siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs, Sidirect 306   331   408   427   599   600   795   802   905   937   1012   1018   1049   1084   1233   1243   1254   1258   1328   1407  
1428   1429   1651   1905   1906   1921   2013   2374   2425   2428   2454   2455   2458   2464   2584   2591   2593   2632   2634   2643  
2647   2699   2707   2769   2779   2813   2826   2891   2935   2949   2950   3008   3016   3018   3019   3032   3043   3111   3286  
Biltr, Rnaxs 23   24   25   94   176   196   197   198   199   202   203   207   210   270   285   286   291   292   295   303  
323   325   326   329   330   338   339   344   345   346   348   349   367   368   369   370   377   378   379   380  
381   382   384   405   406   407   409   412   413   414   415   424   426   428   445   446   458   459   460   464  
465   466   488   489   490   491   493   522   561   563   564   565   566   586   587   588   589   590   591   592  
593   596   597   598   634   635   636   644   645   706   707   729   730   731   732   733   745   746   751   754  
755   756   757   758   766   773   776   777   779   780   781   783   784   787   790   791   794   809   810   811  
820   821   825   826   832   833   834   835   853   854   855   856   857   858   859   861   862   863   867   868  
869   881   882   883   884   885   889   890   891   892   893   894   895   896   898   899   903   904   906   907  
911   912   913   914   916   917   922   931   943   944   945   946   947   949   950   955   956   973   977   978  
979   982   985   986   996   999   1000   1003   1004   1005   1008   1009   1011   1013   1014   1015   1019   1020   1021   1023  
1024   1026   1027   1032   1033   1034   1044   1048   1052   1053   1073   1081   1082   1083   1085   1086   1089   1090   1091   1092  
1108   1110   1111   1112   1113   1114   1117   1118   1119   1125   1126   1163   1165   1166   1168   1182   1183   1187   1196   1197  
1198   1204   1205   1207   1217   1218   1219   1220   1221   1222   1223   1224   1225   1226   1227   1228   1242   1245   1246   1251  
1252   1253   1257   1259   1260   1277   1278   1279   1281   1284   1285   1286   1315   1316   1317   1318   1323   1324   1327   1366  
1367   1372   1373   1374   1388   1389   1399   1402   1406   1416   1417   1418   1419   1425   1426   1427   1431   1437   1438   1439  
1440   1444   1462   1463   1464   1465   1476   1480   1481   1494   1499   1500   1501   1502   1503   1504   1505   1506   1507   1508  
1509   1514   1518   1521   1527   1528   1535   1536   1537   1549   1568   1569   1570   1571   1572   1575   1580   1617   1623   1624  
1626   1627   1631   1632   1633   1635   1636   1637   1638   1639   1641   1642   1643   1644   1645   1646   1648   1650   1653   1682  
1683   1706   1707   1711   1713   1738   1739   1747   1752   1756   1757   1758   1759   1761   1765   1766   1780   1788   1814   1837  
1843   1844   1845   1846   1847   1848   1849   1852   1858   1859   1860   1864   1865   1866   1867   1868   1870   1871   1872   1873  
1875   1876   1877   1878   1894   1895   1896   1899   1900   1902   1904   1908   1914   1915   1916   1917   1918   1919   1925   1926  
1927   1998   2006   2007   2008   2009   2010   2012   2020   2023   2024   2042   2043   2044   2045   2046   2065   2066   2070   2077  
2078   2082   2083   2087   2088   2089   2091   2092   2093   2094   2098   2100   2101   2102   2103   2105   2106   2110   2111   2112  
2117   2118   2144   2146   2169   2170   2171   2172   2173   2174   2185   2228   2229   2230   2231   2232   2236   2238   2239   2244  
2254   2276   2277   2278   2279   2284   2290   2291   2293   2294   2295   2296   2315   2316   2317   2318   2319   2320   2321   2332  
2333   2359   2360   2362   2363   2366   2369   2370   2371   2372   2373   2402   2405   2406   2411   2412   2413   2414   2422   2423  
2424   2427   2430   2431   2432   2433   2451   2452   2453   2457   2461   2462   2463   2466   2468   2469   2489   2490   2491   2494  
2495   2496   2497   2502   2503   2505   2506   2507   2508   2511   2512   2536   2537   2538   2541   2542   2543   2572   2573   2574  
2575   2577   2578   2579   2583   2585   2589   2590   2592   2594   2596   2602   2603   2620   2628   2631   2633   2635   2636   2639  
2641   2646   2656   2657   2700   2702   2703   2704   2705   2706   2708   2709   2713   2723   2724   2727   2728   2730   2731   2732  
2733   2734   2735   2763   2768   2770   2771   2772   2777   2778   2780   2781   2783   2784   2791   2793   2798   2799   2800   2801  
2802   2803   2804   2807   2809   2814   2820   2825   2827   2831   2832   2833   2834   2836   2839   2840   2845   2846   2847   2888  
2890   2892   2895   2914   2915   2921   2924   2925   2934   2937   2938   2943   2946   2947   2948   2951   2954   2955   2956   2986  
2987   2991   2996   2997   3000   3003   3004   3005   3006   3007   3009   3010   3015   3017   3024   3025   3030   3031   3033   3037  
3038   3039   3067   3068   3076   3077   3078   3079   3081   3082   3085   3109   3110   3112   3136   3137   3139   3140   3209   3211  
3212   3213   3214   3216   3217   3218   3219   3222   3223   3224   3253   3259   3260   3270   3271   3282   3283   3284   3285   3287  
3290   3292   3293   3294   3295   3296   3297   3299   3338   3339   3344   3345   3347   3348  
Biltr, Sidirect 263   272   282   297   359   792   803   805   814   818   910   926   975   1007   1230   1232   1238   1241   1247   1264  
1267   1290   1325   1326   1400   1449   1450   1475   1478   1484   1486   1513   1565   1652   1725   1734   1850   1874   2177   2434  
2509   2565   2576   2640   2642   2710   2737   2739   2743   2749   2759   2782   2815   2887   2896   2939   3103   3298   3309   3319  
3332  


Target Position: 345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
345CAUCAGAUGCAUUGGACAA94.858696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
918363CATCAGATGCATTGGACAATTGTCCAATGCATCTGATG0.037600.005900.508600.750001.000001.00000


Target Position: 1449, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1449GCUUAGAACUCUUUACUGA95.227185

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1447-1469ATGCTTAGAACTCTTTACTGAACUCAGUAAAGAGUUCUAAGCAUGCUUAGAACUCUUUACUGAACU11.811.711


Target Position: 1110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1110AGGAGUACGGAGAAUUCUA91.0836221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8351128AGGAGTACGGAGAATTCTATAGAATTCTCCGTACTCCT0.100600.005600.672400.750001.000001.00000


Target Position: 1252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1252CAGAAAGAAAAAGAACAAC69.00342104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7791270CAGAAAGAAAAAGAACAACGTTGTTCTTTTTCTTTCTG0.062400.008900.637900.500001.000001.00000


Target Position: 777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777AGUACUUGGAGGAACGAAG69.43092062

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
914795AGTACTTGGAGGAACGAAGCTTCGTTCCTCCAAGTACT0.247300.022200.569000.500001.000001.00000


Target Position: 978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
978CUGAUGAGGAAGAAGAAAA88.8562314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313996CTGATGAGGAAGAAGAAAATTTTCTTCTTCCTCATCAG0.727600.217100.784500.750001.000001.00000


Target Position: 2802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2802UCCCUGUAGUUGACAAUUC60.91672763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7802820TCCCTGTAGTTGACAATTCGAATTGTCAACTACAGGGA0.078200.007200.698300.500001.000001.00000


Target Position: 198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
198AGGAAACCCAGACCCAAGA71.90161818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
761216AGGAAACCCAGACCCAAGATCTTGGGTCTGGGTTTCCT0.422600.033500.620700.500000.918500.62500


Target Position: 2412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2412CCUGUUCAGUACUCUACAA96.629955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4702430CCTGTTCAGTACTCTACAATTGTAGAGTACTGAACAGG0.442600.024400.698301.000001.000001.00000


Target Position: 1018, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1018GAAGAAGAAGAUUAAGGAA99.50918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9451036GAAGAAGAAGATTAAGGAATTCCTTAATCTTCTTCTTC0.507400.488100.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1016-1038AAGAAGAAGAAGATTAAGGAAAAUUCCUUAAUCUUCUUCUUCUUGAAGAAGAAGAUUAAGGAAAAU19.919.112


Target Position: 3347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3347UUAAUUCCUUGGCCUUAAA73.38411662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7403365TTAATTCCTTGGCCTTAAATTTAAGGCCAAGGAATTAA0.932000.106200.534500.500001.000001.00000


Target Position: 1224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1224GACGUGCUCCUUUUGAUCU78.88721137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9621242GACGTGCTCCTTTTGATCTAGATCAAAAGGAGCACGTC0.063200.043900.594800.500001.000001.00000


Target Position: 2921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2921GCAAAGUUAAAAGCCUACC56.85372971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9102939GCAAAGTTAAAAGCCTACCGGTAGGCTTTTAACTTTGC0.264100.061800.500000.500001.000001.00000


Target Position: 784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784GGAGGAACGAAGAAUAAAG82.7384753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
551802GGAGGAACGAAGAATAAAGCTTTATTCTTCGTTCCTCC0.250800.039800.732800.750001.000001.00000


Target Position: 892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892GGCUGAAGAAAAGGAAGAC72.69621728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
399910GGCTGAAGAAAAGGAAGACGTCTTCCTTTTCTTCAGCC0.803400.208400.681000.750001.000001.00000


Target Position: 1198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1198AUUCAGAGCCCUUCUAUUU74.65581538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9911216ATTCAGAGCCCTTCTATTTAAATAGAAGGGCTCTGAAT0.096400.002400.508600.500000.994600.75000


Target Position: 2799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2799CAUUCCCUGUAGUUGACAA95.43379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9472817CATTCCCTGTAGTTGACAATTGTCAACTACAGGGAATG0.032300.009700.508600.750001.000001.00000


Target Position: 2369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2369CGCAUGGAAGAAGUAGACU74.45741559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5102387CGCATGGAAGAAGTAGACTAGTCTACTTCTTCCATGCG0.318700.020900.715500.750001.000001.00000


Target Position: 586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
586CCAGUUCGGUGUUGGUUUU76.68141334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
630604CCAGTTCGGTGTTGGTTTTAAAACCAACACCGAACTGG0.208300.013800.844801.000001.000001.00000


Target Position: 2405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2405UGACUUACCUGUUCAGUAC71.59761844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9912423TGACTTACCTGTTCAGTACGTACTGAACAGGTAAGTCA0.095800.071700.543100.500000.940200.62500


Target Position: 3037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3037ACAGAUGAGUUAAAAGAUA90.1827250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9543055ACAGATGAGTTAAAAGATATATCTTTTAACTCATCTGT0.086100.003100.663800.750001.000001.00000


Target Position: 3270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3270GAGUUACAUGUGUUCUCUU92.2473164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7733288GAGTTACATGTGTTCTCTTAAGAGAACACATGTAACTC0.114400.007300.672400.750001.000001.00000


Target Position: 1627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1627CUACUGCACCAGAAUGAAG75.39421472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8971645CTACTGCACCAGAATGAAGCTTCATTCTGGTGCAGTAG0.040400.009900.534500.500001.000001.00000


Target Position: 2732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2732CUGAGCUGUAUCUUGAUGU73.77571627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7712750CTGAGCTGTATCTTGATGTACATCAAGATACAGCTCAG0.063700.020900.577600.500001.000001.00000


Target Position: 2706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2706AGACCAAAUCUUGUUAUUG71.92351816

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6432724AGACCAAATCTTGTTATTGCAATAACAAGATTTGGTCT0.229700.036000.577600.500001.000001.00000


Target Position: 2101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2101CCCUGACCAUUCCAUUAUU83.755659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2672119CCCTGACCATTCCATTATTAATAATGGAATGGTCAGGG0.254500.092700.982801.000001.000001.00000


Target Position: 1427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1427AGGAAGAAUUUGGUCAAAA85.8647508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4541445AGGAAGAATTTGGTCAAAATTTTGACCAAATTCTTCCT0.154900.049200.844800.750001.000001.00000


Target Position: 3032, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3032CAAAUACAGAUGAGUUAAA94.424107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7243050CAAATACAGATGAGTTAAATTTAACTCATCTGTATTTG0.073400.019900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3030-3052AACAAATACAGATGAGTTAAAAGUUUAACUCAUCUGUAUUUGUUCAAAUACAGAUGAGUUAAAAGU14.66.932


Target Position: 593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
593GGUGUUGGUUUUUAUUCUG76.70611331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
642611GGTGTTGGTTTTTATTCTGCAGAATAAAAACCAACACC0.271600.051300.569000.750001.000001.00000


Target Position: 894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
894CUGAAGAAAAGGAAGACAA87.6021389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
449912CTGAAGAAAAGGAAGACAATTGTCTTCCTTTTCTTCAG0.831900.768900.637900.750001.000001.00000


Target Position: 408, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
408GGAAAGAGCUGCAUAUUAA105.8441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
149426GGAAAGAGCTGCATATTAATTAATATGCAGCTCTTTCC0.804200.118600.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
406-428TGGGAAAGAGCTGCATATTAACCUUAAUAUGCAGCUCUUUCCCAGGAAAGAGCUGCAUAUUAACCU0.019.102


Target Position: 810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
810UGAAGAAACAUUCUCAGUU76.73991327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
699828TGAAGAAACATTCTCAGTTAACTGAGAATGTTTCTTCA0.077400.010700.577600.750000.956500.75000


Target Position: 826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
826GUUUAUUGGAUAUCCCAUU78.81281144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
951844GTTTATTGGATATCCCATTAATGGGATATCCAATAAAC0.037800.003200.637900.750000.918500.75000


Target Position: 458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
458ACUAUUGUGGAUACUGGAA82.2847796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
748476ACTATTGTGGATACTGGAATTCCAGTATCCACAATAGT0.286000.012000.534500.750001.000001.00000


Target Position: 2947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2947AUCGUAAAGCUGUUCAAAA84.5607608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6292965ATCGTAAAGCTGTTCAAAATTTTGAACAGCTTTACGAT0.529600.153000.681000.500001.000001.00000


Target Position: 2633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2633ACUGUAAGACGUAUGUAAC73.55121650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9292651ACTGTAAGACGTATGTAACGTTACATACGTCTTACAGT0.035200.025300.560300.500001.000001.00000


Target Position: 861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
861AGGAACGUGAUAAAGAAGU64.52132501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
574879AGGAACGTGATAAAGAAGTACTTCTTTATCACGTTCCT0.492000.143300.637900.500001.000001.00000


Target Position: 295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
295UACUUUCUACUCGAACAAA81.1858910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
942313TACTTTCTACTCGAACAAATTTGTTCGAGTAGAAAGTA0.161400.121400.681000.500000.989101.00000


Target Position: 2008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2008GACAGCAAACAUGGAGAGA80.9044942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9942026GACAGCAAACATGGAGAGATCTCTCCATGTTTGCTGTC0.073500.026700.594800.500001.000001.00000


Target Position: 780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
780ACUUGGAGGAACGAAGAAU74.44881561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
729798ACTTGGAGGAACGAAGAATATTCTTCGTTCCTCCAAGT0.266500.008900.698300.750001.000001.00000


Target Position: 2431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2431UUCCUCUGAUAAUAUAUUU72.35021774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7642449TTCCTCTGATAATATATTTAAATATATTATCAGAGGAA0.276900.007600.672400.500001.000001.00000


Target Position: 2254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2254CUACAGGAUGAUCAAACUU81.2175909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922272CTACAGGATGATCAAACTTAAGTTTGATCATCCTGTAG0.024600.006600.534500.750001.000001.00000


Target Position: 1478, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1478GAUAAAGAGAACUACAAGA94.0684120

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1476-1498AAGATAAAGAGAACTACAAGAAAUCUUGUAGUUCUCUUUAUCUUGAUAAAGAGAACUACAAGAAAU16.46.902


Target Position: 1501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1501CUAUGAGCAGUUCUCUAAA93.965126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7421519CTATGAGCAGTTCTCTAAATTTAGAGAACTGCTCATAG0.196800.008600.672400.750000.913001.00000


Target Position: 2279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2279GGUAUUGAUGAAGAUGACC67.4452250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8952297GGTATTGATGAAGATGACCGGTCATCTTCATCAATACC0.106900.019200.500000.500001.000001.00000


Target Position: 912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
912AAGAAGAAGAAAAAGAAAA83.4233688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
655930AAGAAGAAGAAAAAGAAAATTTTCTTTTTCTTCTTCTT0.994400.972700.637900.500001.000001.00000


