siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Sidirect 296   623   646   842   1324   1475   2099   2129   2148  
Biltr, Ernai 292   683  
Biltr, Rnaxs 39   155   156   244   245   246   247   338   340   342   381   382   383   394   395   406   422   423   424   473  
482   484   485   503   535   539   550   551   552   553   554   555   556   557   558   563   565   577   581   582  
583   584   589   590   591   592   593   595   607   608   609   610   611   612   616   617   618   619   620   621  
629   630   642   643   644   645   654   655   661   662   663   665   685   686   687   688   689   690   691   692  
711   712   713   714   735   736   737   738   759   760   761   762   765   766   767   768   769   770   790   791  
792   793   797   798   799   814   818   829   835   836   837   839   844   850   851   856   857   858   859   877  
878   879   880   881   883   884   885   899   900   901   902   907   908   918   921   922   923   924   925   926  
935   936   947   948   949   956   957   961   962   963   964   975   976   982   983   984   987   988   989   991  
993   1002   1003   1005   1015   1024   1057   1066   1067   1068   1070   1071   1108   1109   1110   1111   1112   1117   1118   1119  
1120   1121   1133   1134   1142   1188   1189   1190   1203   1240   1241   1242   1294   1295   1296   1297   1298   1304   1312   1349  
1350   1351   1352   1353   1354   1355   1356   1392   1393   1394   1395   1396   1397   1398   1399   1400   1402   1403   1404   1450  
1453   1458   1459   1464   1477   1479   1480   1481   1483   1486   1487   1489   1610   1611   1612   1639   1640   1642   1643   1646  
1648   1654   1658   1659   1660   1663   1696   1701   1702   1703   1723   1730   1733   1792   1793   1794   1801   1839   1846   1850  
1857   1858   1884   1888   1889   1891   1892   1893   1895   1896   1897   1933   1934   1944   2007   2008   2009   2010   2011   2012  
2013   2014   2016   2017   2018   2022   2023   2047   2048   2058   2059   2061   2062   2065   2066   2067   2068   2069   2070   2071  
2072   2073   2074   2075   2076   2079   2080   2081   2082   2083   2084   2085   2087   2088   2089   2090   2091   2100   2101   2109  
2113   2114   2123   2124   2125   2126   2127   2128   2137   2158   2159   2161   2163   2164   2165   2166   2167   2168   2170   2171  
2172   2173   2174   2175   2176   2177   2178   2179   2180   2181   2182   2183   2184   2185   2186  
Biltr, Ernai, Rnaxs, Sidirect 838   951  
Biltr, Ernai, Rnaxs 937   1069   1478   1488   1848   1849  
Biltr, Rnaxs, Sidirect 341   596   845   938   950   2015   2019   2086   2138   2157   2160   2162   2169  


Target Position: 976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
976GCUAUAUCCCUGCCCGUCU73.6508620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197994GCTATATCCCTGCCCGTCTAGACGGGCAGGGATATAGC0.174000.087300.629300.750001.000001.00000


Target Position: 2083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2083CACCAUAUGAAUUGUACAG75.4019524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2932101CACCATATGAATTGTACAGCTGTACAATTCATATGGTG0.117700.091900.508600.500001.000001.00000


Target Position: 582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
582CUCAAGCUGGGCAACCUUU71.4431737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
324600CTCAAGCTGGGCAACCTTTAAAGGTTGCCCAGCTTGAG0.199500.002600.810300.750000.940200.62500


Target Position: 1646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1646GAUCAACUUCUUCCAGGAU86.0761120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3281664GATCAACTTCTTCCAGGATATCCTGGAAGAAGTTGATC0.097100.073300.500000.750001.000001.00000


Target Position: 1108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1108CUGAGCGUCCCCGGGAAAA68.4047922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2071126CTGAGCGTCCCCGGGAAAATTTTCCCGGGGACGCTCAG0.120700.026700.784500.750000.907600.75000


Target Position: 1190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1190GCAGCUGCACAGUGUCAAU90.260361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2851208GCAGCTGCACAGTGTCAATATTGACACTGTGCAGCTGC0.042700.004400.844801.000001.000001.00000


Target Position: 1242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1242CAAGAGGAGGCUGAGGAUC62.80311260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3741260CAAGAGGAGGCTGAGGATCGATCCTCAGCCTCCTCTTG0.113700.010000.465500.500001.000001.00000


Target Position: 1658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1658CCAGGAUCACACCAAGCUC73.0599648

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2711676CCAGGATCACACCAAGCTCGAGCTTGGTGTGATCCTGG0.179400.011300.534500.750000.962000.87500


Target Position: 654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
654GUCGAAUAUGACGGGGAGA74.911545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
286672GTCGAATATGACGGGGAGATCTCCCCGTCATATTCGAC0.136600.063500.594800.500000.945700.62500


Target Position: 2185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2185AAAAAAAAAAAAAAAAAAA83.5835192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3172203AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.999300.500000.500001.000001.00000


Target Position: 987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
987GCCCGUCUCCCCAUCACCU72.8396661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1541005GCCCGTCTCCCCATCACCTAGGTGATGGGGAGACGGGC0.403900.193000.655200.750001.000001.00000


Target Position: 1850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1850UCUCAAGGCCUCCUAAUAG66.211045

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2641868TCTCAAGGCCTCCTAATAGCTATTAGGAGGCCTTGAGA0.271300.019200.551700.500000.934800.62500


Target Position: 592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
592GCAACCUUUUCCUGAAUGA83.7895170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
289610GCAACCTTTTCCTGAATGATCATTCAGGAAAAGGTTGC0.040600.005000.629300.750001.000001.00000


Target Position: 2061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2061UUGUCCCCCUCCCCCUCAA62.17521307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3022079TTGTCCCCCTCCCCCTCAATTGAGGGGGAGGGGGACAA0.435900.230400.500000.500001.000001.00000


Target Position: 2007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2007GGGGGUUGCUGUGUAAGUU83.7877171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3632025GGGGGTTGCTGTGTAAGTTAACTTACACAGCAACCCCC0.024500.001300.844801.000001.000001.00000


Target Position: 1846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1846ACCGUCUCAAGGCCUCCUA68.5648911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2411864ACCGTCTCAAGGCCTCCTATAGGAGGCCTTGAGACGGT0.080100.047600.681000.750000.940200.62500


Target Position: 2138, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2138GCUUUAUGCACAUUAAACA91.404349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3232156GCTTTATGCACATTAAACATGTTTAATGTGCATAAAGC0.029400.002700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2136-2158TGGCTTTATGCACATTAAACAGAUGUUUAAUGUGCAUAAAGCCAGCUUUAUGCACAUUAAACAGAU-0.33.522


Target Position: 877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
877ACCCCGUGGCCGCCUCCCU51.98461818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
288895ACCCCGTGGCCGCCTCCCTAGGGAGGCGGCCACGGGGT0.425200.035800.508600.500000.918500.62500


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590GGGCAACCUUUUCCUGAAU80.9106277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
264608GGGCAACCTTTTCCTGAATATTCAGGAAAAGGTTGCCC0.056900.010300.982801.000001.000001.00000


Target Position: 2014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2014GCUGUGUAAGUUAUUUUUG71.4567736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2292032GCTGTGTAAGTTATTTTTGCAAAAATAACTTACACAGC0.354300.009600.706900.750001.000001.00000


Target Position: 769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769GUAUCAUGUAUACCUUGUU85.5586128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
347787GTATCATGTATACCTTGTTAACAAGGTATACATGATAC0.021500.007800.534500.750001.000001.00000


Target Position: 983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
983CCCUGCCCGUCUCCCCAUC52.28621805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1271001CCCTGCCCGTCTCCCCATCGATGGGGAGACGGGCAGGG0.653000.128000.810300.750001.000001.00000


Target Position: 1477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1477AGAUCACCCUCCUUAAAUA98.82843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1141495AGATCACCCTCCTTAAATATATTTAAGGAGGGTGATCT0.611800.213300.681000.750000.994600.62500


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766GGUGUAUCAUGUAUACCUU95.847714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364784GGTGTATCATGTATACCTTAAGGTATACATGATACACC0.016800.002200.715501.000000.956500.75000


Target Position: 1858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1858CCUCCUAAUAGCUGCCCUC66.8951013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2761876CCTCCTAATAGCTGCCCTCGAGGGCAGCTATTAGGAGG0.074200.064500.534500.750001.000001.00000


Target Position: 738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
738AGUUUCGAGGUGGAUGUGU63.28361236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
346756AGTTTCGAGGTGGATGTGTACACATCCACCTCGAAACT0.021800.008600.500000.500001.000001.00000


Target Position: 1142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1142UCGAGAGACAGGUGAGGUG63.04641250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3221160TCGAGAGACAGGTGAGGTGCACCTCACCTGTCTCTCGA0.038600.015000.500000.500001.000001.00000


Target Position: 556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
556ACCGAAACCGAGUUAUUCA82.5917214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
297574ACCGAAACCGAGTTATTCATGAATAACTCGGTTTCGGT0.455600.009300.629300.500000.994600.62500


Target Position: 341, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
341GAAGAUGUCCAUGGAAAUA91.985638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
347359GAAGATGTCCATGGAAATATATTTCCATGGACATCTTC0.033100.001800.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
339-361GAGAAGATGTCCATGGAAATATCUAUUUCCAUGGACAUCUUCUCGAAGAUGUCCAUGGAAAUAUCU20.119.222


Target Position: 936, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
936ACCAUUAACGAGCUGCUUA80.898281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
288954ACCATTAACGAGCTGCTTATAAGCAGCTCGTTAATGGT0.041200.015900.819000.750001.000001.00000


Target Position: 2168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2168UCAAAAAAAAAAAAAAAAA74.8393551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2082186TCAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTGA0.998900.437600.724100.750001.000001.00000


Target Position: 2081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2081CCCACCAUAUGAAUUGUAC70.818772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1902099CCCACCATATGAATTGTACGTACAATTCATATGGTGGG0.142700.132600.810300.750001.000001.00000


Target Position: 902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
902GAAGAUGCUUCAGACAGAU89.058970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
346920GAAGATGCTTCAGACAGATATCTGTCTGAAGCATCTTC0.125000.006000.491400.750001.000001.00000


Target Position: 2109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2109CUAUUGAAUUCGGAACUGU77.3025436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3702127CTATTGAATTCGGAACTGTACAGTTCCGAATTCAATAG0.025600.001900.465500.500001.000001.00000


Target Position: 690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
690GGGACUCCUAAUUACAUAG79.7824335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
225708GGGACTCCTAATTACATAGCTATGTAATTAGGAGTCCC0.190100.010000.819000.750000.972800.62500


Target Position: 2071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2071CCCCCUCAACCCCACCAUA79.2939358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
392089CCCCCTCAACCCCACCATATATGGTGGGGTTGAGGGGG0.721400.510800.948301.000001.000001.00000


Target Position: 1730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1730CCGCACAUACCGCCUGAGU66.65891024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3571748CCGCACATACCGCCTGAGTACTCAGGCGGTATGTGCGG0.037800.001500.706900.750000.902200.75000


Target Position: 1295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1295GGUGGACUAUUCGGACAAG78.5727388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2701313GGTGGACTATTCGGACAAGCTTGTCCGAATAGTCCACC0.053000.010300.715500.750001.000001.00000


Target Position: 1353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1353GUGCUCUUCAAUGACUCAA80.7593286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1731371GTGCTCTTCAATGACTCAATTGAGTCATTGAAGAGCAC0.248700.081400.646600.750001.000001.00000


