siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Sidirect 789   792   799  
Biltr, Rnaxs 16   17   18   19   118   119   159   213   229   230   232   239   240   241   284   290   346   347   351   352  
353   360   361   362   363   364   365   366   367   370   373   374   375   376   384   385   393   411   412   413  
414   416   417   455   457   458   459   460   461   462   464   497   498   499   500   502   505   506   513   514  
518   519   527   550   551   553   554   555   556   557   558   560   564   565   566   568   569   575   576   577  
578   579   580   607   608   617   618   620   621   646   664   665   666   667   668   670   691   692   693   702  
727   728   729   736   737   738   739   741   742   748   760   761   762   763   765   766   767   768   776   777  
778   779   780   781  
Biltr, Rnaxs, Sidirect 581   609   622   740   769   770  
Biltr, Ernai 214  


Target Position: 551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
551CAUUCAGGUUGGCAGGAAC76.8707166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
117569CATTCAGGTTGGCAGGAACGTTCCTGCCAACCTGAATG0.021200.006000.508600.500001.000001.00000


Target Position: 412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
412GGCUGGUGAAGUACAUGAA96.91144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
94430GGCTGGTGAAGTACATGAATTCATGTACTTCACCAGCC0.134500.003200.827601.000001.000001.00000


Target Position: 608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
608AGAAAUCAGCCUAUGGUUU76.1225184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
117626AGAAATCAGCCTATGGTTTAAACCATAGGCTGATTTCT0.039100.001300.724100.750001.000001.00000


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766ACAGGAUUGAUCAUUCUUU80.2464113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
77784ACAGGATTGATCATTCTTTAAAGAATGATCAATCCTGT0.261200.005000.706900.750001.000001.00000


Target Position: 609, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
609GAAAUCAGCCUAUGGUUUA89.806923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
121627GAAATCAGCCTATGGTTTATAAACCATAGGCTGATTTC0.112400.001200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
607-629AAGAAATCAGCCTATGGTTTAAGUAAACCAUAGGCUGAUUUCUUGAAAUCAGCCUAUGGUUUAAGU18.812.012


Target Position: 565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
565GGAACAUCAUUCAUGGCAG82.97586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
120583GGAACATCATTCATGGCAGCTGCCATGAATGATGTTCC0.020000.006300.586200.750001.000001.00000


Target Position: 776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
776UCAUUCUUUUAUAGAGCAU72.9638239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
84794TCATTCTTTTATAGAGCATATGCTCTATAAAAGAATGA0.055400.043800.569000.750001.000001.00000


Target Position: 566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
566GAACAUCAUUCAUGGCAGU83.878775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
126584GAACATCATTCATGGCAGTACTGCCATGAATGATGTTC0.024400.006300.465500.500001.000001.00000


Target Position: 556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
556AGGUUGGCAGGAACAUCAU77.4881148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
69574AGGTTGGCAGGAACATCATATGATGTTCCTGCCAACCT0.122500.005700.689700.750001.000001.00000


Target Position: 239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
239GCGCACCUUCAUCGCCAUC60.1085467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
80257GCGCACCTTCATCGCCATCGATGGCGATGAAGGTGCGC0.042200.031500.741400.750000.929300.62500


Target Position: 461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
461GGGGCUGAACGUGGUGAAG66.7576345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
101479GGGGCTGAACGTGGTGAAGCTTCACCACGTTCAGCCCC0.035400.002900.853400.750001.000001.00000


Target Position: 579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
579GGCAGUGAUUCAGUAAAAA94.570811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
112597GGCAGTGATTCAGTAAAAATTTTTACTGAATCACTGCC0.080600.001901.000001.000001.000001.00000


Target Position: 351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
351GCCUCUGAAGAACACCUGA84.963965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
66369GCCTCTGAAGAACACCTGATCAGGTGTTCTTCAGAGGC0.159400.036200.775900.750001.000001.00000


Target Position: 578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
578UGGCAGUGAUUCAGUAAAA87.822938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
99596TGGCAGTGATTCAGTAAAATTTTACTGAATCACTGCCA0.106200.002900.844800.750001.000001.00000