Target Position: 2577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2577UAGUAAUGCUUUUUGAGUU79.35431091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9892595TAGTAATGCTTTTTGAGTTAACTCAAAAAGCATTACTA0.207900.046900.525900.500001.000001.00000


Target Position: 2735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2735AGCUGUAUCUUGAUGUUUA96.880451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8202753AGCTGTATCTTGATGTTTATAAACATCAAGATACAGCT0.056300.013600.819000.750001.000001.00000


Target Position: 895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
895UGAAGAAAAGGAAGACAAA87.918376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
359913TGAAGAAAAGGAAGACAAATTTGTCTTCCTTTTCTTCA0.849500.778700.724100.750001.000001.00000


Target Position: 1083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1083CCAGAAAUCCCGACGAUAU85.5796533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261101CCAGAAATCCCGACGATATATATCGTCGGGATTTCTGG0.122900.057100.801701.000000.956500.62500


Target Position: 1429, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1429GAAGAAUUUGGUCAAAAAA94.2515110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471447GAAGAATTTGGTCAAAAAATTTTTTGACCAAATTCTTC0.210700.089000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1427-1449AGGAAGAATTTGGTCAAAAAATGUUUUUUGACCAAAUUCUUCCUGAAGAAUUUGGUCAAAAAAUGU7.75.312


Target Position: 2832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2832GUCCUCUAGAAAUAGGUUA82.6679759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6922850GTCCTCTAGAAATAGGTTATAACCTATTTCTAGAGGAC0.187200.010400.784500.750000.918500.62500


Target Position: 1328, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1328GAAUAUCUGAACUUCAUUA100.89211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6831346GAATATCTGAACTTCATTATAATGAAGTTCAGATATTC0.081200.071500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1326-1348CTGAATATCTGAACTTCATTAGAUAAUGAAGUUCAGAUAUUCAGGAAUAUCUGAACUUCAUUAGAU12.06.603


Target Position: 3292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3292GUCCACGUUGUUUUGAUGU67.18162278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9783310GTCCACGTTGTTTTGATGTACATCAAAACAACGTGGAC0.150000.007700.612100.500001.000001.00000


Target Position: 2538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2538CUAAGUGAUGCUGUGAUAC69.01272103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732556CTAAGTGATGCTGTGATACGTATCACAGCATCACTTAG0.097100.005200.491400.500001.000001.00000


Target Position: 2469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2469UUUUUGUUAAUAUUAAAAA74.88021517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9132487TTTTTGTTAATATTAAAAATTTTTAATATTAACAAAAA0.281700.099100.500000.500001.000001.00000


Target Position: 2077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2077AGCAAAGAAACACCUGGAG61.69662705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7722095AGCAAAGAAACACCTGGAGCTCCAGGTGTTTCTTTGCT0.203700.210000.543100.500001.000001.00000


Target Position: 2914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2914UGGAGGAGCAAAGUUAAAA78.30551183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9962932TGGAGGAGCAAAGTTAAAATTTTAACTTTGCTCCTCCA0.514600.002400.844800.750001.000001.00000


Target Position: 2228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2228GAUCCCCAGACACAUGCUA84.8604585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9262246GATCCCCAGACACATGCTATAGCATGTGTCTGGGGATC0.104700.003800.508600.750001.000001.00000


Target Position: 1876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1876AGAGAAAAAAACAAAGUUU81.4952884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711894AGAGAAAAAAACAAAGTTTAAACTTTGTTTTTTTCTCT0.212900.158800.724100.750001.000001.00000


Target Position: 821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
821UCUCAGUUUAUUGGAUAUC53.62793104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
904839TCTCAGTTTATTGGATATCGATATCCAATAAACTGAGA0.059200.013900.543100.500001.000001.00000


Target Position: 1734, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1734GCUUAGAAGUGAUCUAUAU96.113962

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1732-1754TGGCTTAGAAGTGATCTATATGAAUAUAGAUCACUUCUAAGCCAGCUUAGAAGUGAUCUAUAUGAU8.211.703


Target Position: 3338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3338UACAGUCACUUAAUUCCUU76.44381369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9933356TACAGTCACTTAATTCCTTAAGGAATTAAGTGACTGTA0.137800.002400.543100.500001.000001.00000


Target Position: 2730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2730UUCUGAGCUGUAUCUUGAU74.1231588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9692748TTCTGAGCTGTATCTTGATATCAAGATACAGCTCAGAA0.544600.002900.491400.500001.000001.00000


Target Position: 2708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2708ACCAAAUCUUGUUAUUGAA87.9968369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3122726ACCAAATCTTGTTATTGAATTCAATAACAAGATTTGGT0.227800.139700.681000.750001.000001.00000


Target Position: 2574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2574AGCUAGUAAUGCUUUUUGA87.5729393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8332592AGCTAGTAATGCTTTTTGATCAAAAAGCATTACTAGCT0.096900.015300.629300.500000.956500.62500


Target Position: 1638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1638GAAUGAAGGAGAACCAGAA100.23215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8801656GAATGAAGGAGAACCAGAATTCTGGTTCTCCTTCATTC0.292500.076600.500000.750000.972801.00000


Target Position: 2575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2575GCUAGUAAUGCUUUUUGAG76.85361312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7092593GCTAGTAATGCTTTTTGAGCTCAAAAAGCATTACTAGC0.112500.046200.543100.750001.000001.00000


Target Position: 3005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3005CGAGUCACAUUCUGCUUAA95.839971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9203023CGAGTCACATTCTGCTTAATTAAGCAGAATGTGACTCG0.037000.005600.758601.000001.000001.00000


Target Position: 2631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2631GCACUGUAAGACGUAUGUA93.7972130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7142649GCACTGTAAGACGTATGTATACATACGTCTTACAGTGC0.075300.045600.672401.000000.994600.62500


Target Position: 207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
207AGACCCAAGACCAACCGAU75.1641501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
729225AGACCCAAGACCAACCGATATCGGTTGGTCTTGGGTCT0.093200.050900.543100.750001.000001.00000


Target Position: 2814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2814ACAAUUCUGCAUGUACUAG67.42352251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8792832ACAATTCTGCATGTACTAGCTAGTACATGCAGAATTGT0.113900.004600.534500.500001.000001.00000


Target Position: 24, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
24GCGGCGGCUGGGGAGGGUU59.80522825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
92242GCGGCGGCTGGGGAGGGTTAACCCTCCCCAGCCGCCGC0.041100.003900.775901.000001.000001.00000


Target Position: 3076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3076UAGGGGGAAAGGGGAGUAU61.64342707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6403094TAGGGGGAAAGGGGAGTATATACTCCCCTTTCCCCCTA0.191900.139800.629300.500001.000001.00000


Target Position: 564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
564GUGCAGAUAUCUCUAUGAU91.5814198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
768582GTGCAGATATCTCTATGATATCATAGAGATATCTGCAC0.064800.019400.612100.750000.934800.87500


Target Position: 2091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2091UGGAGAUAAACCCUGACCA76.72381329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8742109TGGAGATAAACCCTGACCATGGTCAGGGTTTATCTCCA0.229700.028300.500000.500000.934800.62500


Target Position: 1872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1872AGGAAGAGAAAAAAACAAA87.3887407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4431890AGGAAGAGAAAAAAACAAATTTGTTTTTTTCTCTTCCT0.339100.200300.844800.750001.000001.00000


Target Position: 898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
898AGAAAAGGAAGACAAAGAA88.5079330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
697916AGAAAAGGAAGACAAAGAATTCTTTGTCTTCCTTTTCT0.859500.781700.551700.750001.000001.00000


Target Position: 1536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1536UACACGAAGACUCUCAAAA79.60531069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9561554TACACGAAGACTCTCAAAATTTTGAGAGTCTTCGTGTA0.227100.057900.681000.500001.000001.00000


Target Position: 1428, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1428GGAAGAAUUUGGUCAAAAA103.8073

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3961446GGAAGAATTTGGTCAAAAATTTTTGACCAAATTCTTCC0.187800.084400.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1426-1448CAGGAAGAATTTGGTCAAAAAATUUUUUGACCAAAUUCUUCCUGGGAAGAAUUUGGUCAAAAAAUU14.914.812


Target Position: 1004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1004GGUGACAAGAAGAAGAAGA87.1568428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771022GGTGACAAGAAGAAGAAGATCTTCTTCTTCTTGTCACC0.935600.507900.629300.750001.000001.00000


Target Position: 2833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2833UCCUCUAGAAAUAGGUUAA81.2341906

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6632851TCCTCTAGAAATAGGTTAATTAACCTATTTCTAGAGGA0.184900.012200.836200.750000.918500.62500


Target Position: 490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
490GGCUGACUUGAUCAAUAAC80.5993974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
454508GGCTGACTTGATCAATAACGTTATTGATCAAGTCAGCC0.168800.026600.853400.750000.962000.75000


Target Position: 1090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1090UCCCGACGAUAUUACUAAU79.99471041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4191108TCCCGACGATATTACTAATATTAGTAATATCGTCGGGA0.269800.042500.862100.750001.000001.00000


Target Position: 911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
911AAAGAAGAAGAAAAAGAAA88.6571323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
912929AAAGAAGAAGAAAAAGAAATTTCTTTTTCTTCTTCTTT0.996200.967700.500000.500001.000001.00000


Target Position: 466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
466GGAUACUGGAAUUGGAAUG71.51941855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811484GGATACTGGAATTGGAATGCATTCCAATTCCAGTATCC0.057300.034500.715500.750001.000001.00000


Target Position: 1846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1846AGAGGAUGAAGAAGAGAAA92.6354149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1501864AGAGGATGAAGAAGAGAAATTTCTCTTCTTCATCCTCT0.931100.556100.724100.750001.000001.00000


Target Position: 1259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1259AAAAAGAACAACAUCAAAU80.8976943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9821277AAAAAGAACAACATCAAATATTTGATGTTGTTCTTTTT0.106600.032600.491400.500001.000001.00000


Target Position: 1389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1389GUGAGAUGUUGCAACAAAG82.9348734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9181407GTGAGATGTTGCAACAAAGCTTTGTTGCAACATCTCAC0.039300.003900.655200.500001.000001.00000


Target Position: 2094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2094AGAUAAACCCUGACCAUUC73.93551605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6792112AGATAAACCCTGACCATTCGAATGGTCAGGGTTTATCT0.218300.029000.551700.500001.000001.00000


Target Position: 2427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2427ACAAUUCCUCUGAUAAUAU83.5613677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5952445ACAATTCCTCTGATAATATATATTATCAGAGGAATTGT0.150900.016000.663800.750001.000001.00000


Target Position: 346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
346AUCAGAUGCAUUGGACAAA77.18671281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
940364ATCAGATGCATTGGACAAATTTGTCCAATGCATCTGAT0.033400.005000.681000.500001.000001.00000


Target Position: 1859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1859GAGAAAAAGAAGCAGGAAG74.32051569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8101877GAGAAAAAGAAGCAGGAAGCTTCCTGCTTCTTTTTCTC0.200300.218100.672400.500001.000001.00000


Target Position: 2891, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2891GUUUUCCAAAGAAAAGUAU75.26091489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7162909GTTTTCCAAAGAAAAGTATATACTTTTCTTTGGAAAAC0.161000.009500.603400.750000.913000.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2889-2911TTGTTTTCCAAAGAAAAGTATTGAUACUUUUCUUUGGAAAACAAGUUUUCCAAAGAAAAGUAUUGU4.920.111


Target Position: 3211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3211UGGAGCACACGUAGGCACA75.39051473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7193229TGGAGCACACGTAGGCACATGTGCCTACGTGTGCTCCA0.178600.009300.637900.500000.929300.62500


Target Position: 282, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
282CAUUGAUCAUCAAUACUUU96.024166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
280-302GTCATTGATCATCAATACTTTCTAAAGUAUUGAUGAUCAAUGACCAUUGAUCAUCAAUACUUUCUU4.616.202


Target Position: 2411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2411ACCUGUUCAGUACUCUACA82.221802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7362429ACCTGTTCAGTACTCTACATGTAGAGTACTGAACAGGT0.556600.076400.646600.500001.000001.00000


Target Position: 634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
634AACUGUGAUCACCAAACAU84.6458600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
979652AACTGTGATCACCAAACATATGTTTGGTGATCACAGTT0.411500.008600.491400.500001.000001.00000


Target Position: 1008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1008ACAAGAAGAAGAAGAAGAA90.1655251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7531026ACAAGAAGAAGAAGAAGAATTCTTCTTCTTCTTCTTGT0.906900.884200.534500.750001.000001.00000


Target Position: 946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
946GGAAGACAAACCUGAAAUU87.91378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
610964GGAAGACAAACCTGAAATTAATTTCAGGTTTGTCTTCC0.192000.015100.862101.000001.000001.00000


Target Position: 2585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2585CUUUUUGAGUUUCAUGUUG66.6622310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9862603CTTTTTGAGTTTCATGTTGCAACATGAAACTCAAAAAG0.058900.014800.491400.500001.000001.00000


Target Position: 344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
344UCAUCAGAUGCAUUGGACA82.2087806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
890362TCATCAGATGCATTGGACATGTCCAATGCATCTGATGA0.041400.007000.517200.500001.000001.00000


Target Position: 757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
757CCUGAAAGAAGACCAAACU77.25711272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
528775CCTGAAAGAAGACCAAACTAGTTTGGTCTTCTTTCAGG0.189300.101400.637900.750001.000001.00000


Target Position: 2768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2768ACAUCUUGUAGGAUCUACU81.5697873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9652786ACATCTTGTAGGATCTACTAGTAGATCCTACAAGATGT0.028800.003900.500000.500000.907600.62500


Target Position: 1223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1223CGACGUGCUCCUUUUGAUC73.25071678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6851241CGACGTGCTCCTTTTGATCGATCAAAAGGAGCACGTCG0.079900.051400.612100.750001.000001.00000


Target Position: 2779, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2779GAUCUACUUUUUGAACUUU85.9374503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4582797GATCTACTTTTTGAACTTTAAAGTTCAAAAAGTAGATC0.241700.046200.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2777-2799AGGATCTACTTTTTGAACTTTTCAAAGUUCAAAAAGUAGAUCCUGAUCUACUUUUUGAACUUUUCU19.218.922


Target Position: 2641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2641ACGUAUGUAACAUGAUGUU77.08261291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8402659ACGTATGTAACATGATGTTAACATCATGTTACATACGT0.065100.005600.629300.750001.000001.00000


Target Position: 2594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2594UUUCAUGUUGGUUUAUUUU66.82362298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9082612TTTCATGTTGGTTTATTTTAAAATAAACCAACATGAAA0.153300.016400.500000.500001.000001.00000


Target Position: 2951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2951UAAAGCUGUUCAAAAAUAA84.5096614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9232969TAAAGCTGTTCAAAAATAATTATTTTTGAACAGCTTTA0.484700.094600.500000.500001.000001.00000


Target Position: 2088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2088ACCUGGAGAUAAACCCUGA82.3603785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8342106ACCTGGAGATAAACCCTGATCAGGGTTTATCTCCAGGT0.230300.012700.629300.500000.934800.87500


Target Position: 2728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2728UGUUCUGAGCUGUAUCUUG72.61511744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8342746TGTTCTGAGCTGTATCTTGCAAGATACAGCTCAGAACA0.616000.005600.560300.500001.000001.00000


Target Position: 1738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1738AGAAGUGAUCUAUAUGAUU87.9206375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8101756AGAAGTGATCTATATGATTAATCATATAGATCACTTCT0.081900.006400.715500.750001.000001.00000


Target Position: 561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
561CUGGUGCAGAUAUCUCUAU80.4733984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
684579CTGGTGCAGATATCTCTATATAGAGATATCTGCACCAG0.082400.010900.741400.750000.934800.62500


Target Position: 2759, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2759GUAUUCGUUACAUCUUGUA86.4947469

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2757-2779AAGTATTCGTTACATCTTGTAGGUACAAGAUGUAACGAAUACUUGUAUUCGUUACAUCUUGUAGGU19.216.533


Target Position: 1286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1286CGCAGAGUUUUCAUCAUGG73.90231607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9711304CGCAGAGTTTTCATCATGGCCATGATGAAAACTCTGCG0.027700.018400.577600.500001.000001.00000


Target Position: 3039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3039AGAUGAGUUAAAAGAUAUU86.7006459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9753057AGATGAGTTAAAAGATATTAATATCTTTTAACTCATCT0.066900.002800.715500.750001.000001.00000


Target Position: 1849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1849GGAUGAAGAAGAGAAAAAG82.1513815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951867GGATGAAGAAGAGAAAAAGCTTTTTCTCTTCTTCATCC0.925900.714300.732800.750001.000001.00000


Target Position: 2739, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2739GUAUCUUGAUGUUUAGAAA100.9499