Target Position: 856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
856ACAGUAUUCCCAAGCACAU78.2481398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
266874ACAGTATTCCCAAGCACATATGTGCTTGGGAATACTGT0.237300.056200.551700.750001.000001.00000


Target Position: 1639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1639GCGUGCAGAUCAACUUCUU84.5896148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3371657GCGTGCAGATCAACTTCTTAAGAAGTTGATCTGCACGC0.661000.002100.784501.000001.000001.00000


Target Position: 1351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1351GGGUGCUCUUCAAUGACUC74.7833554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921369GGGTGCTCTTCAATGACTCGAGTCATTGAAGAGCACCC0.252500.015600.681000.750001.000001.00000


Target Position: 921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
921CCCACUGCCCGCCCAACCA69.9973826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
167939CCCACTGCCCGCCCAACCATGGTTGGGCGGGCAGTGGG0.580400.127100.646600.750001.000001.00000


Target Position: 2176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2176AAAAAAAAAAAAAAAAAAA83.5835183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3202194AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.998600.500000.500001.000001.00000


Target Position: 2082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2082CCACCAUAUGAAUUGUACA93.535627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2012100CCACCATATGAATTGTACATGTACAATTCATATGGTGG0.136100.108500.637900.750001.000001.00000


Target Position: 797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
797ACCACCUUUUGAGACUUCU64.28081162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
265815ACCACCTTTTGAGACTTCTAGAAGTCTCAAAAGGTGGT0.056300.009200.629300.500001.000001.00000


Target Position: 714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
714GAGGUGCUGAGCAAGAAAG74.168586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
281732GAGGTGCTGAGCAAGAAAGCTTTCTTGCTCAGCACCTC0.240800.005300.672400.500000.983701.00000


Target Position: 2182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2182AAAAAAAAAAAAAAAAAAA83.5835189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3322200AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.999100.500000.500001.000001.00000


Target Position: 2160, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2160GUGAAUAUUCAAAAAAAAA91.667544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1792178GTGAATATTCAAAAAAAAATTTTTTTTTGAATATTCAC0.436100.090000.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2158-2180ATGTGAATATTCAAAAAAAAAAAUUUUUUUUUGAAUAUUCACAUGUGAAUAUUCAAAAAAAAAAAU-11.38.711


Target Position: 2129, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2129CUUUCCUUGGCUUUAUGCA73.7888609

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2127-2149TCCTTTCCTTGGCTTTATGCACAUGCAUAAAGCCAAGGAAAGGACUUUCCUUGGCUUUAUGCACAU15.318.722


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737CAGUUUCGAGGUGGAUGUG67.7339963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
348755CAGTTTCGAGGTGGATGTGCACATCCACCTCGAAACTG0.024100.004900.491400.500001.000001.00000


Target Position: 814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
814CUUGCCUAAAAGAGACCUA81.7599245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
372832CTTGCCTAAAAGAGACCTATAGGTCTCTTTTAGGCAAG0.025200.003000.465500.750000.902200.75000


Target Position: 338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
338GGAGAAGAUGUCCAUGGAA97.32710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
307356GGAGAAGATGTCCATGGAATTCCATGGACATCTTCTCC0.041300.003300.698301.000001.000001.00000


Target Position: 577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
577GAGACCUCAAGCUGGGCAA83.0163203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
338595GAGACCTCAAGCTGGGCAATTGCCCAGCTTGAGGTCTC0.024300.006300.663800.750000.918500.62500


Target Position: 620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
620GGUGAAAAUAGGGGAUUUU80.3613309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
316638GGTGAAAATAGGGGATTTTAAAATCCCCTATTTTCACC0.031900.021600.853401.000001.000001.00000


Target Position: 1066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1066AGCCCCUCACAGUCCUCAA82.0158233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1741084AGCCCCTCACAGTCCTCAATTGAGGACTGTGAGGGGCT0.176300.131600.706900.750000.983700.62500


Target Position: 381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
381CACCAGCACGUCGUAGGAU78.108402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352399CACCAGCACGTCGTAGGATATCCTACGACGTGCTGGTG0.020200.002900.612100.750001.000001.00000


Target Position: 951, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951CUUAAUGACGAGUUCUUUA90.087464

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_895119CTTAATGACGAGTTCTTTA1/0/1/091.46PLK1NM_005030.31NANANANA00PLK1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
338969CTTAATGACGAGTTCTTTATAAAGAACTCGTCATTAAG0.078800.002100.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
949-971TGCTTAATGACGAGTTCTTTACTUAAAGAACUCGUCAUUAAGCACUUAAUGACGAGUUCUUUACUU13.38.921


Target Position: 2079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2079ACCCCACCAUAUGAAUUGU68.5315915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3512097ACCCCACCATATGAATTGTACAATTCATATGGTGGGGT0.142200.123000.646600.500001.000001.00000


Target Position: 665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
665CGGGGAGAGGAAGAAGACC61.16011364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
319683CGGGGAGAGGAAGAAGACCGGTCTTCTTCCTCTCCCCG0.037900.005100.560300.500000.994600.75000


Target Position: 1402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1402GCCUGCAGUACAUAGAGCG67.586980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3211420GCCTGCAGTACATAGAGCGCGCTCTATGTACTGCAGGC0.030100.007400.577600.500000.972800.75000


Target Position: 1896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1896CCUCACUCCCACCUGCAUC63.31431233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1451914CCTCACTCCCACCTGCATCGATGCAGGTGGGAGTGAGG0.296200.124100.663800.750001.000001.00000


Target Position: 655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
655UCGAAUAUGACGGGGAGAG51.55561846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
356673TCGAATATGACGGGGAGAGCTCTCCCCGTCATATTCGA0.129900.056800.482800.500001.000001.00000


Target Position: 884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
884GGCCGCCUCCCUCAUCCAG61.6161339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
202902GGCCGCCTCCCTCATCCAGCTGGATGAGGGAGGCGGCC0.125500.076300.715500.750001.000001.00000


Target Position: 2090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2090UGAAUUGUACAGAAUAUUU81.0328272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2692108TGAATTGTACAGAATATTTAAATATTCTGTACAATTCA0.054200.030100.724100.750001.000001.00000


Target Position: 1640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1640CGUGCAGAUCAACUUCUUC77.5925424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2791658CGTGCAGATCAACTTCTTCGAAGAAGTTGATCTGCACG0.650400.004800.603400.750001.000001.00000


Target Position: 1024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1024GGUUUUCGAUUGCUCCCAG75.6037516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3731042GGTTTTCGATTGCTCCCAGCTGGGAGCAATCGAAAACC0.012400.003700.569000.750001.000001.00000


Target Position: 878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878CCCCGUGGCCGCCUCCCUC52.6371790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182896CCCCGTGGCCGCCTCCCTCGAGGGAGGCGGCCACGGGG0.305900.026400.681000.750000.945700.75000


Target Position: 1610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1610CGCCAUCAUCCUGCACCUC63.35281227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3021628CGCCATCATCCTGCACCTCGAGGTGCAGGATGATGGCG0.036700.012700.612100.750001.000001.00000


Target Position: 685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
685UGUGUGGGACUCCUAAUUA84.4758153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
249703TGTGTGGGACTCCTAATTATAATTAGGAGTCCCACACA0.082100.007100.672400.750000.962001.00000


Target Position: 406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
406GCUUUUUCGAGGACAACGA79.7374339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
375424GCTTTTTCGAGGACAACGATCGTTGTCCTCGAAAAAGC0.012200.003000.560300.750000.962000.62500


Target Position: 1481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1481CACCCUCCUUAAAUAUUUC74.3237580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2711499CACCCTCCTTAAATATTTCGAAATATTTAAGGAGGGTG0.763400.510500.620700.500001.000001.00000


Target Position: 2123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2123ACUGUCCUUUCCUUGGCUU67.6218974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2442141ACTGTCCTTTCCTTGGCTTAAGCCAAGGAAAGGACAGT0.100800.013600.569000.750000.994600.87500


Target Position: 2161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2161UGAAUAUUCAAAAAAAAAA82.5513215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2122179TGAATATTCAAAAAAAAAATTTTTTTTTTGAATATTCA0.957700.092600.724100.750001.000001.00000


Target Position: 791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791GGGCAAACCACCUUUUGAG74.8705548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185809GGGCAAACCACCTTTTGAGCTCAAAAGGTGGTTTGCCC0.427300.016800.681000.750000.923900.62500


Target Position: 2080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2080CCCCACCAUAUGAAUUGUA82.3423222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1982098CCCCACCATATGAATTGTATACAATTCATATGGTGGGG0.134800.143800.810301.000001.000001.00000


Target Position: 39, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
39CGCAGCUUCGGGAGCAUGA77.1624443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
33457CGCAGCTTCGGGAGCATGATCATGCTCCCGAAGCTGCG0.048700.002200.698300.750000.934801.00000


Target Position: 584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
584CAAGCUGGGCAACCUUUUC65.61951077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
362602CAAGCTGGGCAACCTTTTCGAAAAGGTTGCCCAGCTTG0.073700.001400.474100.500000.940200.62500


Target Position: 935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
935AACCAUUAACGAGCUGCUU67.596977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
317953AACCATTAACGAGCTGCTTAAGCAGCTCGTTAATGGTT0.031700.018400.508600.500001.000001.00000


Target Position: 1121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1121GGAAAAAGAAGAACCAGUG76.9787451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3591139GGAAAAAGAAGAACCAGTGCACTGGTTCTTCTTTTTCC0.017400.016300.577600.750001.000001.00000


Target Position: 2159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2159UGUGAAUAUUCAAAAAAAA88.91775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2912177TGTGAATATTCAAAAAAAATTTTTTTTGAATATTCACA0.310900.004100.706900.750001.000001.00000


Target Position: 1483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1483CCCUCCUUAAAUAUUUCCG56.98051579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3741501CCCTCCTTAAATATTTCCGCGGAAATATTTAAGGAGGG0.302400.211900.577600.500001.000001.00000


Target Position: 2068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2068CCUCCCCCUCAACCCCACC46.15852028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3472086CCTCCCCCTCAACCCCACCGGTGGGGTTGAGGGGGAGG0.731100.390300.491400.500001.000001.00000


Target Position: 245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
245UGCCAAGUGCUUCGAGAUC57.20131560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
361263TGCCAAGTGCTTCGAGATCGATCTCGAAGCACTTGGCA0.017900.001400.672400.500000.967400.75000


Target Position: 1643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1643GCAGAUCAACUUCUUCCAG74.1629587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2471661GCAGATCAACTTCTTCCAGCTGGAAGAAGTTGATCTGC0.385000.019700.569000.750001.000001.00000


Target Position: 156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
156CCACCGGCGAAAGAGAUCC52.77611779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
366174CCACCGGCGAAAGAGATCCGGATCTCTTTCGCCGGTGG0.112200.001600.474100.500001.000001.00000


Target Position: 340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
340AGAAGAUGUCCAUGGAAAU85.4596130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
332358AGAAGATGTCCATGGAAATATTTCCATGGACATCTTCT0.045100.002300.715500.750001.000001.00000


Target Position: 1612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1612CCAUCAUCCUGCACCUCAG80.2982312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3561630CCATCATCCTGCACCTCAGCTGAGGTGCAGGATGATGG0.018000.011200.560300.750000.940200.62500