Target Position: 727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
727UCCCUGGACACAGCUCUUC47.5004659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
122745TCCCTGGACACAGCTCTTCGAAGAGCTGTGTCCAGGGA0.023900.001100.698300.500000.945700.87500


Target Position: 518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
518UUCAAAGCCAGGCACCAUU60.489460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
102536TTCAAAGCCAGGCACCATTAATGGTGCCTGGCTTTGAA0.058500.014800.663800.500001.000001.00000


Target Position: 691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
691ACACAACAGCAGUCUCCUU81.5511101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
96709ACACAACAGCAGTCTCCTTAAGGAGACTGCTGTTGTGT0.033600.003500.569000.750001.000001.00000


Target Position: 558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
558GUUGGCAGGAACAUCAUUC67.7764325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
121576GTTGGCAGGAACATCATTCGAATGATGTTCCTGCCAAC0.078800.004700.474100.500001.000001.00000


Target Position: 765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
765AACAGGAUUGAUCAUUCUU77.4262151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
102783AACAGGATTGATCATTCTTAAGAATGATCAATCCTGTT0.309000.006200.508600.500001.000001.00000


Target Position: 366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
366CUGAAGCAGCACUACAUUG73.6278224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
93384CTGAAGCAGCACTACATTGCAATGTAGTGCTGCTTCAG0.317000.078600.637900.500001.000001.00000


Target Position: 555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
555CAGGUUGGCAGGAACAUCA87.348241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
98573CAGGTTGGCAGGAACATCATGATGTTCCTGCCAACCTG0.098600.005400.560300.500001.000001.00000


Target Position: 569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
569CAUCAUUCAUGGCAGUGAU90.151119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
123587CATCATTCATGGCAGTGATATCACTGCCATGAATGATG0.016400.003000.474100.750001.000001.00000


Target Position: 568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
568ACAUCAUUCAUGGCAGUGA78.696133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
116586ACATCATTCATGGCAGTGATCACTGCCATGAATGATGT0.036900.007000.482800.500001.000001.00000


Target Position: 760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
760GAGGCAACAGGAUUGAUCA95.26088

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
103778GAGGCAACAGGATTGATCATGATCAATCCTGTTGCCTC0.029100.009700.586200.500001.000001.00000


Target Position: 580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
580GCAGUGAUUCAGUAAAAAG82.915390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
98598GCAGTGATTCAGTAAAAAGCTTTTTACTGAATCACTGC0.063300.002900.715500.750001.000001.00000


Target Position: 557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
557GGUUGGCAGGAACAUCAUU85.059163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
82575GGTTGGCAGGAACATCATTAATGATGTTCCTGCCAACC0.098100.004700.844801.000001.000001.00000


Target Position: 502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
502AGACCAAUCCAGCAGAUUC74.7652204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
105520AGACCAATCCAGCAGATTCGAATCTGCTGGATTGGTCT0.150600.012400.551700.500000.929300.62500


Target Position: 777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777CAUUCUUUUAUAGAGCAUA90.022820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
72795CATTCTTTTATAGAGCATATATGCTCTATAAAAGAATG0.050500.038300.612100.750001.000001.00000


Target Position: 229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
229CCAACCUGGAGCGCACCUU64.6692386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
127247CCAACCTGGAGCGCACCTTAAGGTGCGCTCCAGGTTGG0.204300.001100.706901.000000.945700.75000


Target Position: 692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
692CACAACAGCAGUCUCCUUC66.1222361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
101710CACAACAGCAGTCTCCTTCGAAGGAGACTGCTGTTGTG0.043800.004800.620700.500001.000001.00000


Target Position: 364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
364ACCUGAAGCAGCACUACAU82.941189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
46382ACCTGAAGCAGCACTACATATGTAGTGCTGCTTCAGGT0.212000.052800.698300.750000.989100.75000