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2737-2759CTGTATCTTGATGTTTAGAAAAGUUUCUAAACAUCAAGAUACAGGUAUCUUGAUGUUUAGAAAAGU7.113.422


Target Position: 493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
493UGACUUGAUCAAUAACCUU79.94591044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
974511TGACTTGATCAATAACCTTAAGGTTATTGATCAAGTCA0.027000.004100.586200.750001.000001.00000


Target Position: 835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
835AUAUCCCAUUACUCUUUUU77.17921282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
945853ATATCCCATTACTCTTTTTAAAAAGAGTAATGGGATAT0.057300.004800.543100.500001.000001.00000


Target Position: 2009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2009ACAGCAAACAUGGAGAGAA85.0659572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7592027ACAGCAAACATGGAGAGAATTCTCTCCATGTTTGCTGT0.068600.027200.534500.750001.000001.00000


Target Position: 2230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2230UCCCCAGACACAUGCUAAC58.1942903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9602248TCCCCAGACACATGCTAACGTTAGCATGTGTCTGGGGA0.110700.058800.724100.500001.000001.00000


Target Position: 2144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2144GCUGAUAAGAACGACAAGU75.32081483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9702162GCTGATAAGAACGACAAGTACTTGTCGTTCTTATCAGC0.043400.002800.646600.750001.000001.00000


Target Position: 2840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2840GAAAUAGGUUAAACUGAAG82.1391818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9692858GAAATAGGTTAAACTGAAGCTTCAGTTTAACCTATTTC0.140500.030000.534500.500001.000001.00000


Target Position: 1877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1877GAGAAAAAAACAAAGUUUG72.861710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6171895GAGAAAAAAACAAAGTTTGCAAACTTTGTTTTTTTCTC0.206400.162400.663800.500001.000001.00000


Target Position: 1003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1003UGGUGACAAGAAGAAGAAG67.27142266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8091021TGGTGACAAGAAGAAGAAGCTTCTTCTTCTTGTCACCA0.938700.496700.706900.500001.000001.00000


Target Position: 1502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1502UAUGAGCAGUUCUCUAAAA87.8195383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7461520TATGAGCAGTTCTCTAAAATTTTAGAGAACTGCTCATA0.212000.010600.543100.500000.913000.87500


Target Position: 359, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
359GACAAAAUCCGGUAUGAAA97.887136

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
357-379TGGACAAAATCCGGTATGAAAGCUUUCAUACCGGAUUUUGUCCAGACAAAAUCCGGUAUGAAAGCU16.15.312


Target Position: 600, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
600GUUUUUAUUCUGCUUAUUU82.0213829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433618GTTTTTATTCTGCTTATTTAAATAAGCAGAATAAAAAC0.167600.125600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
598-620TGGTTTTTATTCTGCTTATTTGGAAAUAAGCAGAAUAAAAACCAGUUUUUAUUCUGCUUAUUUGGU13.6-9.702


Target Position: 947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
947GAAGACAAACCUGAAAUUG70.74391918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
796965GAAGACAAACCTGAAATTGCAATTTCAGGTTTGTCTTC0.248300.019300.525900.500001.000001.00000


Target Position: 1765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1765UGAUGAGUACUGUGUCCAA94.5267104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8461783TGATGAGTACTGTGTCCAATTGGACACAGTACTCATCA0.050200.009000.577600.750001.000001.00000


Target Position: 3025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3025GUUGUAACAAAUACAGAUG73.24091679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9763043GTTGTAACAAATACAGATGCATCTGTATTTGTTACAAC0.096800.018100.491400.500000.913000.75000


Target Position: 2277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2277UGGGUAUUGAUGAAGAUGA78.39031178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9522295TGGGTATTGATGAAGATGATCATCTTCATCAATACCCA0.088900.006300.620700.500001.000001.00000


Target Position: 1636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1636CAGAAUGAAGGAGAACCAG70.78231916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851654CAGAATGAAGGAGAACCAGCTGGTTCTCCTTCATTCTG0.123300.084400.500000.500000.972800.75000


Target Position: 1866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1866AGAAGCAGGAAGAGAAAAA85.9819502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2231884AGAAGCAGGAAGAGAAAAATTTTTCTCTTCCTGCTTCT0.291800.152100.724100.750001.000001.00000


Target Position: 1118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1118GGAGAAUUCUAUAAGAGCU92.3459161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8441136GGAGAATTCTATAAGAGCTAGCTCTTATAGAATTCTCC0.279000.016000.517200.750001.000001.00000


Target Position: 2579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2579GUAAUGCUUUUUGAGUUUC63.12792608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8652597GTAATGCTTTTTGAGTTTCGAAACTCAAAAAGCATTAC0.081800.017600.508600.500001.000001.00000


Target Position: 2783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2783UACUUUUUGAACUUUUCAU72.00111805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7902801TACTTTTTGAACTTTTCATATGAAAAGTTCAAAAAGTA0.367000.106700.525900.500001.000001.00000


Target Position: 1219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1219CCCACGACGUGCUCCUUUU77.72681239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3981237CCCACGACGTGCTCCTTTTAAAAGGAGCACGTCGTGGG0.186800.112400.991401.000000.983700.75000


Target Position: 1915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1915GAAAGACAUAUUGGAGAAA90.5033240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3791933GAAAGACATATTGGAGAAATTTCTCCAATATGTCTTTC0.342400.173100.672400.750001.000001.00000


Target Position: 2505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2505ACUACUUUAAGGGGAAGAU70.53721944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8222523ACTACTTTAAGGGGAAGATATCTTCCCCTTAAAGTAGT0.055800.028400.525900.750001.000001.00000


Target Position: 1014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1014AGAAGAAGAAGAAGAUUAA95.449878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5311032AGAAGAAGAAGAAGATTAATTAATCTTCTTCTTCTTCT0.599600.597900.689700.750001.000001.00000


Target Position: 338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
338UCAAAUUCAUCAGAUGCAU71.01091899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
839356TCAAATTCATCAGATGCATATGCATCTGATGAATTTGA0.052200.040000.569000.750001.000001.00000


Target Position: 3024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3024AGUUGUAACAAAUACAGAU88.3026349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8183042AGTTGTAACAAATACAGATATCTGTATTTGTTACAACT0.096700.015100.525900.750000.913000.75000


Target Position: 2451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2451CAAGGAUGUUUUUCUUUAU91.2919211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732469CAAGGATGTTTTTCTTTATATAAAGAAAAACATCCTTG0.169400.002800.603400.750001.000001.00000


Target Position: 2452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2452AAGGAUGUUUUUCUUUAUU75.70931442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8842470AAGGATGTTTTTCTTTATTAATAAAGAAAAACATCCTT0.151900.005400.629300.500001.000001.00000


Target Position: 2640, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2640GACGUAUGUAACAUGAUGU85.4354545

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2638-2660AAGACGTATGTAACATGATGTTAACAUCAUGUUACAUACGUCUUGACGUAUGUAACAUGAUGUUAU19.421.023


Target Position: 1019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1019AAGAAGAAGAUUAAGGAAA82.5044774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7571037AAGAAGAAGATTAAGGAAATTTCCTTAATCTTCTTCTT0.531700.481200.637900.500001.000001.00000


Target Position: 23, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
23GGCGGCGGCUGGGGAGGGU55.04833055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97641GGCGGCGGCTGGGGAGGGTACCCTCCCCAGCCGCCGCC0.040000.002800.646600.750001.000001.00000


Target Position: 2413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2413CUGUUCAGUACUCUACAAU80.7602958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4732431CTGTTCAGTACTCTACAATATTGTAGAGTACTGAACAG0.443200.024000.775900.750001.000001.00000


Target Position: 2593, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2593GUUUCAUGUUGGUUUAUUU90.565238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5542611GTTTCATGTTGGTTTATTTAAATAAACCAACATGAAAC0.119700.018200.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2591-2613GAGTTTCATGTTGGTTTATTTTCAAAUAAACCAACAUGAAACUCGUUUCAUGUUGGUUUAUUUUCU-0.313.822


Target Position: 1419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1419AAGUUAUCAGGAAGAAUUU80.09041028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6701437AAGTTATCAGGAAGAATTTAAATTCTTCCTGATAACTT0.083200.028800.637900.500001.000001.00000


Target Position: 2455, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2455GAUGUUUUUCUUUAUUUUU83.0697722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5332473GATGTTTTTCTTTATTTTTAAAAATAAAGAAAAACATC0.120300.037600.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2453-2475AGGATGTTTTTCTTTATTTTTGTAAAAAUAAAGAAAAACAUCCUGAUGUUUUUCUUUAUUUUUGUU-9.75.301


Target Position: 2106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2106ACCAUUCCAUUAUUGAGAC64.68742490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7472124ACCATTCCATTATTGAGACGTCTCAATAATGGAATGGT0.079000.037200.534500.500001.000001.00000


Target Position: 270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
270CCCAGUUGAUGUCAUUGAU85.3964547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
868288CCCAGTTGATGTCATTGATATCAATGACATCAACTGGG0.652500.004900.810301.000001.000001.00000


Target Position: 1865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1865AAGAAGCAGGAAGAGAAAA78.84761140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8811883AAGAAGCAGGAAGAGAAAATTTTCTCTTCCTGCTTCTT0.495200.177800.637900.500001.000001.00000


Target Position: 1873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1873GGAAGAGAAAAAAACAAAG78.63031160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2301891GGAAGAGAAAAAAACAAAGCTTTGTTTTTTTCTCTTCC0.336400.173100.732800.750001.000001.00000


Target Position: 1565, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1565CUUUCAGAGCUGUUAAGGU76.91111306

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1563-1585AGCTTTCAGAGCTGTTAAGGTACACCUUAACAGCUCUGAAAGCUCUUUCAGAGCUGUUAAGGUACU18.620.402


Target Position: 285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
285UGAUCAUCAAUACUUUCUA87.4696401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
704303TGATCATCAATACTTTCTATAGAAAGTATTGATGATCA0.480600.021800.551700.750001.000001.00000


Target Position: 446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
446GAUCGAACUCUCACUAUUG85.8399512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
994464GATCGAACTCTCACTATTGCAATAGTGAGAGTTCGATC0.026000.002400.534500.500001.000001.00000


Target Position: 1475, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1475GAAGAUAAAGAGAACUACA99.754816

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1473-1495CGGAAGATAAAGAGAACTACAAGUGUAGUUCUCUUUAUCUUCCGGAAGAUAAAGAGAACUACAAGU21.46.912


Target Position: 982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
982UGAGGAAGAAGAAAAGAAG71.44461863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7431000TGAGGAAGAAGAAAAGAAGCTTCTTTTCTTCTTCCTCA0.654000.423600.586200.500001.000001.00000


Target Position: 2573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2573GAGCUAGUAAUGCUUUUUG74.84651521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7792591GAGCTAGTAATGCTTTTTGCAAAAAGCATTACTAGCTC0.088700.007200.663800.500000.934800.62500


Target Position: 348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
348CAGAUGCAUUGGACAAAAU88.524329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
989366CAGATGCATTGGACAAAATATTTTGTCCAATGCATCTG0.024700.003700.775900.750001.000001.00000


Target Position: 881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
881AGCGAUGAUGAGGCUGAAG63.63532566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
964899AGCGATGATGAGGCTGAAGCTTCAGCCTCATCATCGCT0.132700.053400.715500.500001.000001.00000


Target Position: 2111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2111UCCAUUAUUGAGACCUUAA80.8581947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232129TCCATTATTGAGACCTTAATTAAGGTCTCAATAATGGA0.055800.046600.836200.750001.000001.00000


Target Position: 2066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2066GGUUACAUGGCAGCAAAGA79.61891067

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6052084GGTTACATGGCAGCAAAGATCTTTGCTGCCATGTAACC0.347100.015400.629300.750000.929300.62500


Target Position: 907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
907AGACAAAGAAGAAGAAAAA92.0109179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
222925AGACAAAGAAGAAGAAAAATTTTTCTTCTTCTTTGTCT0.990500.850900.724100.750001.000001.00000


Target Position: 2956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2956CUGUUCAAAAAUAACUCAG67.22422272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9152974CTGTTCAAAAATAACTCAGCTGAGTTATTTTTGAACAG0.157200.145200.500000.500001.000001.00000


Target Position: 751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
751CCUACACCUGAAAGAAGAC72.3761770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
808769CCTACACCTGAAAGAAGACGTCTTCTTTCAGGTGTAGG0.280600.012200.525900.750001.000001.00000


Target Position: 3016, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3016CUGCUUAAAGUUGUAACAA83.691664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7893034CTGCTTAAAGTTGTAACAATTGTTACAACTTTAAGCAG0.061000.019700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3014-3036TTCTGCTTAAAGTTGTAACAAATUUGUUACAACUUUAAGCAGAACUGCUUAAAGUUGUAACAAAUU20.419.722


Target Position: 3019, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3019CUUAAAGUUGUAACAAAUA88.2444352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7333037CTTAAAGTTGTAACAAATATATTTGTTACAACTTTAAG0.071200.027600.594800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3017-3039TGCTTAAAGTTGTAACAAATACAUAUUUGUUACAACUUUAAGCACUUAAAGUUGUAACAAAUACAU5.34.923


Target Position: 2321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2321GCUGUAACUGAAGAAAUGC65.54932410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8862339GCTGTAACTGAAGAAATGCGCATTTCTTCAGTTACAGC0.448700.052200.500000.500001.000001.00000


Target Position: 1091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1091CCCGACGAUAUUACUAAUG62.15792670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841109CCCGACGATATTACTAATGCATTAGTAATATCGTCGGG0.260200.049000.836200.750001.000001.00000


Target Position: 904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
904GGAAGACAAAGAAGAAGAA97.808837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
228922GGAAGACAAAGAAGAAGAATTCTTCTTCTTTGTCTTCC0.979000.837200.698301.000001.000001.00000


Target Position: 2276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2276CUGGGUAUUGAUGAAGAUG68.74322133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7752294CTGGGTATTGATGAAGATGCATCTTCATCAATACCCAG0.097900.007300.629300.500001.000001.00000


Target Position: 1399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1399GCAACAAAGCAAAAUUUUG74.3851567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8641417GCAACAAAGCAAAATTTTGCAAAATTTTGCTTTGTTGC0.046600.007900.706900.750000.994600.75000


Target Position: 2642, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2642CGUAUGUAACAUGAUGUUA92.0548174

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2640-2662GACGTATGTAACATGATGTTAACUAACAUCAUGUUACAUACGUCCGUAUGUAACAUGAUGUUAACU20.515.822


Target Position: 329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
329GAGCUCAUUUCAAAUUCAU87.1761426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
362347GAGCTCATTTCAAATTCATATGAATTTGAAATGAGCTC0.281700.094100.655200.750001.000001.00000


Target Position: 2542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2542GUGAUGCUGUGAUACCUUA94.4737105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5522560GTGATGCTGTGATACCTTATAAGGTATCACAGCATCAC0.225200.018200.758600.750001.000001.00000


Target Position: 1044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1044UCGAUCAAGAAGAGCUCAA74.26891574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6261062TCGATCAAGAAGAGCTCAATTGAGCTCTTCTTGATCGA0.092700.021500.646600.750001.000001.00000


Target Position: 491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
491GCUGACUUGAUCAAUAACC64.00592538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
914509GCTGACTTGATCAATAACCGGTTATTGATCAAGTCAGC0.059100.014500.500000.500000.962000.62500


Target Position: 2512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2512UAAGGGGAAGAUAAGAUUU74.50171553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9092530TAAGGGGAAGATAAGATTTAAATCTTATCTTCCCCTTA0.039100.009100.534500.500001.000001.00000


Target Position: 2831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2831AGUCCUCUAGAAAUAGGUU81.8626845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7372849AGTCCTCTAGAAATAGGTTAACCTATTTCTAGAGGACT0.185400.008700.560300.750000.918500.62500


Target Position: 176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
176GGUCACUUAGCCAAGAUGC65.36332434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
966194GGTCACTTAGCCAAGATGCGCATCTTGGCTAAGTGACC0.094200.002800.500000.500000.967400.75000


Target Position: 2360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2360GACACAUCACGCAUGGAAG80.5025982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9652378GACACATCACGCATGGAAGCTTCCATGCGTGATGTGTC0.108100.017400.681000.500001.000001.00000


Target Position: 2089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2089CCUGGAGAUAAACCCUGAC67.80892218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7892107CCTGGAGATAAACCCTGACGTCAGGGTTTATCTCCAGG0.226600.013100.525900.750000.934800.87500


Target Position: 3109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3109GUGCCAAAAUGUAAAACAU89.1543294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9453127GTGCCAAAATGTAAAACATATGTTTTACATTTTGGCAC0.097600.003400.637900.750001.000001.00000


Target Position: 926, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926GAAAAAGAAGAGAAAGAGU84.5901606