Target Position: 1933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1933GCUCCCGCGGUGCCAUGUC56.28331617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2821951GCTCCCGCGGTGCCATGTCGACATGGCACCGCGGGAGC0.076300.005600.534500.750000.978300.75000


Target Position: 691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
691GGACUCCUAAUUACAUAGC64.56721139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
286709GGACTCCTAATTACATAGCGCTATGTAATTAGGAGTCC0.142200.017800.517200.500000.967400.62500


Target Position: 2065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2065CCCCCUCCCCCUCAACCCC42.58552100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3092083CCCCCTCCCCCTCAACCCCGGGGTTGAGGGGGAGGGGG0.743800.353500.500000.500001.000001.00000


Target Position: 937, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
937CCAUUAACGAGCUGCUUAA91.747540

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_293719CCATTAACGAGCTGCTTAA1/0/1/097.75PLK1NM_005030.31NANANA16:23695258..23695276(+)00PLK1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
271955CCATTAACGAGCTGCTTAATTAAGCAGCTCGTTAATGG0.051500.013300.810301.000001.000001.00000


Target Position: 2015, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2015CUGUGUAAGUUAUUUUUGU80.6267290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2432033CTGTGTAAGTTATTTTTGTACAAAAATAACTTACACAG0.276300.014800.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2013-2035TGCTGTGTAAGTTATTTTTGTACACAAAAAUAACUUACACAGCACUGUGUAAGUUAUUUUUGUACU-3.320.412


Target Position: 247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
247CCAAGUGCUUCGAGAUCUC73.2102643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
312265CCAAGTGCTTCGAGATCTCGAGATCTCGAAGCACTTGG0.033300.005000.534500.750001.000001.00000


Target Position: 621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
621GUGAAAAUAGGGGAUUUUG67.7346962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
297639GTGAAAATAGGGGATTTTGCAAAATCCCCTATTTTCAC0.038200.023000.646600.500001.000001.00000


Target Position: 1642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1642UGCAGAUCAACUUCUUCCA76.9794450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2891660TGCAGATCAACTTCTTCCATGGAAGAAGTTGATCTGCA0.511400.020300.508600.500001.000001.00000


Target Position: 1133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1133ACCAGUGGUUCGAGAGACA82.9167208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3401151ACCAGTGGTTCGAGAGACATGTCTCTCGAACCACTGGT0.558500.016000.646600.500001.000001.00000


Target Position: 2148, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2148CAUUAAACAGAUGUGAAUA94.762318

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2146-2168CACATTAAACAGATGTGAATATTUAUUCACAUCUGUUUAAUGUGCAUUAAACAGAUGUGAAUAUUU20.5-0.322


Target Position: 818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
818CCUAAAAGAGACCUACCUC73.7609611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
279836CCTAAAAGAGACCTACCTCGAGGTAGGTCTCTTTTAGG0.078300.019400.534500.750000.902200.62500


Target Position: 1312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1312AGUACGGCCUUGGGUAUCA77.3058435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3681330AGTACGGCCTTGGGTATCATGATACCCAAGGCCGTACT0.016900.001200.482800.500001.000001.00000


Target Position: 1793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1793CCGCUACGCCCGCACUAUG67.03771009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3131811CCGCTACGCCCGCACTATGCATAGTGCGGGCGTAGCGG0.034300.003000.758600.750000.923900.62500


Target Position: 683, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
683CCUGUGUGGGACUCCUAAU81.5276254

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_768319CCTGTGTGGGACTCCTAAT1/0/1/091.46PLK1NM_005030.31NANANANA00PLK1(0.002)


Target Position: 1404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1404CUGCAGUACAUAGAGCGUG63.98731183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3721422CTGCAGTACATAGAGCGTGCACGCTCTATGTACTGCAG0.012700.008400.491400.500000.972800.62500


Target Position: 1071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1071CUCACAGUCCUCAAUAAAG75.8607507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3731089CTCACAGTCCTCAATAAAGCTTTATTGAGGACTGTGAG0.020000.017300.672400.500001.000001.00000


Target Position: 2125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2125UGUCCUUUCCUUGGCUUUA72.2359698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2442143TGTCCTTTCCTTGGCTTTATAAAGCCAAGGAAAGGACA0.136800.007800.672400.750000.994600.87500


Target Position: 2019, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2019GUAAGUUAUUUUUGUACAU86.4083112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2852037GTAAGTTATTTTTGTACATATGTACAAAAATAACTTAC0.267600.141000.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2017-2039GTGTAAGTTATTTTTGTACATGTAUGUACAAAAAUAACUUACACGUAAGUUAUUUUUGUACAUGUU20.46.612


Target Position: 1356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1356CUCUUCAAUGACUCAACAC69.8712837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3361374CTCTTCAATGACTCAACACGTGTTGAGTCATTGAAGAG0.063300.041100.517200.500001.000001.00000


Target Position: 858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
858AGUAUUCCCAAGCACAUCA81.4774255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
355876AGTATTCCCAAGCACATCATGATGTGCTTGGGAATACT0.222800.053500.482800.500001.000001.00000


Target Position: 991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
991GUCUCCCCAUCACCUGCCU65.56811082

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3611009GTCTCCCCATCACCTGCCTAGGCAGGTGATGGGGAGAC0.189000.198700.474100.500001.000001.00000


Target Position: 2184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2184AAAAAAAAAAAAAAAAAAA83.5835191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3702202AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.999200.500000.500001.000001.00000


Target Position: 948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
948CUGCUUAAUGACGAGUUCU74.13588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
354966CTGCTTAATGACGAGTTCTAGAACTCGTCATTAAGCAG0.022100.001600.560300.500001.000001.00000


Target Position: 2175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2175AAAAAAAAAAAAAAAAAAA83.5835182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3102193AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.998000.500000.500001.000001.00000


Target Position: 2087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2087AUAUGAAUUGUACAGAAUA91.162752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3152105ATATGAATTGTACAGAATATATTCTGTACAATTCATAT0.097200.051700.500000.500001.000001.00000


Target Position: 1895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895UCCUCACUCCCACCUGCAU67.6861971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1891913TCCTCACTCCCACCTGCATATGCAGGTGGGAGTGAGGA0.143100.135400.715500.750001.000001.00000


Target Position: 591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
591GGCAACCUUUUCCUGAAUG66.72681022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
303609GGCAACCTTTTCCTGAATGCATTCAGGAAAAGGTTGCC0.036300.008700.844800.750001.000001.00000


Target Position: 1659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1659CAGGAUCACACCAAGCUCA88.480281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2491677CAGGATCACACCAAGCTCATGAGCTTGGTGTGATCCTG0.104000.010400.560300.500000.962000.75000


Target Position: 482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
482GAGGAGGAAAGCCCUGACU73.4564631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
306500GAGGAGGAAAGCCCTGACTAGTCAGGGCTTTCCTCCTC0.098400.003300.603400.500000.902200.62500


Target Position: 2171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2171AAAAAAAAAAAAAAAAAAA83.5835178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3472189AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999500.987800.500000.500001.000001.00000


Target Position: 1003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1003CCUGCCUGACCAUUCCACC59.75741436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3501021CCTGCCTGACCATTCCACCGGTGGAATGGTCAGGCAGG0.527300.074300.491400.500001.000001.00000


Target Position: 899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899CCAGAAGAUGCUUCAGACA88.983873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
287917CCAGAAGATGCTTCAGACATGTCTGAAGCATCTTCTGG0.101400.004300.637900.750000.934800.87500


Target Position: 2073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2073CCCUCAACCCCACCAUAUG68.2275932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1762091CCCTCAACCCCACCATATGCATATGGTGGGGTTGAGGG0.226700.180100.836200.750001.000001.00000


Target Position: 558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
558CGAAACCGAGUUAUUCAUC68.0347944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
226576CGAAACCGAGTTATTCATCGATGAATAACTCGGTTTCG0.097400.014500.612100.750001.000001.00000


Target Position: 2157, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2157GAUGUGAAUAUUCAAAAAA93.216228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3692175GATGTGAATATTCAAAAAATTTTTTGAATATTCACATC0.279900.001200.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2155-2177CAGATGTGAATATTCAAAAAAAAUUUUUUGAAUAUUCACAUCUGGAUGUGAAUAUUCAAAAAAAAU7.720.522


Target Position: 2164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2164AUAUUCAAAAAAAAAAAAA76.3826474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2672182ATATTCAAAAAAAAAAAAATTTTTTTTTTTTTGAATAT0.994400.290400.543100.500001.000001.00000


Target Position: 2186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2186AAAAAAAAAAAAAAAAAAA83.5835193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3272204AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999800.999400.500000.500001.000001.00000


Target Position: 1723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1723GGGACUUCCGCACAUACCG64.89891122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2451741GGGACTTCCGCACATACCGCGGTATGTGCGGAAGTCCC0.221000.007700.577600.500000.983700.75000


Target Position: 1944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1944GCCAUGUCUGCAGUGUGCC57.14761567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3011962GCCATGTCTGCAGTGTGCCGGCACACTGCAGACATGGC0.049600.009000.500000.500000.945700.62500


Target Position: 1117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1117CCCGGGAAAAAGAAGAACC57.71651544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3231135CCCGGGAAAAAGAAGAACCGGTTCTTCTTTTTCCCGGG0.065300.002700.637900.500001.000001.00000


Target Position: 1487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1487CCUUAAAUAUUUCCGCAAU81.8035242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
911505CCTTAAATATTTCCGCAATATTGCGGAAATATTTAAGG0.308800.186500.836201.000001.000001.00000


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949UGCUUAAUGACGAGUUCUU73.3682636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
349967TGCTTAATGACGAGTTCTTAAGAACTCGTCATTAAGCA0.023100.001800.715500.750001.000001.00000


Target Position: 2170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2170AAAAAAAAAAAAAAAAAAA83.5835177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3162188AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999400.971600.500000.500001.000001.00000


Target Position: 1488, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1488CUUAAAUAUUUCCGCAAUU77.0124449

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5148819CTTAAATATTTCCGCAATT1/0/1/093.44PLK1NM_005030.31NANANA16:23700824..23700842(+)00PLK1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2001506CTTAAATATTTCCGCAATTAATTGCGGAAATATTTAAG0.248700.214900.629300.750001.000001.00000


Target Position: 885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885GCCGCCUCCCUCAUCCAGA74.1786585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
209903GCCGCCTCCCTCATCCAGATCTGGATGAGGGAGGCGGC0.119600.067900.775900.750001.000001.00000


Target Position: 2072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2072CCCCUCAACCCCACCAUAU72.2295700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
372090CCCCTCAACCCCACCATATATATGGTGGGGTTGAGGGG0.727300.528300.948301.000001.000001.00000


Target Position: 2180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2180AAAAAAAAAAAAAAAAAAA83.5835187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3212198AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.999100.500000.500001.000001.00000


Target Position: 551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
551CCUGCACCGAAACCGAGUU70.505796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
297569CCTGCACCGAAACCGAGTTAACTCGGTTTCGGTGCAGG0.043600.003800.698301.000000.967400.75000


Target Position: 880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
880CCGUGGCCGCCUCCCUCAU67.11131004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
151898CCGTGGCCGCCTCCCTCATATGAGGGAGGCGGCCACGG0.306200.027400.758601.000000.945701.00000


Target Position: 1398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1398GACAGCCUGCAGUACAUAG79.0237367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3221416GACAGCCTGCAGTACATAGCTATGTACTGCAGGCTGTC0.091600.029500.646600.500001.000001.00000