Target Position: 620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
620AUGGUUUAAGCCUGAAGAA79.9671116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
115638ATGGTTTAAGCCTGAAGAATTCTTCAGGCTTAAACCAT0.026600.007800.482800.500000.972800.75000


Target Position: 464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
464GCUGAACGUGGUGAAGACA86.090153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97482GCTGAACGTGGTGAAGACATGTCTTCACCACGTTCAGC0.032700.004700.646600.750001.000001.00000


Target Position: 497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
497UGGGGAGACCAAUCCAGCA78.3964136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
115515TGGGGAGACCAATCCAGCATGCTGGATTGGTCTCCCCA0.023500.007800.491400.500000.923900.87500


Target Position: 607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
607AAGAAAUCAGCCUAUGGUU78.079138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
118625AAGAAATCAGCCTATGGTTAACCATAGGCTGATTTCTT0.021000.001600.491400.500001.000001.00000


Target Position: 413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
413GCUGGUGAAGUACAUGAAC72.74242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
96431GCTGGTGAAGTACATGAACGTTCATGTACTTCACCAGC0.047500.003000.706900.750001.000001.00000


Target Position: 736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736ACAGCUCUUCAUUCCAUUG68.6506308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
120754ACAGCTCTTCATTCCATTGCAATGGAATGAAGAGCTGT0.043900.001200.560300.500001.000001.00000


Target Position: 460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
460AGGGGCUGAACGUGGUGAA78.0624139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
100478AGGGGCTGAACGTGGTGAATTCACCACGTTCAGCCCCT0.093900.002900.672400.750001.000001.00000


Target Position: 385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
385ACCUGAAAGACCGACCAUU71.649259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
60403ACCTGAAAGACCGACCATTAATGGTCGGTCTTTCAGGT0.282200.060200.844800.750001.000001.00000


Target Position: 621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
621UGGUUUAAGCCUGAAGAAC58.6495495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
120639TGGTTTAAGCCTGAAGAACGTTCTTCAGGCTTAAACCA0.337600.006300.698300.500000.972800.75000


Target Position: 459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
459GAGGGGCUGAACGUGGUGA76.9387164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
118477GAGGGGCTGAACGTGGTGATCACCACGTTCAGCCCCTC0.035100.004500.586200.500001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781CUUUUAUAGAGCAUAUUUG75.0006202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
113799CTTTTATAGAGCATATTTGCAAATATGCTCTATAAAAG0.060500.013800.491400.500001.000001.00000


Target Position: 799, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
799GCCAAUAAAGCUUUUGGAA84.904867

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
797-819TTGCCAATAAAGCTTTTGGAAGCUUCCAAAAGCUUUAUUGGCAAGCCAAUAAAGCUUUUGGAAGCU20.112.822


Target Position: 346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
346UCCGGGCCUCUGAAGAACA70.1912283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
116364TCCGGGCCTCTGAAGAACATGTTCTTCAGAGGCCCGGA0.248500.001600.663800.500001.000001.00000


Target Position: 411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
411GGGCUGGUGAAGUACAUGA88.883826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
116429GGGCTGGTGAAGTACATGATCATGTACTTCACCAGCCC0.131600.001400.767200.750001.000001.00000


Target Position: 740, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
740CUCUUCAUUCCAUUGACUU76.1982182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
73758CTCTTCATTCCATTGACTTAAGTCAATGGAATGAAGAG0.049100.009200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
738-760AGCTCTTCATTCCATTGACTTAGAAGUCAAUGGAAUGAAGAGCUCUCUUCAUUCCAUUGACUUAGU19.220.422


Target Position: 770, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
770GAUUGAUCAUUCUUUUAUA106.6561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
62788GATTGATCATTCTTTTATATATAAAAGAATGATCAATC0.182800.006500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
768-790AGGATTGATCATTCTTTTATAGAUAUAAAAGAAUGAUCAAUCCUGAUUGAUCAUUCUUUUAUAGAU-4.316.213


Target Position: 554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
554UCAGGUUGGCAGGAACAUC59.4675480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
117572TCAGGTTGGCAGGAACATCGATGTTCCTGCCAACCTGA0.091700.005200.543100.500001.000001.00000


