Input target sequence

Length: 1926
GTGGATGAGCTGTGAGTGCGCGCGCGTGCGCGGGGCCGCGACCTGTGCCGGCTCGAGCCCGCTGGGCACTCGGAGGCGCGCACGTCGTTCCCCGCCCTCCCGCCGCCGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGGTTCTCTCGTTAGTCCACGGTCTGGTCTTCAGCTACCCGCCTTCGTCTCCGAGTTTGCGACTCGCGGACCGGCGTCCCCGGCGCGAAGAGGCTGGACTCGGATTCGTTGCCTGAGCAATGGCTGCCATCCGGAAGAAACTGGTGATTGTTGGTGATGGAGCCTGTGGAAAGACATGCTTGCTCATAGTCTTCAGCAAGGACCAGTTCCCAGAGGTGTATGTGCCCACAGTGTTTGAGAACTATGTGGCAGATATCGAGGTGGATGGAAAGCAGGTAGAGTTGGCTTTGTGGGACACAGCTGGGCAGGAAGATTATGATCGCCTGAGGCCCCTCTCCTACCCAGATACCGATGTTATACTGATGTGTTTTTCCATCGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAGTGGACCCCAGAAGTCAAGCATTTCTGTCCCAACGTGCCCATCATCCTGGTTGGGAATAAGAAGGATCTTCGGAATGATGAGCACACAAGGCGGGAGCTAGCCAAGATGAAGCAGGAGCCGGTGAAACCTGAAGAAGGCAGAGATATGGCAAACAGGATTGGCGCTTTTGGGTACATGGAGTGTTCAGCAAAGACCAAAGATGGAGTGAGAGAGGTTTTTGAAATGGCTACGAGAGCTGCTCTGCAAGCTAGACGTGGGAAGAAAAAATCTGGGTGCCTTGTCTTGTGAAACCTTGCTGCAAGCACAGCCCTTATGCGGTTAATTTTGAAGTGCTGTTTATTAATCTTAGTGTATGATTACTGGCCTTTTTCATTTATCTATAATTTACCTAAGATTACAAATCAGAAGTCATCTTGCTACCAGTATTTAGAAGCCAACTATGATTATTAACGATGTCCAACCCGTCTGGCCCACCAGGGTCCTTTTGACACTGCTCTAACAGCCCTCCTCTGCACTCCCACCTGACACACCAGGCGCTAATTCAAGGAATTTCTTAACTTCTTGCTTCTTTCTAGAAAGAGAAACAGTTGGTAACTTTTGTGAATTAGGCTGTAACTACTTTATAACTAACATGTCCTGCCTATTATCTGTCAGCTGCAAGGTACTCTGGTGAGTCACCACTTCAGGGCTTTACTCCGTAACAGATTTTGTTGGCATAGCTCTGGGGTGGGCAGTTTTTTGAAAATGGGCTCAACCAGAAAAGCCCAAGTTCATGCAGCTGTGGCAGAGTTACAGTTCTGTGGTTTCATGTTAGTTACCTTATAGTTACTGTGTAATTAGTGCCACTTAATGTATGTTACCAAAAATAAATATATCTACCCCAGACTAGATGTAGTATTTTTTGTATAATTGGATTTCCTAATACTGTCATCCTCAAAGAAAGTGTATTGGTTTTTTAAAAAAGAAAGTGTATTTGGAAATAAAGTCAGATGGAAAATTCATTTTTTAAATTCCCGTTTTGTCACTTTTTCTGATAAAAGATGGCCATATTACCCCTTTTCGGCCCCATGTATCTCAGTACCCCATGGAGCTGGGCTAAGTAAATAGGAATTGGTTTCACGCCTGAGGCAATTAGACACTTTGGAAGATGGCATAACCTGTCTCACCTGGACTTAAGCATCTGGCTCTAATTCACAGTGCTCTTTTCTCCTCACTGTATCCAGGTTCCCTCCCAGAGGAGCCACCAGTTCTCATGGGTGGCACTCAGTCTCTCTTCTCTCCAGCTGACTAAACTTTTTTTCTGTACCAGTTAATTTTTCCAACTACTAATAGAATAAAGGCAGTTTTCTAAAAAAA