Target Position: 2011, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2011GUUGCUGUGUAAGUUAUUU80.4638303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2962029GTTGCTGTGTAAGTTATTTAAATAACTTACACAGCAAC0.308700.004000.646600.750001.000001.00000


Target Position: 950, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
950GCUUAAUGACGAGUUCUUU84.3807157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340968GCTTAATGACGAGTTCTTTAAAGAACTCGTCATTAAGC0.066700.002000.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
948-970CTGCTTAATGACGAGTTCTTTACAAAGAACUCGUCAUUAAGCAGGCUUAAUGACGAGUUCUUUACU17.73.522


Target Position: 1792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1792UCCGCUACGCCCGCACUAU62.11309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2681810TCCGCTACGCCCGCACTATATAGTGCGGGCGTAGCGGA0.190500.005300.827600.750000.923900.75000


Target Position: 2008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2008GGGGUUGCUGUGUAAGUUA93.174429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3512026GGGGTTGCTGTGTAAGTTATAACTTACACAGCAACCCC0.038600.001700.956901.000001.000001.00000


Target Position: 473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
473GCUGCACAAGAGGAGGAAA88.486980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
375491GCTGCACAAGAGGAGGAAATTTCCTCCTCTTGTGCAGC0.017100.001000.853401.000001.000001.00000


Target Position: 2067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2067CCCUCCCCCUCAACCCCAC52.72311783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1012085CCCTCCCCCTCAACCCCACGTGGGGTTGAGGGGGAGGG0.756100.398900.698300.750001.000001.00000


Target Position: 993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
993CUCCCCAUCACCUGCCUGA71.1377753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2801011CTCCCCATCACCTGCCTGATCAGGCAGGTGATGGGGAG0.044500.047200.586200.500000.983700.62500


Target Position: 918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
918GAUCCCACUGCCCGCCCAA78.7827379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
280936GATCCCACTGCCCGCCCAATTGGGCGGGCAGTGGGATC0.681300.136700.534500.750001.000001.00000


Target Position: 2062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2062UGUCCCCCUCCCCCUCAAC48.10341960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3312080TGTCCCCCTCCCCCTCAACGTTGAGGGGGAGGGGGACA0.452500.269100.560300.500001.000001.00000


Target Position: 1002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1002ACCUGCCUGACCAUUCCAC57.00721577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2901020ACCTGCCTGACCATTCCACGTGGAATGGTCAGGCAGGT0.528300.019500.560300.500001.000001.00000


Target Position: 1459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1459CCAACUCCUUGAUGAAGAA93.71624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2981477CCAACTCCTTGATGAAGAATTCTTCATCAAGGAGTTGG0.038000.012400.672401.000000.923900.75000


Target Position: 618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
618GAGGUGAAAAUAGGGGAUU71.8944714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
305636GAGGTGAAAATAGGGGATTAATCCCCTATTTTCACCTC0.044800.003400.801700.750001.000001.00000


Target Position: 1654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1654UCUUCCAGGAUCACACCAA77.4624430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2401672TCTTCCAGGATCACACCAATTGGTGTGATCCTGGAAGA0.183800.042200.577600.750000.962000.75000


Target Position: 842, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
842CAAGAAGAAUGAAUACAGU89.295469

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
840-862ATCAAGAAGAATGAATACAGTATACUGUAUUCAUUCUUCUUGAUCAAGAAGAAUGAAUACAGUAUU11.619.122


Target Position: 609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
609GAAGAUCUGGAGGUGAAAA91.480647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
212627GAAGATCTGGAGGTGAAAATTTTCACCTCCAGATCTTC0.115600.026600.672400.750001.000001.00000


Target Position: 790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
790UGGGCAAACCACCUUUUGA76.0708496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
375808TGGGCAAACCACCTTTTGATCAAAAGGTGGTTTGCCCA0.221400.010500.620700.500000.923900.75000


Target Position: 662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
662UGACGGGGAGAGGAAGAAG61.98141319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
316680TGACGGGGAGAGGAAGAAGCTTCTTCCTCTCCCCGTCA0.781900.038300.586200.500001.000001.00000


Target Position: 1134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1134CCAGUGGUUCGAGAGACAG68.5428913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2601152CCAGTGGTTCGAGAGACAGCTGTCTCTCGAACCACTGG0.391500.016200.560300.750001.000001.00000


Target Position: 851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
851UGAAUACAGUAUUCCCAAG71.6226727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342869TGAATACAGTATTCCCAAGCTTGGGAATACTGTATTCA0.121600.087900.586200.500000.934800.62500


Target Position: 2114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2114GAAUUCGGAACUGUCCUUU73.9257601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2982132GAATTCGGAACTGTCCTTTAAAGGACAGTTCCGAATTC0.069300.003700.672400.750000.907600.87500


Target Position: 2101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2101GAAUAUUUCUAUUGAAUUC82.4138219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3252119GAATATTTCTATTGAATTCGAATTCAATAGAAATATTC0.100400.024200.500000.500001.000001.00000


Target Position: 2172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2172AAAAAAAAAAAAAAAAAAA83.5835179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3032190AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999600.994200.500000.500001.000001.00000


Target Position: 1848, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1848CGUCUCAAGGCCUCCUAAU79.7227340

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10184819CGTCTCAAGGCCTCCTAAT1/0/1/091.46PLK1NM_005030.31NANANANA00PLK1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1311866CGTCTCAAGGCCTCCTAATATTAGGAGGCCTTGAGACG0.382300.047500.767201.000000.934800.62500


Target Position: 296, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
296CAAGAUUGUGCCUAAGUCU85.1124138

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
294-316GGCAAGATTGTGCCTAAGTCTCTAGACUUAGGCACAAUCUUGCCCAAGAUUGUGCCUAAGUCUCUU18.912.003


Target Position: 1897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1897CUCACUCCCACCUGCAUCU70.6002784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2421915CTCACTCCCACCTGCATCTAGATGCAGGTGGGAGTGAG0.116300.109700.586200.500001.000001.00000


Target Position: 956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
956UGACGAGUUCUUUACUUCU78.2834396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
330974TGACGAGTTCTTTACTTCTAGAAGTAAAGAACTCGTCA0.313900.014400.500000.500001.000001.00000


Target Position: 2179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2179AAAAAAAAAAAAAAAAAAA83.5835186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3192197AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.999100.500000.500001.000001.00000


Target Position: 793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
793GCAAACCACCUUUUGAGAC65.77771068

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
277811GCAAACCACCTTTTGAGACGTCTCAAAAGGTGGTTTGC0.181200.076700.534500.750001.000001.00000


Target Position: 964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
964UCUUUACUUCUGGCUAUAU73.9877595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327982TCTTTACTTCTGGCTATATATATAGCCAGAAGTAAAGA0.028400.016500.681000.750001.000001.00000


Target Position: 612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
612GAUCUGGAGGUGAAAAUAG79.5332348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
312630GATCTGGAGGTGAAAATAGCTATTTTCACCTCCAGATC0.241800.030100.508600.500001.000001.00000


Target Position: 484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
484GGAGGAAAGCCCUGACUGA92.990831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
250502GGAGGAAAGCCCTGACTGATCAGTCAGGGCTTTCCTCC0.148100.007000.646600.750000.929300.75000


Target Position: 2174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2174AAAAAAAAAAAAAAAAAAA83.5835181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3292192AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999600.997500.500000.500001.000001.00000


Target Position: 1702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1702UGACCUACAUCGACGAGAA91.411848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2631720TGACCTACATCGACGAGAATTCTCGTCGATGTAGGTCA0.219700.105500.551700.750000.956500.62500


Target Position: 2165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2165UAUUCAAAAAAAAAAAAAA82.1045230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2692183TATTCAAAAAAAAAAAAAATTTTTTTTTTTTTTGAATA0.997000.291500.543100.500001.000001.00000


Target Position: 835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
835UCCGGAUCAAGAAGAAUGA71.8033718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
337853TCCGGATCAAGAAGAATGATCATTCTTCTTGATCCGGA0.074100.012700.646600.500001.000001.00000


Target Position: 581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
581CCUCAAGCUGGGCAACCUU76.1526493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
318599CCTCAAGCTGGGCAACCTTAAGGTTGCCCAGCTTGAGG0.034500.002800.706901.000000.940200.62500


Target Position: 1067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1067GCCCCUCACAGUCCUCAAU76.2265489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1741085GCCCCTCACAGTCCTCAATATTGAGGACTGTGAGGGGC0.168000.146800.991401.000001.000001.00000


Target Position: 686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
686GUGUGGGACUCCUAAUUAC80.0199326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
346704GTGTGGGACTCCTAATTACGTAATTAGGAGTCCCACAC0.083900.006000.612100.500000.962001.00000


Target Position: 550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
550ACCUGCACCGAAACCGAGU60.32851406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
323568ACCTGCACCGAAACCGAGTACTCGGTTTCGGTGCAGGT0.054400.004900.646600.500000.989100.62500


Target Position: 395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
395AGGAUUCCACGGCUUUUUC60.15671416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
365413AGGATTCCACGGCTTTTTCGAAAAAGCCGTGGAATCCT0.016400.001400.672400.500001.000001.00000


Target Position: 2069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2069CUCCCCCUCAACCCCACCA62.92331255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3732087CTCCCCCTCAACCCCACCATGGTGGGGTTGAGGGGGAG0.723900.401100.465500.500001.000001.00000


Target Position: 838, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
838GGAUCAAGAAGAAUGAAUA103.941

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_383819GGATCAAGAAGAATGAATA1/0/1/094.96PLK1NM_005030.31NANANANA00PLK1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
115856GGATCAAGAAGAATGAATATATTCATTCTTCTTGATCC0.281800.060800.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
836-858CCGGATCAAGAAGAATGAATACAUAUUCAUUCUUCUUGAUCCGGGGAUCAAGAAGAAUGAAUACAU7.220.422


Target Position: 394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
394UAGGAUUCCACGGCUUUUU59.97011426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
353412TAGGATTCCACGGCTTTTTAAAAAGCCGTGGAATCCTA0.022200.001600.672400.500001.000001.00000


Target Position: 1478, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1478GAUCACCCUCCUUAAAUAU86.1527118

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9147819GATCACCCTCCTTAAATAT1/0/1/091.46PLK1NM_005030.31NANANA16:23700814..23700832(+)00PLK1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1971496GATCACCCTCCTTAAATATATATTTAAGGAGGGTGATC0.616100.218400.637900.750001.000001.00000


Target Position: 1397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1397UGACAGCCUGCAGUACAUA82.2366224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1111415TGACAGCCTGCAGTACATATATGTACTGCAGGCTGTCA0.367400.130100.681000.750001.000001.00000


Target Position: 2018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2018UGUAAGUUAUUUUUGUACA81.6408250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3082036TGTAAGTTATTTTTGTACATGTACAAAAATAACTTACA0.255800.132400.500000.500001.000001.00000


Target Position: 735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
735CACAGUUUCGAGGUGGAUG67.6159975

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
360753CACAGTTTCGAGGTGGATGCATCCACCTCGAAACTGTG0.017300.004200.637900.500001.000001.00000


Target Position: 963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
963UUCUUUACUUCUGGCUAUA73.491628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
318981TTCTTTACTTCTGGCTATATATAGCCAGAAGTAAAGAA0.031200.017900.629300.500001.000001.00000