Target Position: 284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
284GGUGGGCGAGAUCAUCAAG76.7066171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
105302GGTGGGCGAGATCATCAAGCTTGATGATCTCGCCCACC0.237400.002400.715500.750001.000001.00000


Target Position: 462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
462GGGCUGAACGUGGUGAAGA82.162695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97480GGGCTGAACGTGGTGAAGATCTTCACCACGTTCAGCCC0.044800.002900.767200.750001.000001.00000


Target Position: 527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
527AGGCACCAUUCGUGGGGAC58.6244496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
129545AGGCACCATTCGTGGGGACGTCCCCACGAATGGTGCCT0.012000.001000.525900.500000.907600.87500


Target Position: 553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
553UUCAGGUUGGCAGGAACAU57.5285506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
100571TTCAGGTTGGCAGGAACATATGTTCCTGCCAACCTGAA0.095300.005100.517200.500001.000001.00000


Target Position: 767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767CAGGAUUGAUCAUUCUUUU88.50131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
76785CAGGATTGATCATTCTTTTAAAAGAATGATCAATCCTG0.241100.005100.784500.750001.000001.00000


Target Position: 769, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769GGAUUGAUCAUUCUUUUAU88.571630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
57787GGATTGATCATTCTTTTATATAAAAGAATGATCAATCC0.207400.006600.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
767-789CAGGATTGATCATTCTTTTATAGAUAAAAGAAUGAUCAAUCCUGGGAUUGAUCAUUCUUUUAUAGU7.116.212


Target Position: 646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
646ACUACAAGUCUUGUGCUCA82.851791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
127664ACTACAAGTCTTGTGCTCATGAGCACAAGACTTGTAGT0.041600.003500.482800.500001.000001.00000


Target Position: 739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
739GCUCUUCAUUCCAUUGACU83.41280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
101757GCTCTTCATTCCATTGACTAGTCAATGGAATGAAGAGC0.030200.007300.646600.750001.000001.00000


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737CAGCUCUUCAUUCCAUUGA76.7931168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
122755CAGCTCTTCATTCCATTGATCAATGGAATGAAGAGCTG0.037700.005600.560300.500001.000001.00000


Target Position: 455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
455CUGGGAGGGGCUGAACGUG59.3014485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
121473CTGGGAGGGGCTGAACGTGCACGTTCAGCCCCTCCCAG0.018600.004400.491400.500001.000001.00000


Target Position: 667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667ACUGGGUCUAUGAAUAAGA81.0791105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125685ACTGGGTCTATGAATAAGATCTTATTCATAGACCCAGT0.327000.006200.482800.500001.000001.00000


Target Position: 664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
664AUGACUGGGUCUAUGAAUA86.512547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
83682ATGACTGGGTCTATGAATATATTCATAGACCCAGTCAT0.260500.006900.612100.500000.962000.75000


Target Position: 290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
290CGAGAUCAUCAAGCGCUUC68.6154309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
124308CGAGATCATCAAGCGCTTCGAAGCGCTTGATGATCTCG0.015500.014000.620700.750001.000001.00000


Target Position: 417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
417GUGAAGUACAUGAACUCAG74.5425207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
126435GTGAAGTACATGAACTCAGCTGAGTTCATGTACTTCAC0.013700.005800.508600.500000.940200.62500


Target Position: 780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
780UCUUUUAUAGAGCAUAUUU76.5496175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
71798TCTTTTATAGAGCATATTTAAATATGCTCTATAAAAGA0.053600.020000.724100.750001.000001.00000


Target Position: 668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
668CUGGGUCUAUGAAUAAGAG78.7087132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
124686CTGGGTCTATGAATAAGAGCTCTTATTCATAGACCCAG0.321900.007200.474100.500001.000001.00000


Target Position: 665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
665UGACUGGGUCUAUGAAUAA88.63828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
44683TGACTGGGTCTATGAATAATTATTCATAGACCCAGTCA0.313800.012300.689700.750000.962000.62500