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
924-946AAGAAAAAGAAGAGAAAGAGTCGACUCUUUCUCUUCUUUUUCUUGAAAAAGAAGAGAAAGAGUCGU19.15.502


Target Position: 263, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
263GAAAUUGCCCAGUUGAUGU80.4453987

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
261-283CAGAAATTGCCCAGTTGATGTCAACAUCAACUGGGCAAUUUCUGGAAAUUGCCCAGUUGAUGUCAU20.514.003


Target Position: 1112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1112GAGUACGGAGAAUUCUAUA96.672254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7891130GAGTACGGAGAATTCTATATATAGAATTCTCCGTACTC0.207100.007000.767200.750001.000001.00000


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623AGGACUACUGCACCAGAAU78.92841133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6651641AGGACTACTGCACCAGAATATTCTGGTGCAGTAGTCCT0.083800.024100.836200.750000.967400.62500


Target Position: 2996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2996UGUAGUGCUCGAGUCACAU76.32321388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6943014TGTAGTGCTCGAGTCACATATGTGACTCGAGCACTACA0.090500.013600.551700.750000.956500.75000


Target Position: 599, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
599GGUUUUUAUUCUGCUUAUU82.2122804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
358617GGTTTTTATTCTGCTTATTAATAAGCAGAATAAAAACC0.206100.112400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
597-619TTGGTTTTTATTCTGCTTATTTGAAUAAGCAGAAUAAAAACCAAGGUUUUUAUUCUGCUUAUUUGU19.70.002


Target Position: 1407, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1407GCAAAAUUUUGAAAGUUAU87.2417417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3721425GCAAAATTTTGAAAGTTATATAACTTTCAAAATTTTGC0.375900.039000.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1405-1427AAGCAAAATTTTGAAAGTTATCAAUAACUUUCAAAAUUUUGCUUGCAAAAUUUUGAAAGUUAUCAU4.9-3.312


Target Position: 1505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1505GAGCAGUUCUCUAAAAACA95.384182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8121523GAGCAGTTCTCTAAAAACATGTTTTTAGAGAACTGCTC0.339300.022000.603400.500000.983700.62500


Target Position: 1119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1119GAGAAUUCUAUAAGAGCUU82.3174793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5081137GAGAATTCTATAAGAGCTTAAGCTCTTATAGAATTCTC0.243100.021000.672400.750001.000001.00000


Target Position: 883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
883CGAUGAUGAGGCUGAAGAA103.4075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
517901CGATGATGAGGCTGAAGAATTCTTCAGCCTCATCATCG0.152500.083600.620701.000001.000001.00000


Target Position: 2490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2490CUGUAUGGCAUGACAACUA90.5128239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262508CTGTATGGCATGACAACTATAGTTGTCATGCCATACAG0.081200.005700.612100.750001.000001.00000


Target Position: 3224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3224GGCACAGAAAACAGGAAUG73.73791630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8803242GGCACAGAAAACAGGAATGCATTCCTGTTTTCTGTGCC0.042500.015800.844800.750001.000001.00000


Target Position: 1648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1648GAACCAGAAACAUAUCUAU94.963592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841666GAACCAGAAACATATCTATATAGATATGTTTCTGGTTC0.328900.112000.629300.750000.923900.62500


Target Position: 706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
706GAGGACAGACACAGGUGAA95.86770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
967724GAGGACAGACACAGGTGAATTCACCTGTGTCTGTCCTC0.028700.003600.637900.750001.000001.00000


Target Position: 2434, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2434CUCUGAUAAUAUAUUUUCA96.405859

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2432-2454TCCTCTGATAATATATTTTCAAGUGAAAAUAUAUUAUCAGAGGACUCUGAUAAUAUAUUUUCAAGU2.121.402


Target Position: 2296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2296CCCUACUGCUGAUGAUACC66.78462301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9702314CCCTACTGCTGATGATACCGGTATCATCAGCAGTAGGG0.027800.010100.637900.500001.000001.00000


Target Position: 891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
891AGGCUGAAGAAAAGGAAGA75.06491511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
651909AGGCTGAAGAAAAGGAAGATCTTCCTTTTCTTCAGCCT0.819100.148600.620700.500001.000001.00000


Target Position: 1315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1315GGAGCUAAUCCCUGAAUAU94.86795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7231333GGAGCTAATCCCTGAATATATATTCAGGGATTAGCTCC0.143400.009100.827601.000000.983700.62500


Target Position: 1465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1465UGAACUGGCGGAAGAUAAA82.3797783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8211483TGAACTGGCGGAAGATAAATTTATCTTCCGCCAGTTCA0.055900.016100.724100.750001.000001.00000


Target Position: 199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
199GGAAACCCAGACCCAAGAC66.26852342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
687217GGAAACCCAGACCCAAGACGTCTTGGGTCTGGGTTTCC0.299800.018200.551700.750000.983700.62500


Target Position: 1788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1788UGAAGGAAUUUGAGGGGAA82.1492816

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8031806TGAAGGAATTTGAGGGGAATTCCCCTCAAATTCCTTCA0.058700.021200.551700.750001.000001.00000


Target Position: 1713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1713UGGAACGUCUUCGGAAACA68.65892140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9971731TGGAACGTCTTCGGAAACATGTTTCCGAAGACGTTCCA0.101600.030900.637900.500000.989100.62500


Target Position: 379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
379CUUGACAGAUCCCAGUAAA89.1363296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
870397CTTGACAGATCCCAGTAAATTTACTGGGATCTGTCAAG0.045400.019400.637900.750001.000001.00000


Target Position: 1871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1871CAGGAAGAGAAAAAAACAA91.4737201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211889CAGGAAGAGAAAAAAACAATTGTTTTTTTCTCTTCCTG0.335400.137800.637900.750001.000001.00000


Target Position: 2244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2244CUAACAGGAUCUACAGGAU88.3927342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9712262CTAACAGGATCTACAGGATATCCTGTAGATCCTGTTAG0.684900.018500.491400.750001.000001.00000


Target Position: 2013, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2013CAAACAUGGAGAGAAUCAU85.105568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9682031CAAACATGGAGAGAATCATATGATTCTCTCCATGTTTG0.076400.009400.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2011-2033AGCAAACATGGAGAGAATCATGAAUGAUUCUCUCCAUGUUUGCUCAAACAUGGAGAGAAUCAUGAU20.412.112


Target Position: 2845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2845AGGUUAAACUGAAGCAACU81.3471897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8502863AGGTTAAACTGAAGCAACTAGTTGCTTCAGTTTAACCT0.049000.017900.637900.500001.000001.00000


Target Position: 1257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257AGAAAAAGAACAACAUCAA90.4383241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6081275AGAAAAAGAACAACATCAATTGATGTTGTTCTTTTTCT0.116900.016100.577600.750001.000001.00000


Target Position: 2798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2798UCAUUCCCUGUAGUUGACA66.95962289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9882816TCATTCCCTGTAGTTGACATGTCAACTACAGGGAATGA0.024900.010700.517200.500001.000001.00000


Target Position: 591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
591UCGGUGUUGGUUUUUAUUC52.94343121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
567609TCGGTGTTGGTTTTTATTCGAATAAAAACCAACACCGA0.350200.060500.620700.500001.000001.00000


Target Position: 1521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1521ACAUAAAGCUUGGAAUACA88.5495325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8991539ACATAAAGCTTGGAATACATGTATTCCAAGCTTTATGT0.173700.075000.500000.500001.000001.00000


Target Position: 2371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2371CAUGGAAGAAGUAGACUAA100.58713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5182389CATGGAAGAAGTAGACTAATTAGTCTACTTCTTCCATG0.232400.064000.620700.750001.000001.00000


Target Position: 1317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1317AGCUAAUCCCUGAAUAUCU82.3574786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9501335AGCTAATCCCTGAATATCTAGATATTCAGGGATTAGCT0.234200.029100.629300.500001.000001.00000


Target Position: 2332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2332AGAAAUGCCACCCCUUGAA78.50031171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7822350AGAAATGCCACCCCTTGAATTCAAGGGGTGGCATTTCT0.062100.036500.551700.750001.000001.00000


Target Position: 3345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3345ACUUAAUUCCUUGGCCUUA77.20991277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3013363ACTTAATTCCTTGGCCTTATAAGGCCAAGGAATTAAGT0.917800.108600.672400.750001.000001.00000


Target Position: 986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
986GAAGAAGAAAAGAAGGAUG77.45511257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8221004GAAGAAGAAAAGAAGGATGCATCCTTCTTTTCTTCTTC0.517900.405200.517200.500001.000001.00000


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773ACUGAGUACUUGGAGGAAC63.75312556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
862791ACTGAGTACTTGGAGGAACGTTCCTCCAAGTACTCAGT0.094300.016300.560300.500001.000001.00000


Target Position: 589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
589GUUCGGUGUUGGUUUUUAU87.0288437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
551607GTTCGGTGTTGGTTTTTATATAAAAACCAACACCGAAC0.199200.056600.603400.750001.000001.00000


Target Position: 1860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1860AGAAAAAGAAGCAGGAAGA82.1859808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9311878AGAAAAAGAAGCAGGAAGATCTTCCTGCTTCTTTTTCT0.197200.212100.500000.500001.000001.00000


Target Position: 2508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2508ACUUUAAGGGGAAGAUAAG69.21062080

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8962526ACTTTAAGGGGAAGATAAGCTTATCTTCCCCTTAAAGT0.040500.015600.569000.500001.000001.00000


Target Position: 1247, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1247GAAAACAGAAAGAAAAAGA86.6166463

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1245-1267TTGAAAACAGAAAGAAAAAGAACUCUUUUUCUUUCUGUUUUCAAGAAAACAGAAAGAAAAAGAACU5.510.301


Target Position: 1739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1739GAAGUGAUCUAUAUGAUUG86.7714450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8891757GAAGTGATCTATATGATTGCAATCATATAGATCACTTC0.067200.004400.525900.500001.000001.00000


Target Position: 2461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2461UUUCUUUAUUUUUGUUAAU67.65742228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9912479TTTCTTTATTTTTGTTAATATTAACAAAAATAAAGAAA0.121700.059100.491400.500001.000001.00000


Target Position: 2887, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2887GCUUGUUUUCCAAAGAAAA90.8662230

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2885-2907GGGCTTGTTTTCCAAAGAAAAGTUUUUCUUUGGAAAACAAGCCCGCUUGUUUUCCAAAGAAAAGUU5.510.322


Target Position: 2105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2105GACCAUUCCAUUAUUGAGA83.8786649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8112123GACCATTCCATTATTGAGATCTCAATAATGGAATGGTC0.179000.074200.594800.500001.000001.00000


Target Position: 979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
979UGAUGAGGAAGAAGAAAAG71.27291877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
639997TGATGAGGAAGAAGAAAAGCTTTTCTTCTTCCTCATCA0.734300.276100.586200.500001.000001.00000


Target Position: 2423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2423CUCUACAAUUCCUCUGAUA91.2695213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3422441CTCTACAATTCCTCTGATATATCAGAGGAATTGTAGAG0.212000.109900.767200.750001.000001.00000


Target Position: 1032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1032AGGAAAAGUACAUCGAUCA86.0818496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9031050AGGAAAAGTACATCGATCATGATCGATGTACTTTTCCT0.106800.084100.620700.500001.000001.00000


Target Position: 2702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2702AAGUAGACCAAAUCUUGUU78.52861168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9902720AAGTAGACCAAATCTTGTTAACAAGATTTGGTCTACTT0.283200.025600.491400.500000.972801.00000


Target Position: 2295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2295ACCCUACUGCUGAUGAUAC68.86262121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8452313ACCCTACTGCTGATGATACGTATCATCAGCAGTAGGGT0.514700.131200.672400.500001.000001.00000


Target Position: 2938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2938CCUAAGCAUAUCGUAAAGC57.71162923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9802956CCTAAGCATATCGTAAAGCGCTTTACGATATGCTTAGG0.193900.042500.491400.500000.989100.75000


Target Position: 2497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2497GCAUGACAACUACUUUAAG81.7781858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3942515GCATGACAACTACTTTAAGCTTAAAGTAGTTGTCATGC0.193000.034600.715500.750001.000001.00000


Target Position: 2092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2092GGAGAUAAACCCUGACCAU91.4197204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4182110GGAGATAAACCCTGACCATATGGTCAGGGTTTATCTCC0.175900.109600.715501.000000.972800.62500


Target Position: 1569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1569CAGAGCUGUUAAGGUACUA88.8784310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9631587CAGAGCTGTTAAGGTACTATAGTACCTTAACAGCTCTG0.082300.002900.612100.750001.000001.00000


Target Position: 2507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2507UACUUUAAGGGGAAGAUAA84.0851633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8892525TACTTTAAGGGGAAGATAATTATCTTCCCCTTAAAGTA0.041500.018400.646600.500001.000001.00000


Target Position: 1258, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258GAAAAAGAACAACAUCAAA97.362244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5351276GAAAAAGAACAACATCAAATTTGATGTTGTTCTTTTTC0.119000.021600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1256-1278AAGAAAAAGAACAACATCAAATTUUUGAUGUUGUUCUUUUUCUUGAAAAAGAACAACAUCAAAUUU20.55.502


Target Position: 522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
522CCAAGUCUGGGACCAAAGC56.93452967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
975540CCAAGTCTGGGACCAAAGCGCTTTGGTCCCAGACTTGG0.085000.002800.491400.500000.929300.87500


Target Position: 445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
445AGAUCGAACUCUCACUAUU88.4475337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
923463AGATCGAACTCTCACTATTAATAGTGAGAGTTCGATCT0.037000.003900.715500.750000.989100.62500


Target Position: 1757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1757GAGCCCAUUGAUGAGUACU76.61321346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9011775GAGCCCATTGATGAGTACTAGTACTCATCAATGGGCTC0.039700.009300.603400.500000.929300.87500


Target Position: 414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
414AGCUGCAUAUUAACCUUAU82.3562787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
256432AGCTGCATATTAACCTTATATAAGGTTAATATGCAGCT0.811600.269400.810300.750001.000001.00000


Target Position: 792, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792GAAGAAUAAAGGAGAUUGU84.013636

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
790-812ACGAAGAATAAAGGAGATTGTGAACAAUCUCCUUUAUUCUUCGUGAAGAAUAAAGGAGAUUGUGAU20.46.912


Target Position: 754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
754ACACCUGAAAGAAGACCAA83.7679657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
675772ACACCTGAAAGAAGACCAATTGGTCTTCTTTCAGGTGT0.336300.020800.560300.750001.000001.00000


Target Position: 3214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3214AGCACACGUAGGCACAGAA89.146295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5363232AGCACACGTAGGCACAGAATTCTGTGCCTACGTGTGCT0.223300.049200.681000.750000.929300.62500


Target Position: 1325, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1325CCUGAAUAUCUGAACUUCA93.6588134

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1323-1345TCCCTGAATATCTGAACTTCATTUGAAGUUCAGAUAUUCAGGGACCUGAAUAUCUGAACUUCAUUU21.513.403


Target Position: 818, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
818CAUUCUCAGUUUAUUGGAU88.8765311

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
816-838AACATTCTCAGTTTATTGGATATAUCCAAUAAACUGAGAAUGUUCAUUCUCAGUUUAUUGGAUAUU21.220.412


Target Position: 1875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1875AAGAGAAAAAAACAAAGUU77.19731278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851893AAGAGAAAAAAACAAAGTTAACTTTGTTTTTTTCTCTT0.222800.173200.491400.500001.000001.00000


Target Position: 1921, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1921CAUAUUGGAGAAAAAAGUU83.4881685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8711939CATATTGGAGAAAAAAGTTAACTTTTTTCTCCAATATG0.631300.210700.508600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1919-1941GACATATTGGAGAAAAAAGTTGAAACUUUUUUCUCCAAUAUGUCCAUAUUGGAGAAAAAAGUUGAU3.212.602


Target Position: 2934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2934CCUACCUAAGCAUAUCGUA88.1146363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3452952CCTACCTAAGCATATCGTATACGATATGCTTAGGTAGG0.522000.081700.663801.000000.983700.75000


Target Position: 1285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1285ACGCAGAGUUUUCAUCAUG69.48622055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9301303ACGCAGAGTTTTCATCATGCATGATGAAAACTCTGCGT0.035200.023400.620700.500001.000001.00000


Target Position: 405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
405CUGGGAAAGAGCUGCAUAU82.827742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
863423CTGGGAAAGAGCTGCATATATATGCAGCTCTTTCCCAG0.234600.005100.741400.750001.000001.00000


Target Position: 2807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2807GUAGUUGACAAUUCUGCAU80.889944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952825GTAGTTGACAATTCTGCATATGCAGAATTGTCAACTAC0.069300.006800.525900.750001.000001.00000