Target Position: 2013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2013UGCUGUGUAAGUUAUUUUU74.7445560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2332031TGCTGTGTAAGTTATTTTTAAAAATAACTTACACAGCA0.340700.009200.853400.750001.000001.00000


Target Position: 1884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1884GACUGGUGCCCUCCUCACU79.1911364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3451902GACTGGTGCCCTCCTCACTAGTGAGGAGGGCACCAGTC0.611100.002000.612100.500000.967400.62500


Target Position: 1068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1068CCCCUCACAGUCCUCAAUA81.9922234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1771086CCCCTCACAGTCCTCAATATATTGAGGACTGTGAGGGG0.163100.138000.948301.000001.000001.00000


Target Position: 799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
799CACCUUUUGAGACUUCUUG67.9052951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352817CACCTTTTGAGACTTCTTGCAAGAAGTCTCAAAAGGTG0.064800.024700.646600.500001.000001.00000


Target Position: 988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
988CCCGUCUCCCCAUCACCUG57.18681562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1781006CCCGTCTCCCCATCACCTGCAGGTGATGGGGAGACGGG0.234000.091300.706900.750001.000001.00000


Target Position: 1801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1801CCCGCACUAUGGUGGACAA90.22162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3741819CCCGCACTATGGTGGACAATTGTCCACCATAGTGCGGG0.012300.001400.844801.000000.945700.62500


Target Position: 2127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2127UCCUUUCCUUGGCUUUAUG57.88651536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3412145TCCTTTCCTTGGCTTTATGCATAAAGCCAAGGAAAGGA0.123400.041200.715500.500000.994600.75000


Target Position: 610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
610AAGAUCUGGAGGUGAAAAU73.5255624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
360628AAGATCTGGAGGTGAAAATATTTTCACCTCCAGATCTT0.136400.025000.629300.500001.000001.00000


Target Position: 2137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2137GGCUUUAUGCACAUUAAAC78.9764371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3342155GGCTTTATGCACATTAAACGTTTAATGTGCATAAAGCC0.025500.003500.853400.750001.000001.00000


Target Position: 342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
342AAGAUGUCCAUGGAAAUAU74.7441561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
372360AAGATGTCCATGGAAATATATATTTCCATGGACATCTT0.021400.001100.594800.500001.000001.00000


Target Position: 661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
661AUGACGGGGAGAGGAAGAA70.5138794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
354679ATGACGGGGAGAGGAAGAATTCTTCCTCTCCCCGTCAT0.792300.051700.482800.500001.000001.00000


Target Position: 2009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2009GGGUUGCUGUGUAAGUUAU90.373458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3302027GGGTTGCTGTGTAAGTTATATAACTTACACAGCAACCC0.111900.002400.948301.000001.000001.00000


Target Position: 565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
565GAGUUAUUCAUCGAGACCU80.1379321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
369583GAGTTATTCATCGAGACCTAGGTCTCGATGAATAACTC0.195300.009900.465500.500001.000001.00000


Target Position: 1889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1889GUGCCCUCCUCACUCCCAC62.33931294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3131907GTGCCCTCCTCACTCCCACGTGGGAGTGAGGAGGGCAC0.318500.030600.500000.500001.000001.00000


Target Position: 798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
798CCACCUUUUGAGACUUCUU81.4197257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
331816CCACCTTTTGAGACTTCTTAAGAAGTCTCAAAAGGTGG0.041500.002400.706901.000001.000001.00000


Target Position: 1120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1120GGGAAAAAGAAGAACCAGU80.3011311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3281138GGGAAAAAGAAGAACCAGTACTGGTTCTTCTTTTTCCC0.027500.026000.784500.750001.000001.00000


Target Position: 1458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1458CCCAACUCCUUGAUGAAGA78.4204392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3151476CCCAACTCCTTGATGAAGATCTTCATCAAGGAGTTGGG0.032400.012900.767200.750000.923900.62500


Target Position: 736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736ACAGUUUCGAGGUGGAUGU66.31321036

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
362754ACAGTTTCGAGGTGGATGTACATCCACCTCGAAACTGT0.017000.004200.500000.500001.000001.00000


Target Position: 689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
689UGGGACUCCUAAUUACAUA85.4896129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
255707TGGGACTCCTAATTACATATATGTAATTAGGAGTCCCA0.217400.006200.801700.750000.962000.75000


Target Position: 382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382ACCAGCACGUCGUAGGAUU72.0886706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
329400ACCAGCACGTCGTAGGATTAATCCTACGACGTGCTGGT0.029100.002400.844800.750001.000001.00000


Target Position: 1294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1294GGGUGGACUAUUCGGACAA88.846376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2371312GGGTGGACTATTCGGACAATTGTCCGAATAGTCCACCC0.086000.013700.844801.000001.000001.00000


Target Position: 2047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2047UGGGUUCUACAGCCUUGUC59.61471445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2832065TGGGTTCTACAGCCTTGTCGACAAGGCTGTAGAACCCA0.179600.009700.525900.500001.000001.00000


Target Position: 1203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1203GUCAAUGCCUCCAAGCCCU71.6021728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3651221GTCAATGCCTCCAAGCCCTAGGGCTTGGAGGCATTGAC0.026500.010400.474100.500000.918500.87500


Target Position: 535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
535UGCUUGGCUGCCAGUACCU63.90131189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
311553TGCTTGGCTGCCAGTACCTAGGTACTGGCAGCCAAGCA0.249700.003100.508600.500000.902200.62500


Target Position: 1696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1696CAGCCGUGACCUACAUCGA86.4887110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3451714CAGCCGTGACCTACATCGATCGATGTAGGTCACGGCTG0.191900.010300.491400.500000.956500.75000


Target Position: 643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
643UGGCAACCAAAGUCGAAUA80.5206297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
368661TGGCAACCAAAGTCGAATATATTCGACTTTGGTTGCCA0.015300.001800.801700.750000.907600.87500


Target Position: 2091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2091GAAUUGUACAGAAUAUUUC78.6781383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3072109GAATTGTACAGAATATTTCGAAATATTCTGTACAATTC0.042000.019500.500000.500001.000001.00000


Target Position: 881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
881CGUGGCCGCCUCCCUCAUC60.30161407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
225899CGTGGCCGCCTCCCTCATCGATGAGGGAGGCGGCCACG0.288700.029600.594800.750000.945700.87500


Target Position: 924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
924ACUGCCCGCCCAACCAUUA71.7353721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125942ACTGCCCGCCCAACCATTATAATGGTTGGGCGGGCAGT0.478500.098600.672400.750001.000001.00000


Target Position: 1109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1109UGAGCGUCCCCGGGAAAAA70.5231793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1581127TGAGCGTCCCCGGGAAAAATTTTTCCCGGGGACGCTCA0.187000.028000.724100.750000.907600.62500


Target Position: 2074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2074CCUCAACCCCACCAUAUGA84.4092156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2082092CCTCAACCCCACCATATGATCATATGGTGGGGTTGAGG0.212700.168100.620700.750001.000001.00000


Target Position: 1188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1188CAGCAGCUGCACAGUGUCA90.921656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3111206CAGCAGCTGCACAGTGTCATGACACTGTGCAGCTGCTG0.154500.010100.560300.500000.972800.75000


Target Position: 845, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
845GAAGAAUGAAUACAGUAUU88.9374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
149863GAAGAATGAATACAGTATTAATACTGTATTCATTCTTC0.201000.044500.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
843-865AAGAAGAATGAATACAGTATTCCAAUACUGUAUUCAUUCUUCUUGAAGAAUGAAUACAGUAUUCCU19.012.033


Target Position: 563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
563CCGAGUUAUUCAUCGAGAC73.7427613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
228581CCGAGTTATTCATCGAGACGTCTCGATGAATAACTCGG0.218700.010300.594800.750000.940200.62500


Target Position: 900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
900CAGAAGAUGCUUCAGACAG75.0205538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
355918CAGAAGATGCTTCAGACAGCTGTCTGAAGCATCTTCTG0.092100.004900.500000.500000.934800.75000


Target Position: 1296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1296GUGGACUAUUCGGACAAGU70.8671771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3041314GTGGACTATTCGGACAAGTACTTGTCCGAATAGTCCAC0.045200.012900.586200.500001.000001.00000


Target Position: 619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
619AGGUGAAAAUAGGGGAUUU79.8575332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
305637AGGTGAAAATAGGGGATTTAAATCCCCTATTTTCACCT0.034600.007900.844800.750001.000001.00000


Target Position: 642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
642CUGGCAACCAAAGUCGAAU73.1144647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
371660CTGGCAACCAAAGTCGAATATTCGACTTTGGTTGCCAG0.013800.001600.775900.750000.907600.87500


Target Position: 1701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1701GUGACCUACAUCGACGAGA74.7106565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2871719GTGACCTACATCGACGAGATCTCGTCGATGTAGGTCAC0.205200.067800.569000.500000.956500.75000


Target Position: 1450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1450GUUCCCAUCCCAACUCCUU72.6253679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2981468GTTCCCATCCCAACTCCTTAAGGAGTTGGGATGGGAAC0.480600.010600.508600.750001.000001.00000


Target Position: 1849, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1849GUCUCAAGGCCUCCUAAUA90.282659

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4184919GTCTCAAGGCCTCCTAATA1/0/1/094.96PLK1NM_005030.31NANANA16:23701368..23701386(+)00PLK1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2021867GTCTCAAGGCCTCCTAATATATTAGGAGGCCTTGAGAC0.534500.052300.775900.750000.934800.62500


Target Position: 923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
923CACUGCCCGCCCAACCAUU72.2638696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
82941CACTGCCCGCCCAACCATTAATGGTTGGGCGGGCAGTG0.481100.100800.784500.750001.000001.00000


Target Position: 617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
617GGAGGUGAAAAUAGGGGAU80.903279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
310635GGAGGTGAAAATAGGGGATATCCCCTATTTTCACCTCC0.062600.003100.689701.000001.000001.00000


Target Position: 608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
608UGAAGAUCUGGAGGUGAAA80.5011298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
148626TGAAGATCTGGAGGTGAAATTTCACCTCCAGATCTTCA0.203400.071800.724100.750001.000001.00000


Target Position: 554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
554GCACCGAAACCGAGUUAUU83.2718200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
301572GCACCGAAACCGAGTTATTAATAACTCGGTTTCGGTGC0.037600.004600.844801.000000.967400.75000


Target Position: 879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879CCCGUGGCCGCCUCCCUCA67.9648945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
210897CCCGTGGCCGCCTCCCTCATGAGGGAGGCGGCCACGGG0.314800.026600.767200.750000.945700.87500


Target Position: 2066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2066CCCCUCCCCCUCAACCCCA62.53281282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1652084CCCCTCCCCCTCAACCCCATGGGGTTGAGGGGGAGGGG0.745400.380200.646600.750001.000001.00000


Target Position: 1324, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1324GGUAUCAGCUCUGUGAUAA94.464519

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1322-1344TGGGTATCAGCTCTGTGATAACAUUAUCACAGAGCUGAUACCCAGGUAUCAGCUCUGUGAUAACAU21.520.323


Target Position: 2088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2088UAUGAAUUGUACAGAAUAU86.2724114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3122106TATGAATTGTACAGAATATATATTCTGTACAATTCATA0.091200.042800.500000.500001.000001.00000


Target Position: 2010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2010GGUUGCUGUGUAAGUUAUU84.2445160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2832028GGTTGCTGTGTAAGTTATTAATAACTTACACAGCAACC0.255300.004500.844801.000001.000001.00000