Target Position: 376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
376ACUACAUUGACCUGAAAGA80.5506111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
118394ACTACATTGACCTGAAAGATCTTTCAGGTCAATGTAGT0.183300.132800.482800.500001.000001.00000


Target Position: 457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
457GGGAGGGGCUGAACGUGGU73.6787221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
90475GGGAGGGGCTGAACGTGGTACCACGTTCAGCCCCTCCC0.036000.004500.637900.750001.000001.00000


Target Position: 748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
748UCCAUUGACUUAGAGGCAA71.6311260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
119766TCCATTGACTTAGAGGCAATTGCCTCTAAGTCAATGGA0.020600.015700.724100.750000.994600.62500


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768AGGAUUGAUCAUUCUUUUA88.157536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
72786AGGATTGATCATTCTTTTATAAAAGAATGATCAATCCT0.227700.005300.810300.750001.000001.00000


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778AUUCUUUUAUAGAGCAUAU82.087197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
129796ATTCTTTTATAGAGCATATATATGCTCTATAAAAGAAT0.044800.032400.465500.500001.000001.00000


Target Position: 374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
374GCACUACAUUGACCUGAAA96.25145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
18392GCACTACATTGACCTGAAATTTCAGGTCAATGTAGTGC0.245400.140100.853401.000001.000001.00000


Target Position: 365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
365CCUGAAGCAGCACUACAUU81.982798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
10383CCTGAAGCAGCACTACATTAATGTAGTGCTGCTTCAGG0.341400.055100.836201.000000.989100.62500


Target Position: 499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
499GGGAGACCAAUCCAGCAGA84.940466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
105517GGGAGACCAATCCAGCAGATCTGCTGGATTGGTCTCCC0.028500.012200.767200.750000.923900.62500


Target Position: 789, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
789GAGCAUAUUUGCCAAUAAA100.4272

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
787-809TAGAGCATATTTGCCAATAAAGCUUUAUUGGCAAAUAUGCUCUAGAGCAUAUUUGCCAAUAAAGCU12.819.723


Target Position: 741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
741UCUUCAUUCCAUUGACUUA86.208752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88759TCTTCATTCCATTGACTTATAAGTCAATGGAATGAAGA0.037000.007300.689700.750001.000001.00000


Target Position: 362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
362ACACCUGAAGCAGCACUAC63.5373404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
99380ACACCTGAAGCAGCACTACGTAGTGCTGCTTCAGGTGT0.131600.050700.525900.500000.978300.75000


Target Position: 384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
384GACCUGAAAGACCGACCAU83.356382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
56402GACCTGAAAGACCGACCATATGGTCGGTCTTTCAGGTC0.601100.062300.663800.750001.000001.00000


Target Position: 702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
702GUCUCCUUCAGCACGGCGU63.4192407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
129720GTCTCCTTCAGCACGGCGTACGCCGTGCTGAAGGAGAC0.086500.017500.543100.500000.923900.87500


Target Position: 763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
763GCAACAGGAUUGAUCAUUC81.1783104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
114781GCAACAGGATTGATCATTCGAATGATCAATCCTGTTGC0.023600.014000.681000.750001.000001.00000


Target Position: 577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
577AUGGCAGUGAUUCAGUAAA79.9352117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
102595ATGGCAGTGATTCAGTAAATTTACTGAATCACTGCCAT0.102200.002800.655200.500001.000001.00000


Target Position: 241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
241GCACCUUCAUCGCCAUCAA93.142715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
83259GCACCTTCATCGCCATCAATTGATGGCGATGAAGGTGC0.039400.030500.706901.000001.000001.00000


Target Position: 513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
513GCAGAUUCAAAGCCAGGCA81.199103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
109531GCAGATTCAAAGCCAGGCATGCCTGGCTTTGAATCTGC0.030000.001900.500000.750001.000001.00000


Target Position: 16, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
16GGCUGGGCGUGGACACUGU80.7551108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
11434GGCTGGGCGTGGACACTGTACAGTGTCCACGCCCAGCC0.024800.001600.793100.750000.978300.87500