Target Position: 905, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
905GAAGACAAAGAAGAAGAAA89.6265269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327923GAAGACAAAGAAGAAGAAATTTCTTCTTCTTTGTCTTC0.979600.839600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
903-925AGGAAGACAAAGAAGAAGAAAAAUUUCUUCUUCUUUGUCUUCCUGAAGACAAAGAAGAAGAAAAAU19.119.201


Target Position: 1509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1509AGUUCUCUAAAAACAUAAA90.3032246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2671527AGTTCTCTAAAAACATAAATTTATGTTTTTAGAGAACT0.659600.172500.706900.750000.983700.62500


Target Position: 2771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2771UCUUGUAGGAUCUACUUUU77.19011279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7712789TCTTGTAGGATCTACTTTTAAAAGTAGATCCTACAAGA0.091500.007400.724100.750000.907601.00000


Target Position: 1624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1624GGACUACUGCACCAGAAUG81.086922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7251642GGACTACTGCACCAGAATGCATTCTGGTGCAGTAGTCC0.073000.023200.715500.750001.000001.00000


Target Position: 1486, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1486GAACUACAAGAAAUUCUAU94.5379103

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1484-1506GAGAACTACAAGAAATTCTATGAAUAGAAUUUCUUGUAGUUCUCGAACUACAAGAAAUUCUAUGAU6.919.002


Target Position: 2791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2791GAACUUUUCAUUCCCUGUA86.9326444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9812809GAACTTTTCATTCCCTGTATACAGGGAATGAAAAGTTC0.069500.029800.491400.750001.000001.00000


Target Position: 1844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1844CCAGAGGAUGAAGAAGAGA81.1679912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041862CCAGAGGATGAAGAAGAGATCTCTTCTTCATCCTCTGG0.871100.181700.620700.750001.000001.00000


Target Position: 2793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2793ACUUUUCAUUCCCUGUAGU71.16841886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9322811ACTTTTCATTCCCTGTAGTACTACAGGGAATGAAAAGT0.041700.018500.500000.500001.000001.00000


Target Position: 1650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1650ACCAGAAACAUAUCUAUUA88.6584322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2921668ACCAGAAACATATCTATTATAATAGATATGTTTCTGGT0.332200.265200.819000.750000.923900.62500


Target Position: 787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
787GGAACGAAGAAUAAAGGAG76.63731343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
672805GGAACGAAGAATAAAGGAGCTCCTTTATTCTTCGTTCC0.133900.113600.560300.750001.000001.00000


Target Position: 413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
413GAGCUGCAUAUUAACCUUA92.5526156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
314431GAGCTGCATATTAACCTTATAAGGTTAATATGCAGCTC0.799900.216600.775900.750001.000001.00000


Target Position: 2024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2024AGAAUCAUGAAAGCUCAAG61.56662715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9322042AGAATCATGAAAGCTCAAGCTTGAGCTTTCATGATTCT0.035000.003900.586200.500001.000001.00000


Target Position: 3136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3136AGCAGGAGAUGGUUAAACA92.2833163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9813154AGCAGGAGATGGTTAAACATGTTTAACCATCTCCTGCT0.077400.042100.646600.500001.000001.00000


Target Position: 1894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1894UGAGAACCUCUGCAAAAUC66.54862324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8871912TGAGAACCTCTGCAAAATCGATTTTGCAGAGGTTCTCA0.041800.004400.543100.500000.967400.62500


Target Position: 1549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1549UCAAAAUCGGAAGAAGCUU62.66842638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9521567TCAAAATCGGAAGAAGCTTAAGCTTCTTCCGATTTTGA0.031200.018800.586200.750001.000001.00000


Target Position: 3000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3000GUGCUCGAGUCACAUUCUG68.29812183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9533018GTGCTCGAGTCACATTCTGCAGAATGTGACTCGAGCAC0.031000.010800.508600.500001.000001.00000


Target Position: 2496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2496GGCAUGACAACUACUUUAA92.0441175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4022514GGCATGACAACTACTTTAATTAAAGTAGTTGTCATGCC0.203600.033000.965501.000001.000001.00000


Target Position: 2723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2723UGAAGUGUUCUGAGCUGUA87.3168413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7972741TGAAGTGTTCTGAGCTGTATACAGCTCAGAACACTTCA0.059500.013300.543100.750001.000001.00000


Target Position: 2707, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2707GACCAAAUCUUGUUAUUGA96.944450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7932725GACCAAATCTTGTTATTGATCAATAACAAGATTTGGTC0.233300.143100.594800.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2705-2727TAGACCAAATCTTGTTATTGAAGUCAAUAACAAGAUUUGGUCUAGACCAAAUCUUGUUAUUGAAGU6.918.833


Target Position: 2939, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2939CUAAGCAUAUCGUAAAGCU79.4881078

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2937-2959ACCTAAGCATATCGTAAAGCTGTAGCUUUACGAUAUGCUUAGGUCUAAGCAUAUCGUAAAGCUGUU20.919.733


Target Position: 1011, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1011AGAAGAAGAAGAAGAAGAU87.2092423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7201029AGAAGAAGAAGAAGAAGATATCTTCTTCTTCTTCTTCT0.617400.620500.543100.750001.000001.00000


Target Position: 1182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1182UUGAAGGACAGUUGGAAUU61.64122708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531200TTGAAGGACAGTTGGAATTAATTCCAACTGTCCTTCAA0.032400.003100.637900.500001.000001.00000


Target Position: 2171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2171GAUCUGGUCAUCUUGCUUU84.8134586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8332189GATCTGGTCATCTTGCTTTAAAGCAAGATGACCAGATC0.344100.005700.681000.750001.000001.00000


Target Position: 326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
326AGAGAGCUCAUUUCAAAUU77.9011227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
413344AGAGAGCTCATTTCAAATTAATTTGAAATGAGCTCTCT0.322000.031100.715500.750001.000001.00000


Target Position: 2888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2888CUUGUUUUCCAAAGAAAAG66.33372339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8882906CTTGTTTTCCAAAGAAAAGCTTTTCTTTGGAAAACAAG0.111300.010000.500000.500000.913000.62500


Target Position: 3008, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3008GUCACAUUCUGCUUAAAGU83.9216643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583026GTCACATTCTGCTTAAAGTACTTTAAGCAGAATGTGAC0.056400.006400.612100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3006-3028GAGTCACATTCTGCTTAAAGTTGACUUUAAGCAGAAUGUGACUCGUCACAUUCUGCUUAAAGUUGU1.320.522


Target Position: 1086, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1086GAAAUCCCGACGAUAUUAC69.14932089

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9891104GAAATCCCGACGATATTACGTAATATCGTCGGGATTTC0.253700.048500.491400.500000.989100.87500


Target Position: 2236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2236GACACAUGCUAACAGGAUC78.87711138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9022254GACACATGCTAACAGGATCGATCCTGTTAGCATGTGTC0.096200.004200.637900.500001.000001.00000


Target Position: 2422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2422ACUCUACAAUUCCUCUGAU83.6638670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952440ACTCTACAATTCCTCTGATATCAGAGGAATTGTAGAGT0.200200.096200.525900.750001.000001.00000


Target Position: 3004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3004UCGAGUCACAUUCUGCUUA76.40731377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9463022TCGAGTCACATTCTGCTTATAAGCAGAATGTGACTCGA0.032400.005600.758600.750001.000001.00000


Target Position: 732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
732GUCGUGGAACAAAAGUUAU80.17051018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
604750GTCGTGGAACAAAAGTTATATAACTTTTGTTCCACGAC0.144500.015400.775900.750001.000001.00000


Target Position: 1205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1205GCCCUUCUAUUUGUCCCAC62.91612623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7831223GCCCTTCTATTTGTCCCACGTGGGACAAATAGAAGGGC0.066800.007200.706900.750001.000001.00000


Target Position: 3038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3038CAGAUGAGUUAAAAGAUAU94.2191111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9193056CAGATGAGTTAAAAGATATATATCTTTTAACTCATCTG0.076900.003900.741400.750001.000001.00000


Target Position: 2506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2506CUACUUUAAGGGGAAGAUA85.0919571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8352524CTACTTTAAGGGGAAGATATATCTTCCCCTTAAAGTAG0.053200.026100.629300.750001.000001.00000


Target Position: 3079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3079GGGGAAAGGGGAGUAUCUG69.90252007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6973097GGGGAAAGGGGAGTATCTGCAGATACTCCCCTTTCCCC0.077500.041000.706900.750001.000001.00000


Target Position: 1905, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1905GCAAAAUCAUGAAAGACAU89.8925261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2251923GCAAAATCATGAAAGACATATGTCTTTCATGATTTTGC0.316600.224900.698301.000000.972800.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1903-1925CTGCAAAATCATGAAAGACATATAUGUCUUUCAUGAUUUUGCAGGCAAAAUCAUGAAAGACAUAUU19.27.412


Target Position: 2491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2491UGUAUGGCAUGACAACUAC68.7732131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672509TGTATGGCATGACAACTACGTAGTTGTCATGCCATACA0.073500.004900.525900.500001.000001.00000


Target Position: 853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
853UGUGGAGAAGGAACGUGAU77.03881297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
805871TGTGGAGAAGGAACGTGATATCACGTTCCTTCTCCACA0.143000.041500.525900.750001.000001.00000


Target Position: 943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
943GUCGGAAGACAAACCUGAA93.1076139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
829961GTCGGAAGACAAACCTGAATTCAGGTTTGTCTTCCGAC0.194400.005700.646600.750000.956500.87500


Target Position: 1089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1089AUCCCGACGAUAUUACUAA82.4502777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9931107ATCCCGACGATATTACTAATTAGTAATATCGTCGGGAT0.290900.035400.646600.500001.000001.00000


Target Position: 2943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2943GCAUAUCGUAAAGCUGUUC66.89262293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4162961GCATATCGTAAAGCTGTTCGAACAGCTTTACGATATGC0.176600.125900.681000.750001.000001.00000


Target Position: 862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
862GGAACGUGAUAAAGAAGUA100.77712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
247880GGAACGTGATAAAGAAGTATACTTCTTTATCACGTTCC0.504300.190000.689701.000001.000001.00000


Target Position: 2584, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2584GCUUUUUGAGUUUCAUGUU80.8712945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7402602GCTTTTTGAGTTTCATGTTAACATGAAACTCAAAAAGC0.069900.013100.706901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2582-2604ATGCTTTTTGAGTTTCATGTTGGAACAUGAAACUCAAAAAGCAUGCUUUUUGAGUUUCAUGUUGGU20.52.123


Target Position: 1418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1418AAAGUUAUCAGGAAGAAUU80.05321032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9771436AAAGTTATCAGGAAGAATTAATTCTTCCTGATAACTTT0.083000.028200.491400.500001.000001.00000


Target Position: 931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
931AGAAGAGAAAGAGUCGGAA85.003577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
978949AGAAGAGAAAGAGTCGGAATTCCGACTCTTTCTCTTCT0.026400.029100.551700.750001.000001.00000


Target Position: 2333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2333GAAAUGCCACCCCUUGAAG69.60532041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9172351GAAATGCCACCCCTTGAAGCTTCAAGGGGTGGCATTTC0.037600.024400.534500.500001.000001.00000


Target Position: 2700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2700CUAAGUAGACCAAAUCUUG77.24441273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7992718CTAAGTAGACCAAATCTTGCAAGATTTGGTCTACTTAG0.289500.018400.525900.500000.972800.75000


Target Position: 1756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1756UGAGCCCAUUGAUGAGUAC65.50552414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9061774TGAGCCCATTGATGAGTACGTACTCATCAATGGGCTCA0.060900.014700.543100.500000.907600.62500


Target Position: 1374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1374CUCUAAACAUAUCCCGUGA84.0885632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9321392CTCTAAACATATCCCGTGATCACGGGATATGTTTAGAG0.044200.008600.586200.500001.000001.00000


Target Position: 597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
597UUGGUUUUUAUUCUGCUUA67.7952219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
664615TTGGTTTTTATTCTGCTTATAAGCAGAATAAAAACCAA0.223500.053700.612100.500001.000001.00000


Target Position: 1082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1082ACCAGAAAUCCCGACGAUA80.5835976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5781100ACCAGAAATCCCGACGATATATCGTCGGGATTTCTGGT0.103800.061100.810300.750000.951100.62500


Target Position: 3110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3110UGCCAAAAUGUAAAACAUG65.94812371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7743128TGCCAAAATGTAAAACATGCATGTTTTACATTTTGGCA0.095500.007300.698300.500001.000001.00000


Target Position: 1919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1919GACAUAUUGGAGAAAAAAG79.35141092

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6101937GACATATTGGAGAAAAAAGCTTTTTTCTCCAATATGTC0.466200.191200.681000.500001.000001.00000


Target Position: 1706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1706GCCUUUGUGGAACGUCUUC62.78012630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9971724GCCTTTGTGGAACGTCTTCGAAGACGTTCCACAAAGGC0.078700.002300.827600.750001.000001.00000


Target Position: 2709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2709CCAAAUCUUGUUAUUGAAG70.34831961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3042727CCAAATCTTGTTATTGAAGCTTCAATAACAAGATTTGG0.230800.137000.706900.750001.000001.00000


Target Position: 2425, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2425CUACAAUUCCUCUGAUAAU89.1358297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3312443CTACAATTCCTCTGATAATATTATCAGAGGAATTGTAG0.240300.129300.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2423-2445CTCTACAATTCCTCTGATAATATAUUAUCAGAGGAAUUGUAGAGCUACAAUUCCUCUGAUAAUAUU13.46.902


Target Position: 349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
349AGAUGCAUUGGACAAAAUC68.50722159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
972367AGATGCATTGGACAAAATCGATTTTGTCCAATGCATCT0.040000.004400.543100.500001.000001.00000


Target Position: 2359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2359CGACACAUCACGCAUGGAA90.302247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5972377CGACACATCACGCATGGAATTCCATGCGTGATGTGTCG0.112700.015900.620701.000001.000001.00000


Target Position: 1431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1431AGAAUUUGGUCAAAAAAUG70.38971956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9901449AGAATTTGGTCAAAAAATGCATTTTTTGACCAAATTCT0.217400.090600.569000.500001.000001.00000


Target Position: 1644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1644AGGAGAACCAGAAACAUAU85.4867542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2271662AGGAGAACCAGAAACATATATATGTTTCTGGTTCTCCT0.384900.075100.801700.750000.972800.75000


Target Position: 1864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1864AAAGAAGCAGGAAGAGAAA86.2744484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9301882AAAGAAGCAGGAAGAGAAATTTCTCTTCCTGCTTCTTT0.525800.186500.500000.500001.000001.00000


Target Position: 906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
906AAGACAAAGAAGAAGAAAA89.8838262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
808924AAGACAAAGAAGAAGAAAATTTTCTTCTTCTTTGTCTT0.980000.850600.637900.500001.000001.00000


Target Position: 592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
592CGGUGUUGGUUUUUAUUCU84.1432626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
326610CGGTGTTGGTTTTTATTCTAGAATAAAAACCAACACCG0.365800.048000.689700.750001.000001.00000


Target Position: 1645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1645GGAGAACCAGAAACAUAUC79.22461106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2411663GGAGAACCAGAAACATATCGATATGTTTCTGGTTCTCC0.337600.071200.689700.750001.000001.00000


Target Position: 1462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1462UACUGAACUGGCGGAAGAU73.7321632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9091480TACTGAACTGGCGGAAGATATCTTCCGCCAGTTCAGTA0.145500.030200.500000.500001.000001.00000


Target Position: 975, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975GUUCUGAUGAGGAAGAAGA85.0296574

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
973-995TGGTTCTGATGAGGAAGAAGAAAUCUUCUUCCUCAUCAGAACCAGUUCUGAUGAGGAAGAAGAAAU19.120.402


Target Position: 1480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1480UAAAGAGAACUACAAGAAA87.4732400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9611498TAAAGAGAACTACAAGAAATTTCTTGTAGTTCTCTTTA0.110900.003000.534500.500001.000001.00000


Target Position: 2592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2592AGUUUCAUGUUGGUUUAUU74.77711529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7502610AGTTTCATGTTGGTTTATTAATAAACCAACATGAAACT0.067700.022900.698300.750001.000001.00000


Target Position: 1246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1246UGAAAACAGAAAGAAAAAG60.71242774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8071264TGAAAACAGAAAGAAAAAGCTTTTTCTTTCTGTTTTCA0.223700.066000.586200.500001.000001.00000


Target Position: 460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
460UAUUGUGGAUACUGGAAUU81.7796857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
970478TATTGTGGATACTGGAATTAATTCCAGTATCCACAATA0.226800.019900.534500.500001.000001.00000


Target Position: 1187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1187GGACAGUUGGAAUUCAGAG80.31081000