Target Position: 2167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2167UUCAAAAAAAAAAAAAAAA69.5517853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3382185TTCAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTGAA0.998400.316000.672400.500001.000001.00000


Target Position: 593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
593CAACCUUUUCCUGAAUGAA89.362968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
359611CAACCTTTTCCTGAATGAATTCATTCAGGAAAAGGTTG0.094000.003400.474100.750001.000001.00000


Target Position: 947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
947GCUGCUUAAUGACGAGUUC71.9418712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
362965GCTGCTTAATGACGAGTTCGAACTCGTCATTAAGCAGC0.021000.001300.681000.750001.000001.00000


Target Position: 2086, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2086CAUAUGAAUUGUACAGAAU92.013637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2202104CATATGAATTGTACAGAATATTCTGTACAATTCATATG0.103900.061000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2084-2106ACCATATGAATTGTACAGAATATAUUCUGUACAAUUCAUAUGGUCAUAUGAAUUGUACAGAAUAUU20.38.722


Target Position: 1015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1015UUCCACCAAGGUUUUCGAU59.51761450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3691033TTCCACCAAGGTTTTCGATATCGAAAACCTTGGTGGAA0.015000.002400.491400.500000.956500.75000


Target Position: 1057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1057GCAACCGGAAGCCCCUCAC57.21951558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2581075GCAACCGGAAGCCCCTCACGTGAGGGGCTTCCGGTTGC0.265500.009600.560300.750000.956501.00000


Target Position: 857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
857CAGUAUUCCCAAGCACAUC70.1088816

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
251875CAGTATTCCCAAGCACATCGATGTGCTTGGGAATACTG0.233300.054000.603400.500001.000001.00000


Target Position: 424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
424ACUUCGUGUUCGUGGUGUU78.7895378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
349442ACTTCGTGTTCGTGGTGTTAACACCACGAACACGAAGT0.021200.001900.560300.750001.000001.00000


Target Position: 2181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181AAAAAAAAAAAAAAAAAAA83.5835188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3142199AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.999100.500000.500001.000001.00000


Target Position: 583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
583UCAAGCUGGGCAACCUUUU59.77661435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
346601TCAAGCTGGGCAACCTTTTAAAAGGTTGCCCAGCTTGA0.105400.001800.724100.750000.940200.62500


Target Position: 1110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1110GAGCGUCCCCGGGAAAAAG66.22931043

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2981128GAGCGTCCCCGGGAAAAAGCTTTTTCCCGGGGACGCTC0.211200.036000.672400.500000.972801.00000


Target Position: 2128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2128CCUUUCCUUGGCUUUAUGC56.46781610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3662146CCTTTCCTTGGCTTTATGCGCATAAAGCCAAGGAAAGG0.016300.005200.491400.500001.000001.00000


Target Position: 616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
616UGGAGGUGAAAAUAGGGGA70.7296776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364634TGGAGGTGAAAATAGGGGATCCCCTATTTTCACCTCCA0.066900.002600.474100.500001.000001.00000


Target Position: 901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
901AGAAGAUGCUUCAGACAGA92.888732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
305919AGAAGATGCTTCAGACAGATCTGTCTGAAGCATCTTCT0.082400.005700.500000.500000.934800.62500


Target Position: 1111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1111AGCGUCCCCGGGAAAAAGA65.67511072

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3721129AGCGTCCCCGGGAAAAAGATCTTTTTCCCGGGGACGCT0.302000.043000.629300.500000.972801.00000


Target Position: 1349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1349GGGGGUGCUCUUCAAUGAC72.3057693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3501367GGGGGTGCTCTTCAATGACGTCATTGAAGAGCACCCCC0.253800.001800.672400.750001.000001.00000


Target Position: 1395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1395GGUGACAGCCUGCAGUACA90.446557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921413GGTGACAGCCTGCAGTACATGTACTGCAGGCTGTCACC0.326300.018700.646600.750001.000001.00000


Target Position: 712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
712CCGAGGUGCUGAGCAAGAA87.164799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
309730CCGAGGTGCTGAGCAAGAATTCTTGCTCAGCACCTCGG0.292000.003200.741401.000000.983701.00000


Target Position: 1393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1393AUGGUGACAGCCUGCAGUA81.2994263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3671411ATGGTGACAGCCTGCAGTATACTGCAGGCTGTCACCAT0.229200.004400.474100.500000.972800.75000


Target Position: 422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
422CGACUUCGUGUUCGUGGUG68.2078934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
367440CGACTTCGTGTTCGTGGTGCACCACGAACACGAAGTCG0.027200.001200.500000.750000.994600.62500


Target Position: 539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
539UGGCUGCCAGUACCUGCAC54.0591717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327557TGGCTGCCAGTACCTGCACGTGCAGGTACTGGCAGCCA0.029700.002500.551700.500000.902200.62500


Target Position: 770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
770UAUCAUGUAUACCUUGUUA89.419167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
343788TATCATGTATACCTTGTTATAACAAGGTATACATGATA0.023100.009500.508600.500001.000001.00000


Target Position: 2113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2113UGAAUUCGGAACUGUCCUU70.1096815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3162131TGAATTCGGAACTGTCCTTAAGGACAGTTCCGAATTCA0.138700.002900.586200.750000.907600.75000


Target Position: 844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844AGAAGAAUGAAUACAGUAU87.802787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
211862AGAAGAATGAATACAGTATATACTGTATTCATTCTTCT0.248200.078600.681000.750001.000001.00000


Target Position: 1486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1486UCCUUAAAUAUUUCCGCAA73.5189625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1861504TCCTTAAATATTTCCGCAATTGCGGAAATATTTAAGGA0.320400.192100.724100.750001.000001.00000


Target Position: 1352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1352GGUGCUCUUCAAUGACUCA95.772515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1911370GGTGCTCTTCAATGACTCATGAGTCATTGAAGAGCACC0.250800.025700.629300.750001.000001.00000


Target Position: 2076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2076UCAACCCCACCAUAUGAAU67.7314964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1632094TCAACCCCACCATATGAATATTCATATGGTGGGGTTGA0.183100.154600.715500.750001.000001.00000


Target Position: 2084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2084ACCAUAUGAAUUGUACAGA75.3594526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3572102ACCATATGAATTGTACAGATCTGTACAATTCATATGGT0.111500.081000.629300.500001.000001.00000


Target Position: 1297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1297UGGACUAUUCGGACAAGUA87.999884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2041315TGGACTATTCGGACAAGTATACTTGTCCGAATAGTCCA0.205700.029200.663800.750001.000001.00000


Target Position: 2162, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2162GAAUAUUCAAAAAAAAAAA93.133530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1332180GAATATTCAAAAAAAAAAATTTTTTTTTTTGAATATTC0.972200.095700.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2160-2182GTGAATATTCAAAAAAAAAAAAAUUUUUUUUUUUGAAUAUUCACGAAUAUUCAAAAAAAAAAAAAU-11.31.801


Target Position: 907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
907UGCUUCAGACAGAUCCCAC65.53611083

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
250925TGCTTCAGACAGATCCCACGTGGGATCTGTCTGAAGCA0.166400.053700.560300.500001.000001.00000


Target Position: 687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
687UGUGGGACUCCUAAUUACA83.1967201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
311705TGTGGGACTCCTAATTACATGTAATTAGGAGTCCCACA0.120400.005800.500000.500000.962000.87500


Target Position: 552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
552CUGCACCGAAACCGAGUUA76.0825495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
300570CTGCACCGAAACCGAGTTATAACTCGGTTTCGGTGCAG0.039000.003600.750000.750000.967400.75000


Target Position: 1934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1934CUCCCGCGGUGCCAUGUCU69.4209859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3641952CTCCCGCGGTGCCATGTCTAGACATGGCACCGCGGGAG0.043900.001300.586200.500001.000001.00000


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975GGCUAUAUCCCUGCCCGUC64.50171146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190993GGCTATATCCCTGCCCGTCGACGGGCAGGGATATAGCC0.163000.075000.681000.750000.902200.62500


Target Position: 837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
837CGGAUCAAGAAGAAUGAAU81.5283253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
235855CGGATCAAGAAGAATGAATATTCATTCTTCTTGATCCG0.087300.021300.905201.000001.000001.00000


Target Position: 2099, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2099CAGAAUAUUUCUAUUGAAU91.315450

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2097-2119TACAGAATATTTCTATTGAATTCAUUCAAUAGAAAUAUUCUGUACAGAAUAUUUCUAUUGAAUUCU8.96.621


Target Position: 2089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2089AUGAAUUGUACAGAAUAUU71.1297755

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2562107ATGAATTGTACAGAATATTAATATTCTGTACAATTCAT0.066000.036500.646600.500001.000001.00000


Target Position: 2075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2075CUCAACCCCACCAUAUGAA79.5377347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1872093CTCAACCCCACCATATGAATTCATATGGTGGGGTTGAG0.196100.164300.637900.750001.000001.00000


Target Position: 713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
713CGAGGUGCUGAGCAAGAAA94.384120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
293731CGAGGTGCTGAGCAAGAAATTTCTTGCTCAGCACCTCG0.272300.004100.793101.000000.983701.00000


Target Position: 423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
423GACUUCGUGUUCGUGGUGU70.7486774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327441GACTTCGTGTTCGTGGTGTACACCACGAACACGAAGTC0.033400.003600.612100.500001.000001.00000


Target Position: 2169, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2169CAAAAAAAAAAAAAAAAAA86.7759106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1612187CAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTG0.999200.957100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2167-2189TTCAAAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUUUGAACAAAAAAAAAAAAAAAAAAAAU-11.3-11.300


Target Position: 961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
961AGUUCUUUACUUCUGGCUA85.4531131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
314979AGTTCTTTACTTCTGGCTATAGCCAGAAGTAAAGAACT0.032700.006000.534500.750001.000001.00000


Target Position: 984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
984CCUGCCCGUCUCCCCAUCA73.0471650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2051002CCTGCCCGTCTCCCCATCATGATGGGGAGACGGGCAGG0.455700.093400.620700.750001.000001.00000


Target Position: 2070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2070UCCCCCUCAACCCCACCAU52.12191812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1932088TCCCCCTCAACCCCACCATATGGTGGGGTTGAGGGGGA0.717100.414400.715500.750001.000001.00000


Target Position: 1400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1400CAGCCUGCAGUACAUAGAG75.9475501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3631418CAGCCTGCAGTACATAGAGCTCTATGTACTGCAGGCTG0.036300.006600.474100.500001.000001.00000


Target Position: 1703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1703GACCUACAUCGACGAGAAG76.6136464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3261721GACCTACATCGACGAGAAGCTTCTCGTCGATGTAGGTC0.028500.010600.681000.500001.000001.00000


Target Position: 1394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1394UGGUGACAGCCUGCAGUAC63.16071243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3711412TGGTGACAGCCTGCAGTACGTACTGCAGGCTGTCACCA0.305800.011300.663800.500000.972800.75000


Target Position: 1794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1794CGCUACGCCCGCACUAUGG59.34141463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3661812CGCTACGCCCGCACTATGGCCATAGTGCGGGCGTAGCG0.025200.001300.577600.500000.934800.75000


Target Position: 1355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1355GCUCUUCAAUGACUCAACA91.740741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1691373GCTCTTCAATGACTCAACATGTTGAGTCATTGAAGAGC0.183100.060600.646600.750001.000001.00000