Target Position: 581, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
581CAGUGAUUCAGUAAAAAGU84.318871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
104599CAGTGATTCAGTAAAAAGTACTTTTTACTGAATCACTG0.054300.002700.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
579-601GGCAGTGATTCAGTAAAAAGTGCACUUUUUACUGAAUCACUGCCCAGUGAUUCAGUAAAAAGUGCU-3.819.203


Target Position: 575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
575UCAUGGCAGUGAUUCAGUA89.018825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
110593TCATGGCAGTGATTCAGTATACTGAATCACTGCCATGA0.027200.001900.543100.750001.000001.00000


Target Position: 762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
762GGCAACAGGAUUGAUCAUU74.2204213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
108780GGCAACAGGATTGATCATTAATGATCAATCCTGTTGCC0.027100.016600.991401.000001.000001.00000


Target Position: 550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
550GCAUUCAGGUUGGCAGGAA84.683369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
128568GCATTCAGGTTGGCAGGAATTCCTGCCAACCTGAATGC0.013400.006100.681001.000001.000001.00000


Target Position: 506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
506CAAUCCAGCAGAUUCAAAG76.3254179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
107524CAATCCAGCAGATTCAAAGCTTTGAATCTGCTGGATTG0.114400.008800.508600.500000.929300.62500


Target Position: 729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
729CCUGGACACAGCUCUUCAU85.371358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
129747CCTGGACACAGCTCTTCATATGAAGAGCTGTGTCCAGG0.042200.001000.689701.000000.945700.62500


Target Position: 693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
693ACAACAGCAGUCUCCUUCA84.185472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
117711ACAACAGCAGTCTCCTTCATGAAGGAGACTGCTGTTGT0.094900.006600.482800.500001.000001.00000


Target Position: 670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
670GGGUCUAUGAAUAAGAGGU82.799192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
64688GGGTCTATGAATAAGAGGTACCTCTTATTCATAGACCC0.098700.012800.637900.750001.000001.00000


Target Position: 514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
514CAGAUUCAAAGCCAGGCAC64.8781378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
124532CAGATTCAAAGCCAGGCACGTGCCTGGCTTTGAATCTG0.022400.001100.491400.500001.000001.00000


Target Position: 393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
393GACCGACCAUUCUUCCCUG77.2123156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
122411GACCGACCATTCTTCCCTGCAGGGAAGAATGGTCGGTC0.017800.005200.534500.500001.000001.00000


Target Position: 360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
360GAACACCUGAAGCAGCACU76.7602169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
128378GAACACCTGAAGCAGCACTAGTGCTGCTTCAGGTGTTC0.106200.037100.465500.500000.978300.87500


Target Position: 416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
416GGUGAAGUACAUGAACUCA95.166310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125434GGTGAAGTACATGAACTCATGAGTTCATGTACTTCACC0.015000.007100.629300.750000.940200.62500


Target Position: 622, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
622GGUUUAAGCCUGAAGAACU88.273935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
62640GGTTTAAGCCTGAAGAACTAGTTCTTCAGGCTTAAACC0.327600.006300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
620-642ATGGTTTAAGCCTGAAGAACTGGAGUUCUUCAGGCUUAAACCAUGGUUUAAGCCUGAAGAACUGGU21.54.913


Target Position: 728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
728CCCUGGACACAGCUCUUCA88.365833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
123746CCCTGGACACAGCTCTTCATGAAGAGCTGTGTCCAGGG0.028100.001100.767200.750000.945700.75000


Target Position: 363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
363CACCUGAAGCAGCACUACA90.617918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
78381CACCTGAAGCAGCACTACATGTAGTGCTGCTTCAGGTG0.145300.051000.586200.500000.978300.62500


Target Position: 118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
118CCGCCCUGCGCCCCUCCUC46.7129669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
126136CCGCCCTGCGCCCCTCCTCGAGGAGGGGCGCAGGGCGG0.256900.001100.603400.750000.902200.62500