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8151205GGACAGTTGGAATTCAGAGCTCTGAATTCCAACTGTCC0.137900.006300.560300.750001.000001.00000


Target Position: 729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
729UGGGUCGUGGAACAAAAGU58.12642907

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
992747TGGGTCGTGGAACAAAAGTACTTTTGTTCCACGACCCA0.298300.002400.637900.500001.000001.00000


Target Position: 2087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2087CACCUGGAGAUAAACCCUG65.92332375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8492105CACCTGGAGATAAACCCTGCAGGGTTTATCTCCAGGTG0.231600.013400.508600.500000.934800.75000


Target Position: 2991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2991GGAAAUGUAGUGCUCGAGU79.46711083

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5633009GGAAATGTAGTGCTCGAGTACTCGAGCACTACATTTCC0.125100.017700.663800.750001.000001.00000


Target Position: 1005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1005GUGACAAGAAGAAGAAGAA94.2548109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211023GTGACAAGAAGAAGAAGAATTCTTCTTCTTCTTGTCAC0.937200.512800.620700.750001.000001.00000


Target Position: 1000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1000GGAUGGUGACAAGAAGAAG80.7123961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3011018GGATGGTGACAAGAAGAAGCTTCTTCTTGTCACCATCC0.963100.465700.732800.750001.000001.00000


Target Position: 598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
598UGGUUUUUAUUCUGCUUAU78.0431214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
346616TGGTTTTTATTCTGCTTATATAAGCAGAATAAAAACCA0.211000.070900.801700.750001.000001.00000


Target Position: 2724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2724GAAGUGUUCUGAGCUGUAU87.3256412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6772742GAAGTGTTCTGAGCTGTATATACAGCTCAGAACACTTC0.098500.011200.629300.750001.000001.00000


Target Position: 1761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1761CCAUUGAUGAGUACUGUGU77.56161249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9591779CCATTGATGAGTACTGTGTACACAGTACTCATCAATGG0.030300.013400.637900.750001.000001.00000


Target Position: 3067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3067UGUCUUAUUUAGGGGGAAA78.04611213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583085TGTCTTATTTAGGGGGAAATTTCCCCCTAAATAAGACA0.462000.003000.706900.750001.000001.00000


Target Position: 427, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
427CCUUAUACCGAACAAACAA90.4353242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
252445CCTTATACCGAACAAACAATTGTTTGTTCGGTATAAGG0.265100.157100.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
425-447AACCTTATACCGAACAAACAAGAUUGUUUGUUCGGUAUAAGGUUCCUUAUACCGAACAAACAAGAU19.36.313


Target Position: 1026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1026AGAUUAAGGAAAAGUACAU84.7319593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6431044AGATTAAGGAAAAGTACATATGTACTTTTCCTTAATCT0.326400.232100.569000.750001.000001.00000


Target Position: 884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
884GAUGAUGAGGCUGAAGAAA89.6537268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
309902GATGATGAGGCTGAAGAAATTTCTTCAGCCTCATCATC0.228800.093100.681000.750001.000001.00000


Target Position: 1015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1015GAAGAAGAAGAAGAUUAAG78.55931163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9161033GAAGAAGAAGAAGATTAAGCTTAATCTTCTTCTTCTTC0.555900.550200.534500.500001.000001.00000


Target Position: 2820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2820CUGCAUGUACUAGUCCUCU75.40331469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9872838CTGCATGTACTAGTCCTCTAGAGGACTAGTACATGCAG0.024900.002600.560300.500001.000001.00000


Target Position: 890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
890GAGGCUGAAGAAAAGGAAG73.72871633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
910908GAGGCTGAAGAAAAGGAAGCTTCCTTTTCTTCAGCCTC0.819800.139500.672400.500001.000001.00000


Target Position: 203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
203ACCCAGACCCAAGACCAAC57.58092930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
758221ACCCAGACCCAAGACCAACGTTGGTCTTGGGTCTGGGT0.218400.013200.706900.500001.000001.00000


Target Position: 1759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1759GCCCAUUGAUGAGUACUGU78.46641174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021777GCCCATTGATGAGTACTGTACAGTACTCATCAATGGGC0.039600.018300.793100.750000.929300.62500


Target Position: 1416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1416UGAAAGUUAUCAGGAAGAA82.0466827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7511434TGAAAGTTATCAGGAAGAATTCTTCCTGATAACTTTCA0.067600.031600.551700.750001.000001.00000


Target Position: 1438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1438GGUCAAAAAAUGCUUAGAA95.748473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341456GGTCAAAAAATGCTTAGAATTCTAAGCATTTTTTGACC0.167400.077800.681001.000001.000001.00000


Target Position: 2846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2846GGUUAAACUGAAGCAACUU84.2791618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8912864GGTTAAACTGAAGCAACTTAAGTTGCTTCAGTTTAACC0.041400.015300.715501.000001.000001.00000


Target Position: 1402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1402ACAAAGCAAAAUUUUGAAA78.26421187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7411420ACAAAGCAAAATTTTGAAATTTCAAAATTTTGCTTTGT0.069800.016300.706900.750001.000001.00000


Target Position: 1518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1518AAAACAUAAAGCUUGGAAU79.48921077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9781536AAAACATAAAGCTTGGAATATTCCAAGCTTTATGTTTT0.109000.105400.491400.500000.972800.62500


Target Position: 825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
825AGUUUAUUGGAUAUCCCAU83.048724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
794843AGTTTATTGGATATCCCATATGGGATATCCAATAAACT0.060300.008700.551700.750000.918500.62500


Target Position: 1837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1837GGAACUUCCAGAGGAUGAA88.383344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9291855GGAACTTCCAGAGGATGAATTCATCCTCTGGAAGTTCC0.557800.003800.698301.000000.967401.00000


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832UGGAUAUCCCAUUACUCUU77.40881259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
851850TGGATATCCCATTACTCTTAAGAGTAATGGGATATCCA0.048700.007100.706900.750000.945700.62500


Target Position: 1852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1852UGAAGAAGAGAAAAAGAAG73.13891688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6231870TGAAGAAGAGAAAAAGAAGCTTCTTTTTCTCTTCTTCA0.445500.428100.586200.500001.000001.00000


Target Position: 2620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2620UGGGGUAACGUGCACUGUA82.7751747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8822638TGGGGTAACGTGCACTGTATACAGTGCACGTTACCCCA0.062700.004500.663800.750001.000001.00000


Target Position: 3260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3260CUGCGUCCAUGAGUUACAU80.9048941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9103278CTGCGTCCATGAGTTACATATGTAACTCATGGACGCAG0.038900.017200.629300.750001.000001.00000


Target Position: 2643, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2643GUAUGUAACAUGAUGUUAA99.327221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8502661GTATGTAACATGATGTTAATTAACATCATGTTACATAC0.057400.005200.646600.750000.956500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2641-2663ACGTATGTAACATGATGTTAACTUUAACAUCAUGUUACAUACGUGUAUGUAACAUGAUGUUAACUU16.18.522


Target Position: 2704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2704GUAGACCAAAUCUUGUUAU80.24541009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4312722GTAGACCAAATCTTGTTATATAACAAGATTTGGTCTAC0.263900.036000.637900.750000.972800.75000


Target Position: 2743, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2743CUUGAUGUUUAGAAAAGUA94.7143100

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2741-2763ATCTTGATGTTTAGAAAAGTATTUACUUUUCUAAACAUCAAGAUCUUGAUGUUUAGAAAAGUAUUU13.320.522


Target Position: 3344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3344CACUUAAUUCCUUGGCCUU79.77291054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3583362CACTTAATTCCTTGGCCTTAAGGCCAAGGAATTAAGTG0.918800.109500.655200.750001.000001.00000


Target Position: 3140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3140GGAGAUGGUUAAACACUAG86.0081501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9933158GGAGATGGTTAAACACTAGCTAGTGTTTAACCATCTCC0.024400.007500.698300.750001.000001.00000


Target Position: 2424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2424UCUACAAUUCCUCUGAUAA85.8467511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5052442TCTACAATTCCTCTGATAATTATCAGAGGAATTGTAGA0.228200.123200.689700.750001.000001.00000


Target Position: 2489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2489UCUGUAUGGCAUGACAACU68.59552150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8292507TCTGTATGGCATGACAACTAGTTGTCATGCCATACAGA0.085300.007500.517200.500001.000001.00000


Target Position: 2406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2406GACUUACCUGUUCAGUACU82.1475817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6072424GACTTACCTGTTCAGTACTAGTACTGAACAGGTAAGTC0.114600.071300.612100.500000.940200.75000


Target Position: 306, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
306CGAACAAAGAGAUCUUUCU84.4274615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
892324CGAACAAAGAGATCTTTCTAGAAAGATCTCTTTGTTCG0.041100.005200.569000.750000.972800.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
304-326CTCGAACAAAGAGATCTTTCTGAAGAAAGAUCUCUUUGUUCGAGCGAACAAAGAGAUCUUUCUGAU14.814.902


Target Position: 731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
731GGUCGUGGAACAAAAGUUA93.2785138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
927749GGTCGTGGAACAAAAGTTATAACTTTTGTTCCACGACC0.306400.003800.819001.000001.000001.00000


Target Position: 3068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3068GUCUUAUUUAGGGGGAAAG62.93482618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7203086GTCTTATTTAGGGGGAAAGCTTTCCCCCTAAATAAGAC0.529200.022300.681000.500001.000001.00000


Target Position: 1081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1081GACCAGAAAUCCCGACGAU85.6042529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7091099GACCAGAAATCCCGACGATATCGTCGGGATTTCTGGTC0.075600.044400.637900.750000.951100.75000


Target Position: 1207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1207CCUUCUAUUUGUCCCACGA83.7234662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811225CCTTCTATTTGTCCCACGATCGTGGGACAAATAGAAGG0.025700.011500.551700.750001.000001.00000


Target Position: 378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
378GCUUGACAGAUCCCAGUAA93.0685140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
942396GCTTGACAGATCCCAGTAATTACTGGGATCTGTCAAGC0.033100.020700.819001.000001.000001.00000


Target Position: 2804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2804CCUGUAGUUGACAAUUCUG76.02181413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9012822CCTGTAGTTGACAATTCTGCAGAATTGTCAACTACAGG0.059300.004200.560300.750001.000001.00000


Target Position: 1366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1366GGAUCUCCCUCUAAACAUA103.0136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9001384GGATCTCCCTCTAAACATATATGTTTAGAGGGAGATCC0.096300.004200.827601.000001.000001.00000


Target Position: 202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
202AACCCAGACCCAAGACCAA83.1238715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
901220AACCCAGACCCAAGACCAATTGGTCTTGGGTCTGGGTT0.208300.016600.500000.500001.000001.00000


Target Position: 1367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1367GAUCUCCCUCUAAACAUAU86.5067468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9081385GATCTCCCTCTAAACATATATATGTTTAGAGGGAGATC0.140300.004000.637900.750001.000001.00000


Target Position: 1084, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1084CAGAAAUCCCGACGAUAUU81.4031894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161102CAGAAATCCCGACGATATTAATATCGTCGGGATTTCTG0.130500.052600.775900.750000.989100.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1082-1104ACCAGAAATCCCGACGATATTACAAUAUCGUCGGGAUUUCUGGUCAGAAAUCCCGACGAUAUUACU16.414.803


Target Position: 3031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3031ACAAAUACAGAUGAGUUAA84.726594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4223049ACAAATACAGATGAGTTAATTAACTCATCTGTATTTGT0.178300.054800.672400.750001.000001.00000


Target Position: 1326, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1326CUGAAUAUCUGAACUUCAU86.8759445

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1324-1346CCCTGAATATCTGAACTTCATTAAUGAAGUUCAGAUAUUCAGGGCUGAAUAUCUGAACUUCAUUAU19.28.702


Target Position: 2494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2494AUGGCAUGACAACUACUUU79.04951121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7812512ATGGCATGACAACTACTTTAAAGTAGTTGTCATGCCAT0.241100.008500.655200.500001.000001.00000


Target Position: 2763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2763UCGUUACAUCUUGUAGGAU71.87351819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9952781TCGTTACATCTTGTAGGATATCCTACAAGATGTAACGA0.025200.002400.612100.750000.989101.00000


Target Position: 1514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514UCUAAAAACAUAAAGCUUG60.79582769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8431532TCTAAAAACATAAAGCTTGCAAGCTTTATGTTTTTAGA0.147700.150000.577600.500000.972800.62500


Target Position: 1013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1013AAGAAGAAGAAGAAGAUUA88.5059331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6911031AAGAAGAAGAAGAAGATTATAATCTTCTTCTTCTTCTT0.603200.604500.603400.500001.000001.00000


Target Position: 2997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2997GUAGUGCUCGAGUCACAUU86.1087494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6443015GTAGTGCTCGAGTCACATTAATGTGACTCGAGCACTAC0.092400.013200.672400.750000.956500.75000


Target Position: 566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
566GCAGAUAUCUCUAUGAUUG83.9496639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
923584GCAGATATCTCTATGATTGCAATCATAGAGATATCTGC0.036700.015700.706900.750000.934800.62500


Target Position: 1222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1222ACGACGUGCUCCUUUUGAU79.96261043

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5621240ACGACGTGCTCCTTTTGATATCAAAAGGAGCACGTCGT0.109600.072500.594800.750001.000001.00000


Target Position: 914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
914GAAGAAGAAAAAGAAAAAG73.2341682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
741932GAAGAAGAAAAAGAAAAAGCTTTTTCTTTTTCTTCTTC0.991000.970100.534500.500001.000001.00000


Target Position: 2778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2778GGAUCUACUUUUUGAACUU92.0393177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3642796GGATCTACTTTTTGAACTTAAGTTCAAAAAGTAGATCC0.212700.040400.732801.000001.000001.00000


Target Position: 1450, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1450CUUAGAACUCUUUACUGAA95.527177

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1448-1470TGCTTAGAACTCTTTACTGAACTUUCAGUAAAGAGUUCUAAGCACUUAGAACUCUUUACUGAACUU20.314.611


Target Position: 2731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2731UCUGAGCUGUAUCUUGAUG64.21712523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7962749TCTGAGCTGTATCTTGATGCATCAAGATACAGCTCAGA0.068700.006800.569000.500001.000001.00000


Target Position: 2428, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2428CAAUUCCUCUGAUAAUAUA99.644517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7032446CAATTCCTCTGATAATATATATATTATCAGAGGAATTG0.131600.010000.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2426-2448TACAATTCCTCTGATAATATATTUAUAUUAUCAGAGGAAUUGUACAAUUCCUCUGAUAAUAUAUUU-8.618.702


Target Position: 1642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1642GAAGGAGAACCAGAAACAU88.2416353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8351660GAAGGAGAACCAGAAACATATGTTTCTGGTTCTCCTTC0.530000.057400.517200.750000.972800.87500


Target Position: 380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
380UUGACAGAUCCCAGUAAAU73.81021622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
836398TTGACAGATCCCAGTAAATATTTACTGGGATCTGTCAA0.052800.019400.637900.500001.000001.00000


Target Position: 3078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3078GGGGGAAAGGGGAGUAUCU80.03941033

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6963096GGGGGAAAGGGGAGTATCTAGATACTCCCCTTTCCCCC0.077600.043000.767200.750001.000001.00000


Target Position: 973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
973UGGUUCUGAUGAGGAAGAA79.28211101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
985991TGGTTCTGATGAGGAAGAATTCTTCCTCATCAGAACCA0.710100.002600.672400.750001.000001.00000


Target Position: 1324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1324CCCUGAAUAUCUGAACUUC74.76751530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3721342CCCTGAATATCTGAACTTCGAAGTTCAGATATTCAGGG0.198500.049300.819000.750001.000001.00000


Target Position: 2583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2583UGCUUUUUGAGUUUCAUGU64.80832476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262601TGCTTTTTGAGTTTCATGTACATGAAACTCAAAAAGCA0.055400.009900.646600.500001.000001.00000


Target Position: 1316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1316GAGCUAAUCCCUGAAUAUC75.92051421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6961334GAGCTAATCCCTGAATATCGATATTCAGGGATTAGCTC0.136100.010100.629300.500001.000001.00000


Target Position: 3213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3213GAGCACACGUAGGCACAGA86.125491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8883231GAGCACACGTAGGCACAGATCTGTGCCTACGTGTGCTC0.210500.021600.586200.500000.929300.62500


Target Position: 426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
426ACCUUAUACCGAACAAACA82.3844782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
860444ACCTTATACCGAACAAACATGTTTGTTCGGTATAAGGT0.227900.184300.646600.500001.000001.00000


Target Position: 1327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1327UGAAUAUCUGAACUUCAUU78.22231193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6351345TGAATATCTGAACTTCATTAATGAAGTTCAGATATTCA0.090600.081100.715500.750001.000001.00000