Target Position: 908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
908GCUUCAGACAGAUCCCACU83.0161204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
213926GCTTCAGACAGATCCCACTAGTGGGATCTGTCTGAAGC0.174900.050900.646600.750001.000001.00000


Target Position: 1119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1119CGGGAAAAAGAAGAACCAG70.5322791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3031137CGGGAAAAAGAAGAACCAGCTGGTTCTTCTTTTTCCCG0.039500.003400.629300.750001.000001.00000


Target Position: 1189, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1189AGCAGCUGCACAGUGUCAA77.9947406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1861207AGCAGCTGCACAGTGTCAATTGACACTGTGCAGCTGCT0.172100.016700.706900.750000.972800.75000


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768UGUAUCAUGUAUACCUUGU70.9805762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
354786TGTATCATGTATACCTTGTACAAGGTATACATGATACA0.019900.005900.500000.500000.956500.62500


Target Position: 2183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2183AAAAAAAAAAAAAAAAAAA83.5835190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3342201AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.999200.500000.500001.000001.00000


Target Position: 1480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1480UCACCCUCCUUAAAUAUUU69.9901827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1941498TCACCCTCCTTAAATATTTAAATATTTAAGGAGGGTGA0.731300.371600.724100.750001.000001.00000


Target Position: 553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
553UGCACCGAAACCGAGUUAU60.76771387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
290571TGCACCGAAACCGAGTTATATAACTCGGTTTCGGTGCA0.039700.004500.810300.750000.967400.75000


Target Position: 555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
555CACCGAAACCGAGUUAUUC70.5108795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
349573CACCGAAACCGAGTTATTCGAATAACTCGGTTTCGGTG0.050500.007900.620700.500000.967400.62500


Target Position: 595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
595ACCUUUUCCUGAAUGAAGA77.7567416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
369613ACCTTTTCCTGAATGAAGATCTTCATTCAGGAAAAGGT0.146100.002800.629300.500001.000001.00000


Target Position: 1839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1839GCCAGCAACCGUCUCAAGG58.45171505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3351857GCCAGCAACCGTCTCAAGGCCTTGAGACGGTTGCTGGC0.055100.002200.655200.500001.000001.00000


Target Position: 383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
383CCAGCACGUCGUAGGAUUC71.3068741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
351401CCAGCACGTCGTAGGATTCGAATCCTACGACGTGCTGG0.020600.001900.672400.750001.000001.00000


Target Position: 829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
829CCUACCUCCGGAUCAAGAA83.0082205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185847CCTACCTCCGGATCAAGAATTCTTGATCCGGAGGTAGG0.146100.024700.672401.000000.962000.62500


Target Position: 859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
859GUAUUCCCAAGCACAUCAA85.8976123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
275877GTATTCCCAAGCACATCAATTGATGTGCTTGGGAATAC0.224700.051900.534500.750001.000001.00000


Target Position: 2100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2100AGAAUAUUUCUAUUGAAUU84.6567147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2322118AGAATATTTCTATTGAATTAATTCAATAGAAATATTCT0.091800.020800.715500.750001.000001.00000


Target Position: 485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
485GAGGAAAGCCCUGACUGAG74.7306563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
370503GAGGAAAGCCCTGACTGAGCTCAGTCAGGGCTTTCCTC0.027200.001100.500000.500000.929300.62500


Target Position: 926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926UGCCCGCCCAACCAUUAAC51.9391820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
257944TGCCCGCCCAACCATTAACGTTAATGGTTGGGCGGGCA0.390400.272300.706900.500001.000001.00000


Target Position: 2022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2022AGUUAUUUUUGUACAUGUU84.0298166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2522040AGTTATTTTTGTACATGTTAACATGTACAAAAATAACT0.313500.190400.560300.750001.000001.00000


Target Position: 1475, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1475GAAGAUCACCCUCCUUAAA92.331735

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1473-1495AAGAAGATCACCCTCCTTAAATAUUUAAGGAGGGUGAUCUUCUUGAAGAUCACCCUCCUUAAAUAU19.920.413


Target Position: 2016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2016UGUGUAAGUUAUUUUUGUA91.730942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2842034TGTGTAAGTTATTTTTGTATACAAAAATAACTTACACA0.250200.025300.525900.750001.000001.00000


Target Position: 1888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1888GGUGCCCUCCUCACUCCCA80.8978282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2971906GGTGCCCTCCTCACTCCCATGGGAGTGAGGAGGGCACC0.327200.021800.508600.750000.967400.62500


Target Position: 760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
760CCAUUGGGUGUAUCAUGUA92.348234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
268778CCATTGGGTGTATCATGTATACATGATACACCCAATGG0.054300.005500.663801.000001.000001.00000


Target Position: 2163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2163AAUAUUCAAAAAAAAAAAA80.5619295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2912181AATATTCAAAAAAAAAAAATTTTTTTTTTTTGAATATT0.988100.118100.508600.500001.000001.00000


Target Position: 792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792GGCAAACCACCUUUUGAGA83.6602174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
189810GGCAAACCACCTTTTGAGATCTCAAAAGGTGGTTTGCC0.438500.101400.775900.750000.967400.62500


Target Position: 1070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1070CCUCACAGUCCUCAAUAAA90.065865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1871088CCTCACAGTCCTCAATAAATTTATTGAGGACTGTGAGG0.145000.066300.844801.000001.000001.00000


Target Position: 938, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
938CAUUAACGAGCUGCUUAAU81.7932243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
230956CATTAACGAGCTGCTTAATATTAAGCAGCTCGTTAATG0.093000.010700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
936-958ACCATTAACGAGCTGCTTAATGAAUUAAGCAGCUCGUUAAUGGUCAUUAACGAGCUGCUUAAUGAU19.76.923


Target Position: 1241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1241GCAAGAGGAGGCUGAGGAU86.3261113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2531259GCAAGAGGAGGCTGAGGATATCCTCAGCCTCCTCTTGC0.068100.019600.672401.000001.000001.00000


Target Position: 759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
759UCCAUUGGGUGUAUCAUGU66.30441038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
339777TCCATTGGGTGTATCATGTACATGATACACCCAATGGA0.044200.004100.663800.500001.000001.00000


Target Position: 155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
155UCCACCGGCGAAAGAGAUC47.01842003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
288173TCCACCGGCGAAAGAGATCGATCTCTTTCGCCGGTGGA0.196600.005300.689700.500001.000001.00000


Target Position: 623, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
623GAAAAUAGGGGAUUUUGGA83.1013202

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
621-643GTGAAAATAGGGGATTTTGGACTUCCAAAAUCCCCUAUUUUCACGAAAAUAGGGGAUUUUGGACUU11.3-4.322


Target Position: 957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
957GACGAGUUCUUUACUUCUG75.34527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
350975GACGAGTTCTTTACTTCTGCAGAAGTAAAGAACTCGTC0.033700.001900.534500.500001.000001.00000


Target Position: 646, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
646CAACCAAAGUCGAAUAUGA96.874411

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
644-666GGCAACCAAAGTCGAATATGACGUCAUAUUCGACUUUGGUUGCCCAACCAAAGUCGAAUAUGACGU8.718.802


Target Position: 1611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1611GCCAUCAUCCUGCACCUCA81.8599238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3191629GCCATCATCCTGCACCTCATGAGGTGCAGGATGATGGC0.030500.015000.775900.750001.000001.00000


Target Position: 1298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1298GGACUAUUCGGACAAGUAC79.2114363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2751316GGACTATTCGGACAAGTACGTACTTGTCCGAATAGTCC0.048500.018800.689700.750001.000001.00000


Target Position: 1304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1304UUCGGACAAGUACGGCCUU57.911534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3101322TTCGGACAAGTACGGCCTTAAGGCCGTACTTGTCCGAA0.039200.006000.534500.500000.945700.62500


Target Position: 836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
836CCGGAUCAAGAAGAAUGAA85.0955140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
242854CCGGATCAAGAAGAATGAATTCATTCTTCTTGATCCGG0.079000.014100.741401.000001.000001.00000


Target Position: 989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
989CCGUCUCCCCAUCACCUGC58.41371506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2781007CCGTCTCCCCATCACCTGCGCAGGTGATGGGGAGACGG0.209800.102900.560300.500001.000001.00000


Target Position: 1403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1403CCUGCAGUACAUAGAGCGU77.7868414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3701421CCTGCAGTACATAGAGCGTACGCTCTATGTACTGCAGG0.013900.006100.569000.750000.972800.62500


Target Position: 1892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1892CCCUCCUCACUCCCACCUG59.62481444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2031910CCCTCCTCACTCCCACCTGCAGGTGGGAGTGAGGAGGG0.153800.104900.706900.750001.000001.00000


Target Position: 607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
607AUGAAGAUCUGGAGGUGAA86.5294109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364625ATGAAGATCTGGAGGTGAATTCACCTCCAGATCTTCAT0.184300.062600.482800.500001.000001.00000


Target Position: 765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
765GGGUGUAUCAUGUAUACCU91.013854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
374783GGGTGTATCATGTATACCTAGGTATACATGATACACCC0.016200.001100.646600.750000.956500.75000


Target Position: 1396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1396GUGACAGCCUGCAGUACAU89.007372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1861414GTGACAGCCTGCAGTACATATGTACTGCAGGCTGTCAC0.340700.060100.637900.750001.000001.00000


Target Position: 925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
925CUGCCCGCCCAACCAUUAA73.9754597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
162943CTGCCCGCCCAACCATTAATTAATGGTTGGGCGGGCAG0.468200.236800.750000.750001.000001.00000


Target Position: 1733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1733CACAUACCGCCUGAGUCUC64.1311174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3651751CACATACCGCCTGAGTCTCGAGACTCAGGCGGTATGTG0.034000.001300.482800.500001.000001.00000


Target Position: 2085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2085CCAUAUGAAUUGUACAGAA101.5352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2182103CCATATGAATTGTACAGAATTCTGTACAATTCATATGG0.104800.071000.672401.000001.000001.00000


Target Position: 1479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1479AUCACCCUCCUUAAAUAUU67.9341950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2341497ATCACCCTCCTTAAATATTAATATTTAAGGAGGGTGAT0.631400.263400.672400.500001.000001.00000


Target Position: 883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
883UGGCCGCCUCCCUCAUCCA70.3494806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
323901TGGCCGCCTCCCTCATCCATGGATGAGGGAGGCGGCCA0.317900.077000.500000.500000.945700.75000


Target Position: 663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
663GACGGGGAGAGGAAGAAGA82.5399216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
289681GACGGGGAGAGGAAGAAGATCTTCTTCCTCTCCCCGTC0.782900.026700.594800.500001.000001.00000


Target Position: 761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
761CAUUGGGUGUAUCAUGUAU91.148853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
272779CATTGGGTGTATCATGTATATACATGATACACCCAATG0.061900.005100.612100.750001.000001.00000


Target Position: 503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
503GCCUGAGGCCCGAUACUAC77.2402438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
290521GCCTGAGGCCCGATACTACGTAGTATCGGGCCTCAGGC0.155900.004200.819000.750000.929300.62500


Target Position: 1464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1464UCCUUGAUGAAGAAGAUCA77.724418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2371482TCCTTGATGAAGAAGATCATGATCTTCTTCATCAAGGA0.129600.020100.646600.500000.978300.62500


Target Position: 2158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2158AUGUGAAUAUUCAAAAAAA93.725123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3552176ATGTGAATATTCAAAAAAATTTTTTTGAATATTCACAT0.283000.001600.655200.500001.000001.00000