Target Position: 17, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
17GCUGGGCGUGGACACUGUU79.1246129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
10835GCTGGGCGTGGACACTGTTAACAGTGTCCACGCCCAGC0.038500.002100.706901.000000.978301.00000


Target Position: 19, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
19UGGGCGUGGACACUGUUCU64.2054391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
12137TGGGCGTGGACACTGTTCTAGAACAGTGTCCACGCCCA0.071400.003700.620700.500000.978300.87500


Target Position: 458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
458GGAGGGGCUGAACGUGGUG66.6113353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
92476GGAGGGGCTGAACGTGGTGCACCACGTTCAGCCCCTCC0.035500.004500.577600.750001.000001.00000


Target Position: 505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
505CCAAUCCAGCAGAUUCAAA87.649839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
26523CCAATCCAGCAGATTCAAATTTGAATCTGCTGGATTGG0.239300.019900.844801.000000.929300.75000


Target Position: 761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
761AGGCAACAGGAUUGAUCAU80.9477107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
59779AGGCAACAGGATTGATCATATGATCAATCCTGTTGCCT0.080700.009800.689700.750001.000001.00000


Target Position: 617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
617CCUAUGGUUUAAGCCUGAA83.588179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
48635CCTATGGTTTAAGCCTGAATTCAGGCTTAAACCATAGG0.163400.007300.672401.000000.972801.00000


Target Position: 375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
375CACUACAUUGACCUGAAAG74.2187214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
128393CACTACATTGACCTGAAAGCTTTCAGGTCAATGTAGTG0.239000.148500.655200.500001.000001.00000


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779UUCUUUUAUAGAGCAUAUU63.6133402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
99797TTCTTTTATAGAGCATATTAATATGCTCTATAAAAGAA0.035700.025800.663800.500001.000001.00000


Target Position: 159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
159UGGUCGCACCAGCUCUCUG65.5795366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
127177TGGTCGCACCAGCTCTCTGCAGAGAGCTGGTGCGACCA0.013500.002800.560300.500000.929301.00000


Target Position: 792, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792CAUAUUUGCCAAUAAAGCU79.3942125

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
790-812AGCATATTTGCCAATAAAGCTTTAGCUUUAUUGGCAAAUAUGCUCAUAUUUGCCAAUAAAGCUUUU13.6-1.822


Target Position: 213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
213GCUUCCCGGACCAUGGCCA71.1104265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
119231GCTTCCCGGACCATGGCCATGGCCATGGTCCGGGAAGC0.055700.001200.508600.750000.972800.87500


Target Position: 119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
119CGCCCUGCGCCCCUCCUCC51.1076604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125137CGCCCTGCGCCCCTCCTCCGGAGGAGGGGCGCAGGGCG0.247100.001100.551700.500000.907600.75000


Target Position: 738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
738AGCUCUUCAUUCCAUUGAC71.7178258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
96756AGCTCTTCATTCCATTGACGTCAATGGAATGAAGAGCT0.033700.008000.534500.500001.000001.00000


Target Position: 352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
352CCUCUGAAGAACACCUGAA89.918221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
50370CCTCTGAAGAACACCTGAATTCAGGTGTTCTTCAGAGG0.157400.036600.672401.000001.000001.00000


Target Position: 564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
564AGGAACAUCAUUCAUGGCA74.7381205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
110582AGGAACATCATTCATGGCATGCCATGAATGATGTTCCT0.112700.004200.491400.500001.000001.00000


Target Position: 498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
498GGGGAGACCAAUCCAGCAG67.8093324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
109516GGGGAGACCAATCCAGCAGCTGCTGGATTGGTCTCCCC0.026600.010900.706900.750000.923900.75000


Target Position: 18, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
18CUGGGCGUGGACACUGUUC59.99468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
10636CTGGGCGTGGACACTGTTCGAACAGTGTCCACGCCCAG0.086300.004500.612100.500000.978301.00000