Target Position: 1463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1463ACUGAACUGGCGGAAGAUA79.47231081

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3661481ACTGAACTGGCGGAAGATATATCTTCCGCCAGTTCAGT0.236700.040000.663800.750001.000001.00000


Target Position: 985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
985GGAAGAAGAAAAGAAGGAU86.8125448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2451003GGAAGAAGAAAAGAAGGATATCCTTCTTTTCTTCTTCC0.554400.424500.689701.000001.000001.00000


Target Position: 2007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2007GGACAGCAAACAUGGAGAG75.32071484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6892025GGACAGCAAACATGGAGAGCTCTCCATGTTTGCTGTCC0.079200.026700.560300.750001.000001.00000


Target Position: 2713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2713AUCUUGUUAUUGAAGUGUU76.46491366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7502731ATCTTGTTATTGAAGTGTTAACACTTCAATAACAAGAT0.078500.051200.534500.500001.000001.00000


Target Position: 2012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2012GCAAACAUGGAGAGAAUCA87.4208404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7372030GCAAACATGGAGAGAATCATGATTCTCTCCATGTTTGC0.070600.017700.629300.750001.000001.00000


Target Position: 856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
856GGAGAAGGAACGUGAUAAA98.579428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
282874GGAGAAGGAACGTGATAAATTTATCACGTTCCTTCTCC0.243100.071600.870701.000001.000001.00000


Target Position: 1426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1426CAGGAAGAAUUUGGUCAAA88.4762334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041444CAGGAAGAATTTGGTCAAATTTGACCAAATTCTTCCTG0.131200.040300.784500.750001.000001.00000


Target Position: 3009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3009UCACAUUCUGCUUAAAGUU72.83041714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9053027TCACATTCTGCTTAAAGTTAACTTTAAGCAGAATGTGA0.116400.004200.577600.750001.000001.00000


Target Position: 1024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1024GAAGAUUAAGGAAAAGUAC78.25411189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941042GAAGATTAAGGAAAAGTACGTACTTTTCCTTAATCTTC0.398500.268800.491400.500001.000001.00000


Target Position: 2509, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2509CUUUAAGGGGAAGAUAAGA79.03911122

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2507-2529TACTTTAAGGGGAAGATAAGATTUCUUAUCUUCCCCUUAAAGUACUUUAAGGGGAAGAUAAGAUUU11.611.012


Target Position: 2103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2103CUGACCAUUCCAUUAUUGA82.1774810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7002121CTGACCATTCCATTATTGATCAATAATGGAATGGTCAG0.198500.092600.560300.500001.000001.00000


Target Position: 2895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2895UCCAAAGAAAAGUAUUGUU70.28481964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9822913TCCAAAGAAAAGTATTGTTAACAATACTTTTCTTTGGA0.025600.015800.724100.750001.000001.00000


Target Position: 1092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1092CCGACGAUAUUACUAAUGA88.8904307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3231110CCGACGATATTACTAATGATCATTAGTAATATCGTCGG0.247200.048900.689700.750001.000001.00000


Target Position: 596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
596GUUGGUUUUUAUUCUGCUU79.70861061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
850614GTTGGTTTTTATTCTGCTTAAGCAGAATAAAAACCAAC0.225300.052900.508600.750001.000001.00000


Target Position: 2430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2430AUUCCUCUGAUAAUAUAUU76.90321308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9162448ATTCCTCTGATAATATATTAATATATTATCAGAGGAAT0.292300.008000.500000.500001.000001.00000


Target Position: 2950, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2950GUAAAGCUGUUCAAAAAUA92.6897148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4132968GTAAAGCTGTTCAAAAATATATTTTTGAACAGCTTTAC0.705600.173100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2948-2970TCGTAAAGCTGTTCAAAAATAACUAUUUUUGAACAGCUUUACGAGUAAAGCUGUUCAAAAAUAACU-3.318.321


Target Position: 2987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2987GGAUGGAAAUGUAGUGCUC80.9319937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8713005GGATGGAAATGTAGTGCTCGAGCACTACATTTCCATCC0.058000.004800.560300.750001.000001.00000


Target Position: 2118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2118UUGAGACCUUAAGGCAAAA73.53351652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7402136TTGAGACCTTAAGGCAAAATTTTGCCTTAAGGTCTCAA0.083300.008900.646600.500000.934801.00000


Target Position: 1053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053AAGAGCUCAACAAAACAAA81.4318891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6041071AAGAGCTCAACAAAACAAATTTGTTTTGTTGAGCTCTT0.361600.075500.637900.500000.951100.87500


Target Position: 3296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3296ACGUUGUUUUGAUGUUAUU77.08361290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4953314ACGTTGTTTTGATGTTATTAATAACATCAAAACAACGT0.134300.031600.767200.750001.000001.00000


Target Position: 1318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1318GCUAAUCCCUGAAUAUCUG77.27041268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6471336GCTAATCCCTGAATATCTGCAGATATTCAGGGATTAGC0.225400.020700.569000.750001.000001.00000


Target Position: 3137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3137GCAGGAGAUGGUUAAACAC78.44371175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7913155GCAGGAGATGGTTAAACACGTGTTTAACCATCTCCTGC0.060500.018900.560300.750001.000001.00000


Target Position: 3218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3218CACGUAGGCACAGAAAACA83.2108710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7803236CACGTAGGCACAGAAAACATGTTTTCTGTGCCTACGTG0.368500.072200.586200.500001.000001.00000


Target Position: 196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
196UGAGGAAACCCAGACCCAA80.7367959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
799214TGAGGAAACCCAGACCCAATTGGGTCTGGGTTTCCTCA0.118000.006700.577600.750000.918500.62500


Target Position: 2362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2362CACAUCACGCAUGGAAGAA82.2633798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7602380CACATCACGCATGGAAGAATTCTTCCATGCGTGATGTG0.088300.007800.620700.750001.000001.00000


Target Position: 1904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1904UGCAAAAUCAUGAAAGACA80.4105992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6051922TGCAAAATCATGAAAGACATGTCTTTCATGATTTTGCA0.322400.224100.646600.500000.972800.62500


Target Position: 2710, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2710CAAAUCUUGUUAUUGAAGU75.80511435

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2708-2730ACCAAATCTTGTTATTGAAGTGTACUUCAAUAACAAGAUUUGGUCAAAUCUUGUUAUUGAAGUGUU12.05.312


Target Position: 2699, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2699CCUAAGUAGACCAAAUCUU80.4099993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5692717CCTAAGTAGACCAAATCTTAAGATTTGGTCTACTTAGG0.319500.017600.706901.000000.972800.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2697-2719TGCCTAAGTAGACCAAATCTTGTAAGAUUUGGUCUACUUAGGCACCUAAGUAGACCAAAUCUUGUU12.011.333


Target Position: 1113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1113AGUACGGAGAAUUCUAUAA89.2644287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7091131AGTACGGAGAATTCTATAATTATAGAATTCTCCGTACT0.216000.009900.672400.750001.000001.00000


Target Position: 3003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3003CUCGAGUCACAUUCUGCUU76.80111319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9493021CTCGAGTCACATTCTGCTTAAGCAGAATGTGACTCGAG0.031900.005700.672400.750001.000001.00000


Target Position: 2733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2733UGAGCUGUAUCUUGAUGUU81.0777924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7752751TGAGCTGTATCTTGATGTTAACATCAAGATACAGCTCA0.063100.017800.577600.750001.000001.00000


Target Position: 2082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2082AGAAACACCUGGAGAUAAA90.6043236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2492100AGAAACACCTGGAGATAAATTTATCTCCAGGTGTTTCT0.268800.164400.724100.750001.000001.00000


Target Position: 2070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2070ACAUGGCAGCAAAGAAACA82.5548769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9242088ACATGGCAGCAAAGAAACATGTTTCTTTGCTGCCATGT0.759600.043400.500000.500001.000001.00000


Target Position: 2065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2065GGGUUACAUGGCAGCAAAG77.46591256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9782083GGGTTACATGGCAGCAAAGCTTTGCTGCCATGTAACCC0.123500.002700.853400.750000.929300.62500


Target Position: 776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
776GAGUACUUGGAGGAACGAA89.2453289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
532794GAGTACTTGGAGGAACGAATTCGTTCCTCCAAGTACTC0.238800.019700.637900.750001.000001.00000


Target Position: 1373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1373CCUCUAAACAUAUCCCGUG70.63791931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8301391CCTCTAAACATATCCCGTGCACGGGATATGTTTAGAGG0.054000.007300.551700.750001.000001.00000


Target Position: 1021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1021GAAGAAGAUUAAGGAAAAG78.2631188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7821039GAAGAAGATTAAGGAAAAGCTTTTCCTTAATCTTCTTC0.428200.306600.534500.500001.000001.00000


Target Position: 855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
855UGGAGAAGGAACGUGAUAA83.3065701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
362873TGGAGAAGGAACGTGATAATTATCACGTTCCTTCTCCA0.203700.060900.810300.750001.000001.00000


Target Position: 2366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2366UCACGCAUGGAAGAAGUAG57.88762915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152384TCACGCATGGAAGAAGTAGCTACTTCTTCCATGCGTGA0.264600.017300.551700.500001.000001.00000


Target Position: 1264, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1264GAACAACAUCAAAUUGUAU93.9938125

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1262-1284AAGAACAACATCAAATTGTATGTAUACAAUUUGAUGUUGUUCUUGAACAACAUCAAAUUGUAUGUU6.919.302


Target Position: 2318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2318GCUGCUGUAACUGAAGAAA86.3601481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4432336GCTGCTGTAACTGAAGAAATTTCTTCAGTTACAGCAGC0.161700.046400.853401.000001.000001.00000


Target Position: 1034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1034GAAAAGUACAUCGAUCAAG74.48851554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8561052GAAAAGTACATCGATCAAGCTTGATCGATGTACTTTTC0.056800.045200.534500.500001.000001.00000


Target Position: 2232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2232CCCAGACACAUGCUAACAG72.82281716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952250CCCAGACACATGCTAACAGCTGTTAGCATGTGTCTGGG0.060100.012800.706900.750001.000001.00000


Target Position: 2315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2315AGUGCUGCUGUAACUGAAG69.53722049

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7752333AGTGCTGCTGTAACTGAAGCTTCAGTTACAGCAGCACT0.162700.022500.569000.500001.000001.00000


Target Position: 1867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1867GAAGCAGGAAGAGAAAAAA92.5535155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3831885GAAGCAGGAAGAGAAAAAATTTTTTCTCTTCCTGCTTC0.346000.140400.672400.750001.000001.00000


Target Position: 1278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1278UGUAUGUACGCAGAGUUUU68.50062161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6641296TGTATGTACGCAGAGTTTTAAAACTCTGCGTACATACA0.083800.014800.706900.750001.000001.00000


Target Position: 3259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3259CCUGCGUCCAUGAGUUACA83.1209716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9803277CCTGCGTCCATGAGTTACATGTAACTCATGGACGCAGG0.052500.002600.637900.750001.000001.00000


Target Position: 2290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2290AGAUGACCCUACUGCUGAU91.7078192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7122308AGATGACCCTACTGCTGATATCAGCAGTAGGGTCATCT0.358700.081200.543100.750001.000001.00000


Target Position: 2372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2372AUGGAAGAAGUAGACUAAU74.5061551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6802390ATGGAAGAAGTAGACTAATATTAGTCTACTTCTTCCAT0.123400.046200.646600.500001.000001.00000


Target Position: 1238, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1238GAUCUGUUUGAAAACAGAA96.057163

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1236-1258TTGATCTGTTTGAAAACAGAAAGUUCUGUUUUCAAACAGAUCAAGAUCUGUUUGAAAACAGAAAGU19.219.210


Target Position: 1580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1580AGGUACUACACAUCUGCCU70.99751900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9371598AGGTACTACACATCTGCCTAGGCAGATGTGTAGTACCT0.099400.019800.500000.500000.962000.75000


Target Position: 1012, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1012GAAGAAGAAGAAGAAGAUU85.8296514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4061030GAAGAAGAAGAAGAAGATTAATCTTCTTCTTCTTCTTC0.609600.610200.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1010-1032AAGAAGAAGAAGAAGAAGATTAAAAUCUUCUUCUUCUUCUUCUUGAAGAAGAAGAAGAAGAUUAAU19.119.111


Target Position: 2502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2502ACAACUACUUUAAGGGGAA83.4063691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7782520ACAACTACTTTAAGGGGAATTCCCCTTAAAGTAGTTGT0.068100.038500.534500.750001.000001.00000


Target Position: 1279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1279GUAUGUACGCAGAGUUUUC76.43321373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8511297GTATGTACGCAGAGTTTTCGAAAACTCTGCGTACATAC0.075400.012400.508600.500001.000001.00000


Target Position: 1646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1646GAGAACCAGAAACAUAUCU77.04431296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7591664GAGAACCAGAAACATATCTAGATATGTTTCTGGTTCTC0.330400.083700.586200.500000.972800.62500


Target Position: 3010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3010CACAUUCUGCUUAAAGUUG70.25511970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8233028CACATTCTGCTTAAAGTTGCAACTTTAAGCAGAATGTG0.070500.005800.646600.500001.000001.00000


Target Position: 382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382GACAGAUCCCAGUAAAUUA102.6267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
872400GACAGATCCCAGTAAATTATAATTTACTGGGATCTGTC0.044700.023700.784500.750001.000001.00000


Target Position: 1752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1752UGAUUGAGCCCAUUGAUGA82.2699797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9251770TGATTGAGCCCATTGATGATCATCAATGGGCTCAATCA0.261300.038200.500000.500001.000001.00000


Target Position: 1481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1481AAAGAGAACUACAAGAAAU88.722320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9981499AAAGAGAACTACAAGAAATATTTCTTGTAGTTCTCTTT0.168500.002300.491400.500001.000001.00000


Target Position: 2229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2229AUCCCCAGACACAUGCUAA83.2163708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8092247ATCCCCAGACACATGCTAATTAGCATGTGTCTGGGGAT0.105500.006400.646600.500001.000001.00000


Target Position: 1220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1220CCACGACGUGCUCCUUUUG68.5052160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4171238CCACGACGTGCTCCTTTTGCAAAAGGAGCACGTCGTGG0.176200.108000.698300.750000.983700.62500


Target Position: 2734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2734GAGCUGUAUCUUGAUGUUU82.5122772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7722752GAGCTGTATCTTGATGTTTAAACATCAAGATACAGCTC0.063400.015300.810300.750001.000001.00000


Target Position: 2100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2100ACCCUGACCAUUCCAUUAU69.21382079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4752118ACCCTGACCATTCCATTATATAATGGAATGGTCAGGGT0.324400.023600.810300.750001.000001.00000


Target Position: 3212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3212GGAGCACACGUAGGCACAG73.53321653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6453230GGAGCACACGTAGGCACAGCTGTGCCTACGTGTGCTCC0.201000.013200.586200.750000.929300.62500


Target Position: 3018, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3018GCUUAAAGUUGUAACAAAU93.7223133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7703036GCTTAAAGTTGTAACAAATATTTGTTACAACTTTAAGC0.064000.029000.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3016-3038CTGCTTAAAGTTGTAACAAATACAUUUGUUACAACUUUAAGCAGGCUUAAAGUUGUAACAAAUACU7.21.322


Target Position: 794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
794AGAAUAAAGGAGAUUGUGA87.5821392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
897812AGAATAAAGGAGATTGTGATCACAATCTCCTTTATTCT0.066100.062700.500000.500001.000001.00000


Target Position: 1225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1225ACGUGCUCCUUUUGAUCUG62.92862622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9841243ACGTGCTCCTTTTGATCTGCAGATCAAAAGGAGCACGT0.046700.034000.491400.500001.000001.00000


Target Position: 2010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2010CAGCAAACAUGGAGAGAAU92.5794153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4372028CAGCAAACATGGAGAGAATATTCTCTCCATGTTTGCTG0.521900.027700.775900.750001.000001.00000


Target Position: 370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
370GUAUGAAAGCUUGACAGAU87.2559415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
921388GTATGAAAGCTTGACAGATATCTGTCAAGCTTTCATAC0.091500.021100.500000.750001.000001.00000


Target Position: 2432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2432UCCUCUGAUAAUAUAUUUU75.20071493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7672450TCCTCTGATAATATATTTTAAAATATATTATCAGAGGA0.079200.007600.870700.750001.000001.00000


Target Position: 854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
854GUGGAGAAGGAACGUGAUA85.3536550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
547872GTGGAGAAGGAACGTGATATATCACGTTCCTTCTCCAC0.193500.050500.750000.750001.000001.00000