Target Position: 688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
688GUGGGACUCCUAAUUACAU86.6214107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
253706GTGGGACTCCTAATTACATATGTAATTAGGAGTCCCAC0.264700.006300.637900.750000.962000.75000


Target Position: 1240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240GGCAAGAGGAGGCUGAGGA80.5852292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2651258GGCAAGAGGAGGCTGAGGATCCTCAGCCTCCTCTTGCC0.274300.005700.629300.750001.000001.00000


Target Position: 2048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2048GGGUUCUACAGCCUUGUCC62.31821297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2822066GGGTTCTACAGCCTTGTCCGGACAAGGCTGTAGAACCC0.186900.093200.620700.500001.000001.00000


Target Position: 1005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1005UGCCUGACCAUUCCACCAA73.404635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1941023TGCCTGACCATTCCACCAATTGGTGGAATGGTCAGGCA0.185200.015500.706900.750001.000001.00000


Target Position: 645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
645GCAACCAAAGUCGAAUAUG67.6483973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
325663GCAACCAAAGTCGAATATGCATATTCGACTTTGGTTGC0.039600.002600.698300.750000.907600.62500


Target Position: 292, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
292CGGGCAAGAUUGUGCCUAA97.43459

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_629219CGGGCAAGATTGTGCCTAA1/0/1/093.35PLK1NM_005030.31NANANANA00PLK1(0.002)


Target Position: 2017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2017GUGUAAGUUAUUUUUGUAC72.0824707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3202035GTGTAAGTTATTTTTGTACGTACAAAAATAACTTACAC0.249600.072800.612100.500001.000001.00000


Target Position: 2023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2023GUUAUUUUUGUACAUGUUC64.78561130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3602041GTTATTTTTGTACATGTTCGAACATGTACAAAAATAAC0.307500.201700.474100.500001.000001.00000


Target Position: 762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
762AUUGGGUGUAUCAUGUAUA85.8936124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
371780ATTGGGTGTATCATGTATATATACATGATACACCCAAT0.071100.003200.465500.500001.000001.00000


Target Position: 1350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1350GGGGUGCUCUUCAAUGACU83.2883199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2461368GGGGTGCTCTTCAATGACTAGTCATTGAAGAGCACCCC0.252800.007600.784500.750001.000001.00000


Target Position: 2012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2012UUGCUGUGUAAGUUAUUUU70.4238799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2822030TTGCTGTGTAAGTTATTTTAAAATAACTTACACAGCAA0.321700.004500.646600.500001.000001.00000


Target Position: 2173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2173AAAAAAAAAAAAAAAAAAA83.5835180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3582191AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999600.996700.500000.500001.000001.00000


Target Position: 1489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1489UUAAAUAUUUCCGCAAUUA74.8231552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3661507TTAAATATTTCCGCAATTATAATTGCGGAAATATTTAA0.240000.235400.500000.500001.000001.00000


Target Position: 1069, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1069CCCUCACAGUCCUCAAUAA97.67387

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1106919CCCTCACAGTCCTCAATAA1/0/1/0100.00PLK1NM_005030.31NANANA16:23695390..23695408(+)00PLK1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1691087CCCTCACAGTCCTCAATAATTATTGAGGACTGTGAGGG0.176900.133200.956901.000001.000001.00000


Target Position: 2124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2124CUGUCCUUUCCUUGGCUUU69.6006850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2382142CTGTCCTTTCCTTGGCTTTAAAGCCAAGGAAAGGACAG0.159900.008400.784500.750000.994601.00000


Target Position: 1648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1648UCAACUUCUUCCAGGAUCA78.4177393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3311666TCAACTTCTTCCAGGATCATGATCCTGGAAGAAGTTGA0.086400.065300.500000.500001.000001.00000


Target Position: 839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
839GAUCAAGAAGAAUGAAUAC82.12228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
324857GATCAAGAAGAATGAATACGTATTCATTCTTCTTGATC0.272500.062700.500000.500001.000001.00000


Target Position: 1392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1392GAUGGUGACAGCCUGCAGU79.2716359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3581410GATGGTGACAGCCTGCAGTACTGCAGGCTGTCACCATC0.207700.001900.474100.500000.972800.87500


Target Position: 982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
982UCCCUGCCCGUCUCCCCAU56.56831605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1391000TCCCTGCCCGTCTCCCCATATGGGGAGACGGGCAGGGA0.438400.116300.715500.750001.000001.00000


Target Position: 1453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1453CCCAUCCCAACUCCUUGAU63.82311195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2761471CCCATCCCAACTCCTTGATATCAAGGAGTTGGGATGGG0.047900.032600.810301.000000.994600.62500


Target Position: 630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
630GGGGAUUUUGGACUGGCAA84.054165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
280648GGGGATTTTGGACTGGCAATTGCCAGTCCAAAATCCCC0.834600.004700.844801.000001.000001.00000


Target Position: 1354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1354UGCUCUUCAAUGACUCAAC64.8521125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3621372TGCTCTTCAATGACTCAACGTTGAGTCATTGAAGAGCA0.180900.051100.706900.500001.000001.00000


Target Position: 1112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1112GCGUCCCCGGGAAAAAGAA78.0083405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1291130GCGTCCCCGGGAAAAAGAATTCTTTTTCCCGGGGACGC0.790000.049400.750001.000000.972800.87500


Target Position: 246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
246GCCAAGUGCUUCGAGAUCU75.7938511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
358264GCCAAGTGCTTCGAGATCTAGATCTCGAAGCACTTGGC0.017400.006500.775900.750001.000001.00000


Target Position: 1399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1399ACAGCCUGCAGUACAUAGA77.1819442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3531417ACAGCCTGCAGTACATAGATCTATGTACTGCAGGCTGT0.076300.017200.482800.500001.000001.00000


Target Position: 1660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1660AGGAUCACACCAAGCUCAU75.0135540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2211678AGGATCACACCAAGCTCATATGAGCTTGGTGTGATCCT0.102500.011200.689700.750000.962000.75000


Target Position: 767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767GUGUAUCAUGUAUACCUUG77.6521423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
355785GTGTATCATGTATACCTTGCAAGGTATACATGATACAC0.018300.004100.646600.500000.956500.75000


Target Position: 850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
850AUGAAUACAGUAUUCCCAA84.0686164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
308868ATGAATACAGTATTCCCAATTGGGAATACTGTATTCAT0.256000.139200.508600.500000.934800.75000


Target Position: 711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
711CCCGAGGUGCUGAGCAAGA76.3276479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
371729CCCGAGGTGCTGAGCAAGATCTTGCTCAGCACCTCGGG0.258800.001100.767200.750000.983700.87500


Target Position: 2178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2178AAAAAAAAAAAAAAAAAAA83.5835185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3182196AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.999000.500000.500001.000001.00000


Target Position: 557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
557CCGAAACCGAGUUAUUCAU77.7263417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
258575CCGAAACCGAGTTATTCATATGAATAACTCGGTTTCGG0.064900.011800.758601.000001.000001.00000


Target Position: 2177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2177AAAAAAAAAAAAAAAAAAA83.5835184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3682195AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999700.998800.500000.500001.000001.00000


Target Position: 1663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1663AUCACACCAAGCUCAUCUU73.8317606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3561681ATCACACCAAGCTCATCTTAAGATGAGCTTGGTGTGAT0.030500.015600.543100.500001.000001.00000


Target Position: 1891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1891GCCCUCCUCACUCCCACCU59.06771479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1961909GCCCTCCTCACTCCCACCTAGGTGGGAGTGAGGAGGGC0.409100.203600.655200.750001.000001.00000


Target Position: 589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
589UGGGCAACCUUUUCCUGAA81.6992246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
325607TGGGCAACCTTTTCCTGAATTCAGGAAAAGGTTGCCCA0.028900.002800.672400.750000.989100.75000


Target Position: 1118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1118CCGGGAAAAAGAAGAACCA80.4657301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3121136CCGGGAAAAAGAAGAACCATGGTTCTTCTTTTTCCCGG0.057200.003100.569000.750001.000001.00000


Target Position: 2058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2058GCCUUGUCCCCCUCCCCCU62.45211286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2092076GCCTTGTCCCCCTCCCCCTAGGGGGAGGGGGACAAGGC0.416000.189600.655200.750001.000001.00000


Target Position: 2166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2166AUUCAAAAAAAAAAAAAAA78.1748400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2922184ATTCAAAAAAAAAAAAAAATTTTTTTTTTTTTTTGAAT0.997900.291000.508600.500001.000001.00000


Target Position: 244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
244UUGCCAAGUGCUUCGAGAU70.221811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
375262TTGCCAAGTGCTTCGAGATATCTCGAAGCACTTGGCAA0.023900.001100.465500.500000.967400.75000


Target Position: 596, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
596CCUUUUCCUGAAUGAAGAU80.9435276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
320614CCTTTTCCTGAATGAAGATATCTTCATTCAGGAAAAGG0.148400.002800.663801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
594-616AACCTTTTCCTGAATGAAGATCTAUCUUCAUUCAGGAAAAGGUUCCUUUUCCUGAAUGAAGAUCUU20.418.722


Target Position: 692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
692GACUCCUAAUUACAUAGCU83.6798172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
368710GACTCCTAATTACATAGCTAGCTATGTAATTAGGAGTC0.126000.008000.465500.500000.967400.75000


Target Position: 1893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1893CCUCCUCACUCCCACCUGC62.05711313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3431911CCTCCTCACTCCCACCTGCGCAGGTGGGAGTGAGGAGG0.144100.148500.491400.500001.000001.00000


Target Position: 629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
629AGGGGAUUUUGGACUGGCA82.677212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342647AGGGGATTTTGGACTGGCATGCCAGTCCAAAATCCCCT0.026200.004000.491400.500001.000001.00000


Target Position: 962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
962GUUCUUUACUUCUGGCUAU84.907145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
310980GTTCTTTACTTCTGGCTATATAGCCAGAAGTAAAGAAC0.033500.006100.603400.750001.000001.00000


Target Position: 2126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2126GUCCUUUCCUUGGCUUUAU73.4414632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2472144GTCCTTTCCTTGGCTTTATATAAAGCCAAGGAAAGGAC0.125100.007500.775900.750000.994600.75000


Target Position: 922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
922CCACUGCCCGCCCAACCAU70.6732778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
110940CCACTGCCCGCCCAACCATATGGTTGGGCGGGCAGTGG0.601200.132300.689701.000001.000001.00000


Target Position: 644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
644GGCAACCAAAGUCGAAUAU74.948544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
341662GGCAACCAAAGTCGAATATATATTCGACTTTGGTTGCC0.023800.002200.956901.000000.907600.75000


Target Position: 1857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1857GCCUCCUAAUAGCUGCCCU73.3385637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2501875GCCTCCTAATAGCTGCCCTAGGGCAGCTATTAGGAGGC0.072600.065800.655200.750000.940200.62500


Target Position: 611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
611AGAUCUGGAGGUGAAAAUA89.029671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176629AGATCTGGAGGTGAAAATATATTTTCACCTCCAGATCT0.164600.027000.681000.750001.000001.00000


Target Position: 2059, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2059CCUUGUCCCCCUCCCCCUC52.61792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2732077CCTTGTCCCCCTCCCCCTCGAGGGGGAGGGGGACAAGG0.434500.210900.534500.750001.000001.00000