Target Position: 353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
353CUCUGAAGAACACCUGAAG71.3662262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
103371CTCTGAAGAACACCTGAAGCTTCAGGTGTTCTTCAGAG0.230900.055600.672400.500001.000001.00000


Target Position: 560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
560UGGCAGGAACAUCAUUCAU75.3234199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
63578TGGCAGGAACATCATTCATATGAATGATGTTCCTGCCA0.071000.006500.689700.750001.000001.00000


Target Position: 361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
361AACACCUGAAGCAGCACUA79.6897120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
123379AACACCTGAAGCAGCACTATAGTGCTGCTTCAGGTGTT0.123500.052900.474100.500000.978300.87500


Target Position: 347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
347CCGGGCCUCUGAAGAACAC63.7631400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
107365CCGGGCCTCTGAAGAACACGTGTTCTTCAGAGGCCCGG0.184000.002300.620700.750001.000001.00000


Target Position: 414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
414CUGGUGAAGUACAUGAACU82.942588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
99432CTGGTGAAGTACATGAACTAGTTCATGTACTTCACCAG0.031400.003600.577600.500001.000001.00000


Target Position: 500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
500GGAGACCAAUCCAGCAGAU86.695845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
100518GGAGACCAATCCAGCAGATATCTGCTGGATTGGTCTCC0.030400.012600.689701.000000.967400.62500


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742CUUCAUUCCAUUGACUUAG64.1157392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
127760CTTCATTCCATTGACTTAGCTAAGTCAATGGAATGAAG0.028700.004800.465500.500001.000001.00000


Target Position: 214, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
214CUUCCCGGACCAUGGCCAA73.3405233

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_121419CTTCCCGGACCATGGCCAA1/1/0/070.23NME2NM_002512.2+NM_001018139.1+NM_001018138.1+NM_001018137.11+0+0+0NANANANA00NME2(0.002)


Target Position: 370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
370AGCAGCACUACAUUGACCU70.656272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
123388AGCAGCACTACATTGACCTAGGTCAATGTAGTGCTGCT0.292300.091800.508600.500001.000001.00000


Target Position: 373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
373AGCACUACAUUGACCUGAA92.860516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
47391AGCACTACATTGACCTGAATTCAGGTCAATGTAGTGCT0.239200.142900.681000.750001.000001.00000


Target Position: 576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
576CAUGGCAGUGAUUCAGUAA94.550712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
106594CATGGCAGTGATTCAGTAATTACTGAATCACTGCCATG0.056900.002300.620700.750001.000001.00000


Target Position: 618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
618CUAUGGUUUAAGCCUGAAG69.4681294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
98636CTATGGTTTAAGCCTGAAGCTTCAGGCTTAAACCATAG0.032200.007100.534500.500000.972801.00000


Target Position: 240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
240CGCACCUUCAUCGCCAUCA73.8218220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86258CGCACCTTCATCGCCATCATGATGGCGATGAAGGTGCG0.038200.034400.698300.750000.962000.62500


Target Position: 519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
519UCAAAGCCAGGCACCAUUC54.8143545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
89537TCAAAGCCAGGCACCATTCGAATGGTGCCTGGCTTTGA0.043000.011900.551700.500001.000001.00000


Target Position: 232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
232ACCUGGAGCGCACCUUCAU71.5116261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
111250ACCTGGAGCGCACCTTCATATGAAGGTGCGCTCCAGGT0.493000.001900.698300.750000.945701.00000


Target Position: 230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
230CAACCUGGAGCGCACCUUC69.3293297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125248CAACCTGGAGCGCACCTTCGAAGGTGCGCTCCAGGTTG0.242800.001300.474100.500000.945700.87500


Target Position: 367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
367UGAAGCAGCACUACAUUGA76.6543173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
107385TGAAGCAGCACTACATTGATCAATGTAGTGCTGCTTCA0.335400.080900.500000.500001.000001.00000


Target Position: 666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666GACUGGGUCUAUGAAUAAG80.6412110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
115684GACTGGGTCTATGAATAAGCTTATTCATAGACCCAGTC0.090100.004100.681000.500001.000001.00000