCTTGGGGAGACCAATCCAGCAGATTCAAAGCCAGGCACCATTCGTGGGGACTTCTGCATTCAGGTTGGCAGGAACATCATTCATGGCAGTGATTCAGTAAAAAGTGCTGAAAAAGAAATCAGCCTATGGTTTAAGCCTGAAGAACTGGTTGACTACAAGTCTTGTGCTCATGACTGGGTCTATGAATAAGAGGTGGACACAACAGCAGTCTCCTTCAGCACGGCGTGGTGTGTCCCTGGACACAGCTCTTCATTCCATTGACTTAGAGGCAACAGGATTGATCATTCTTTTATAGAGCATATTTGCCAATAAAGCTTTTGGAAGCCGG