Target Position: 565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
565UGCAGAUAUCUCUAUGAUU83.922642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
756583TGCAGATATCTCTATGATTAATCATAGAGATATCTGCA0.066900.022200.844800.750000.934800.75000


Target Position: 1651, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1651CCAGAAACAUAUCUAUUAU94.6696101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2011669CCAGAAACATATCTATTATATAATAGATATGTTTCTGG0.320500.263700.801701.000000.923900.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1649-1671AACCAGAAACATATCTATTATATAUAAUAGAUAUGUUUCUGGUUCCAGAAACAUAUCUAUUAUAUU8.419.212


Target Position: 197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
197GAGGAAACCCAGACCCAAG77.18721280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
730215GAGGAAACCCAGACCCAAGCTTGGGTCTGGGTTTCCTC0.153300.025000.672400.500000.918500.62500


Target Position: 2935, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2935CUACCUAAGCAUAUCGUAA95.00591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4082953CTACCTAAGCATATCGTAATTACGATATGCTTAGGTAG0.620500.077800.637900.750000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2933-2955GCCTACCTAAGCATATCGTAAAGUUACGAUAUGCUUAGGUAGGCCUACCUAAGCAUAUCGUAAAGU17.719.833


Target Position: 2177, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2177GUCAUCUUGCUUUAUGAAA83.0287726

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2175-2197TGGTCATCTTGCTTTATGAAACTUUUCAUAAAGCAAGAUGACCAGUCAUCUUGCUUUAUGAAACUU8.920.402


Target Position: 2896, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2896CCAAAGAAAAGUAUUGUUU78.43881176

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2894-2916TTCCAAAGAAAAGTATTGTTTGGAAACAAUACUUUUCUUUGGAACCAAAGAAAAGUAUUGUUUGGU6.912.222


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204AGCCCUUCUAUUUGUCCCA73.88141612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681222AGCCCTTCTATTTGTCCCATGGGACAAATAGAAGGGCT0.066400.004800.508600.500001.000001.00000


Target Position: 1900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1900CCUCUGCAAAAUCAUGAAA84.7852590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8461918CCTCTGCAAAATCATGAAATTTCATGATTTTGCAGAGG0.445900.005300.844801.000001.000001.00000


Target Position: 885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885AUGAUGAGGCUGAAGAAAA84.2457622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
630903ATGATGAGGCTGAAGAAAATTTTCTTCAGCCTCATCAT0.925400.102000.655200.500001.000001.00000


Target Position: 1023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1023AGAAGAUUAAGGAAAAGUA94.1262116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7231041AGAAGATTAAGGAAAAGTATACTTTTCCTTAATCTTCT0.582600.290400.543100.750001.000001.00000


Target Position: 2892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2892UUUUCCAAAGAAAAGUAUU64.38912510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932910TTTTCCAAAGAAAAGTATTAATACTTTTCTTTGGAAAA0.096200.012500.491400.500000.945700.62500


Target Position: 3294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3294CCACGUUGUUUUGAUGUUA88.2353354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6683312CCACGTTGTTTTGATGTTATAACATCAAAACAACGTGG0.125700.011900.810301.000001.000001.00000


Target Position: 1906, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1906CAAAAUCAUGAAAGACAUA94.4233108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5571924CAAAATCATGAAAGACATATATGTCTTTCATGATTTTG0.316300.251900.603400.750000.972800.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1904-1926TGCAAAATCATGAAAGACATATTUAUGUCUUUCAUGAUUUUGCACAAAAUCAUGAAAGACAUAUUU19.27.412


Target Position: 1917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1917AAGACAUAUUGGAGAAAAA94.745999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6521935AAGACATATTGGAGAAAAATTTTTCTCCAATATGTCTT0.408000.175900.637900.500001.000001.00000


Target Position: 2572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2572AGAGCUAGUAAUGCUUUUU76.30921390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772590AGAGCTAGTAATGCTTTTTAAAAAGCATTACTAGCTCT0.088200.002700.724100.750000.934800.75000


Target Position: 2363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2363ACAUCACGCAUGGAAGAAG67.42062252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8522381ACATCACGCATGGAAGAAGCTTCTTCCATGCGTGATGT0.198400.005200.569000.500001.000001.00000


Target Position: 428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
428CUUAUACCGAACAAACAAG70.80411912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
929446CTTATACCGAACAAACAAGCTTGTTTGTTCGGTATAAG0.244200.144400.500000.500001.000001.00000


Target Position: 2414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2414UGUUCAGUACUCUACAAUU85.5971530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5802432TGTTCAGTACTCTACAATTAATTGTAGAGTACTGAACA0.353300.016800.698300.750001.000001.00000


Target Position: 2803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2803CCCUGUAGUUGACAAUUCU85.1366565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8422821CCCTGTAGTTGACAATTCTAGAATTGTCAACTACAGGG0.067500.005500.767200.750001.000001.00000


Target Position: 2813, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2813GACAAUUCUGCAUGUACUA93.0113142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8612831GACAATTCTGCATGTACTATAGTACATGCAGAATTGTC0.046800.011700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2811-2833TTGACAATTCTGCATGTACTAGTUAGUACAUGCAGAAUUGUCAAGACAAUUCUGCAUGUACUAGUU19.014.833


Target Position: 3223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3223AGGCACAGAAAACAGGAAU72.35331773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6873241AGGCACAGAAAACAGGAATATTCCTGTTTTCTGTGCCT0.079700.015300.836200.750001.000001.00000


Target Position: 368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
368CGGUAUGAAAGCUUGACAG76.91091307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
843386CGGTATGAAAGCTTGACAGCTGTCAAGCTTTCATACCG0.127000.005400.629300.750001.000001.00000


Target Position: 325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
325GAGAGAGCUCAUUUCAAAU93.5484136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
451343GAGAGAGCTCATTTCAAATATTTGAAATGAGCTCTCTC0.445200.029600.801700.750001.000001.00000


Target Position: 2705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2705UAGACCAAAUCUUGUUAUU73.29291674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7542723TAGACCAAATCTTGTTATTAATAACAAGATTTGGTCTA0.588300.042100.663800.500000.972800.62500


Target Position: 2173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2173UCUGGUCAUCUUGCUUUAU68.65632142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6252191TCTGGTCATCTTGCTTTATATAAAGCAAGATGACCAGA0.178000.014200.681000.750001.000001.00000


Target Position: 1527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1527AGCUUGGAAUACACGAAGA83.6254674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5781545AGCTTGGAATACACGAAGATCTTCGTGTATTCCAAGCT0.130600.017000.629300.500001.000001.00000


Target Position: 1406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1406AGCAAAAUUUUGAAAGUUA89.8363264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4601424AGCAAAATTTTGAAAGTTATAACTTTCAAAATTTTGCT0.259700.025400.819000.750001.000001.00000


Target Position: 459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
459CUAUUGUGGAUACUGGAAU78.16711199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
588477CTATTGTGGATACTGGAATATTCCAGTATCCACAATAG0.242800.016200.663800.750001.000001.00000


Target Position: 2462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2462UUCUUUAUUUUUGUUAAUA73.81881619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8832480TTCTTTATTTTTGTTAATATATTAACAAAAATAAAGAA0.131400.061900.629300.500001.000001.00000


Target Position: 910, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
910CAAAGAAGAAGAAAAAGAA97.915135

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
908-930GACAAAGAAGAAGAAAAAGAAAAUUCUUUUUCUUCUUCUUUGUCCAAAGAAGAAGAAAAAGAAAAU5.510.300


Target Position: 1217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1217GUCCCACGACGUGCUCCUU73.44531659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9491235GTCCCACGACGTGCTCCTTAAGGAGCACGTCGTGGGAC0.167900.003300.681000.750000.907600.62500


Target Position: 1998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1998CAUAUGGCUGGACAGCAAA88.2316355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9822016CATATGGCTGGACAGCAAATTTGCTGTCCAGCCATATG0.037700.002600.655200.750000.945700.87500


Target Position: 1228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1228UGCUCCUUUUGAUCUGUUU71.26941878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9801246TGCTCCTTTTGATCTGTTTAAACAGATCAAAAGGAGCA0.025800.023000.853400.750001.000001.00000


Target Position: 1571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1571GAGCUGUUAAGGUACUACA94.1278115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8411589GAGCTGTTAAGGTACTACATGTAGTACCTTAACAGCTC0.095900.007300.603400.500001.000001.00000


Target Position: 2635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2635UGUAAGACGUAUGUAACAU78.30811182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8452653TGTAAGACGTATGTAACATATGTTACATACGTCTTACA0.050800.018900.551700.750001.000001.00000


Target Position: 1165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1165AGUGAAGCAUUUUUCAGUU82.0934821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7921183AGTGAAGCATTTTTCAGTTAACTGAAAAATGCTTCACT0.095300.006900.560300.750000.962000.62500


Target Position: 1440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1440UCAAAAAAUGCUUAGAACU69.82782018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9391458TCAAAAAATGCTTAGAACTAGTTCTAAGCATTTTTTGA0.039200.018700.517200.500001.000001.00000


Target Position: 2466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2466UUAUUUUUGUUAAUAUUAA82.5937765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9052484TTATTTTTGTTAATATTAATTAATATTAACAAAAATAA0.222800.092700.500000.500001.000001.00000


Target Position: 303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
303ACUCGAACAAAGAGAUCUU80.14111019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997321ACTCGAACAAAGAGATCTTAAGATCTCTTTGTTCGAGT0.024000.010600.569000.750000.967400.62500


Target Position: 1444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1444AAAAUGCUUAGAACUCUUU74.27521573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9601462AAAATGCTTAGAACTCTTTAAAGAGTTCTAAGCATTTT0.030300.006600.500000.500001.000001.00000


Target Position: 1899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1899ACCUCUGCAAAAUCAUGAA83.5109679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8701917ACCTCTGCAAAATCATGAATTCATGATTTTGCAGAGGT0.450100.004900.681000.750001.000001.00000


Target Position: 1535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1535AUACACGAAGACUCUCAAA84.0996631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8551553ATACACGAAGACTCTCAAATTTGAGAGTCTTCGTGTAT0.279000.081100.543100.500001.000001.00000


Target Position: 2924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2924AAGUUAAAAGCCUACCUAA92.9767143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7692942AAGTTAAAAGCCTACCTAATTAGGTAGGCTTTTAACTT0.314000.051500.603400.500001.000001.00000


Target Position: 2596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2596UCAUGUUGGUUUAUUUUCA81.1079921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8762614TCATGTTGGTTTATTTTCATGAAAATAAACCAACATGA0.105600.014900.500000.500001.000001.00000


Target Position: 1425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1425UCAGGAAGAAUUUGGUCAA79.96581042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6161443TCAGGAAGAATTTGGTCAATTGACCAAATTCTTCCTGA0.121500.033500.577600.750001.000001.00000


Target Position: 755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
755CACCUGAAAGAAGACCAAA87.5373396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
462773CACCTGAAAGAAGACCAAATTTGGTCTTCTTTCAGGTG0.330100.025200.793100.750001.000001.00000


Target Position: 645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
645CCAAACAUAACGAUGAUGA81.8126853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
825663CCAAACATAACGATGATGATCATCATCGTTATGTTTGG0.055500.017200.620700.750001.000001.00000


Target Position: 3103, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3103CAGUUAGUGCCAAAAUGUA95.836572

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3101-3123GACAGTTAGTGCCAAAATGTAAAUACAUUUUGGCACUAACUGUCCAGUUAGUGCCAAAAUGUAAAU5.317.633


Target Position: 1027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1027GAUUAAGGAAAAGUACAUC75.26591488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9221045GATTAAGGAAAAGTACATCGATGTACTTTTCCTTAATC0.314600.226500.500000.500001.000001.00000


Target Position: 1230, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1230CUCCUUUUGAUCUGUUUGA75.66711449

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1228-1250TGCTCCTTTTGATCTGTTTGAAAUCAAACAGAUCAAAAGGAGCACUCCUUUUGAUCUGUUUGAAAU16.718.712


Target Position: 2634, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2634CUGUAAGACGUAUGUAACA89.0621303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8182652CTGTAAGACGTATGTAACATGTTACATACGTCTTACAG0.056400.021300.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2632-2654CACTGTAAGACGTATGTAACATGUGUUACAUACGUCUUACAGUGCUGUAAGACGUAUGUAACAUGU14.620.322


Target Position: 488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
488AAGGCUGACUUGAUCAAUA92.5771154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
891506AAGGCTGACTTGATCAATATATTGATCAAGTCAGCCTT0.227500.008300.594800.500000.962000.75000


Target Position: 3043, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3043GAGUUAAAAGAUAUUGUGU86.2496487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8793061GAGTTAAAAGATATTGTGTACACAATATCTTTTAACTC0.066600.005200.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3041-3063ATGAGTTAAAAGATATTGTGTGAACACAAUAUCUUUUAACUCAUGAGUUAAAAGAUAUUGUGUGAU13.54.922


Target Position: 2374, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2374GGAAGAAGUAGACUAAUCU92.1413169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5912392GGAAGAAGTAGACTAATCTAGATTAGTCTACTTCTTCC0.098800.038900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2372-2394ATGGAAGAAGTAGACTAATCTCTAGAUUAGUCUACUUCUUCCAUGGAAGAAGUAGACUAAUCUCUU14.519.102


Target Position: 1725, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1725GGAAACAUGGCUUAGAAGU75.89461425

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1723-1745TCGGAAACATGGCTTAGAAGTGAACUUCUAAGCCAUGUUUCCGAGGAAACAUGGCUUAGAAGUGAU11.714.802


Target Position: 636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
636CUGUGAUCACCAAACAUAA97.0149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
302654CTGTGATCACCAAACATAATTATGTTTGGTGATCACAG0.739500.052000.750000.750001.000001.00000


Target Position: 3319, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3319GAAUACCUUCUGUGUUAAA95.431181

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3317-3339TGGAATACCTTCTGTGTTAAATAUUUAACACAGAAGGUAUUCCAGAAUACCUUCUGUGUUAAAUAU14.718.522


Target Position: 1513, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1513CUCUAAAAACAUAAAGCUU82.9285736

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1511-1533TTCTCTAAAAACATAAAGCTTGGAAGCUUUAUGUUUUUAGAGAACUCUAAAAACAUAAAGCUUGGU18.37.103


Target Position: 1926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1926UGGAGAAAAAAGUUGAAAA85.556536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3851944TGGAGAAAAAAGTTGAAAATTTTCAACTTTTTTCTCCA0.575200.293700.844800.750001.000001.00000


Target Position: 1631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1631UGCACCAGAAUGAAGGAGA70.88021907

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8311649TGCACCAGAATGAAGGAGATCTCCTTCATTCTGGTGCA0.180100.012800.629300.500000.967400.87500


Target Position: 896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
896GAAGAAAAGGAAGACAAAG75.90171423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
852914GAAGAAAAGGAAGACAAAGCTTTGTCTTCCTTTTCTTC0.850700.782600.534500.500001.000001.00000


Target Position: 1870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1870GCAGGAAGAGAAAAAAACA94.1436114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5441888GCAGGAAGAGAAAAAAACATGTTTTTTTCTCTTCCTGC0.333300.130900.646600.750001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781CUUGGAGGAACGAAGAAUA88.9431306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
562799CTTGGAGGAACGAAGAATATATTCTTCGTTCCTCCAAG0.259100.017700.594800.750001.000001.00000


Target Position: 1168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1168GAAGCAUUUUUCAGUUGAA99.414820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9351186GAAGCATTTTTCAGTTGAATTCAACTGAAAAATGCTTC0.103700.043200.500000.750001.000001.00000


Target Position: 1085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1085AGAAAUCCCGACGAUAUUA83.8995647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831103AGAAATCCCGACGATATTATAATATCGTCGGGATTTCT0.142300.058000.689700.750000.989101.00000


Target Position: 297, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
297CUUUCUACUCGAACAAAGA86.254486

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
295-317TACTTTCTACTCGAACAAAGAGAUCUUUGUUCGAGUAGAAAGUACUUUCUACUCGAACAAAGAGAU10.314.603


Target Position: 2839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2839AGAAAUAGGUUAAACUGAA93.9037128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6962857AGAAATAGGTTAAACTGAATTCAGTTTAACCTATTTCT0.158700.035600.551700.750001.000001.00000


Target Position: 999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
999AGGAUGGUGACAAGAAGAA83.3288698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2991017AGGATGGTGACAAGAAGAATTCTTCTTGTCACCATCCT0.689500.466900.672400.750001.000001.00000


Target Position: 1254, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1254GAAAGAAAAAGAACAACAU89.7118266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281272GAAAGAAAAAGAACAACATATGTTGTTCTTTTTCTTTC0.132400.012700.517200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1252-1274CAGAAAGAAAAAGAACAACATCAAUGUUGUUCUUUUUCUUUCUGGAAAGAAAAAGAACAACAUCAU19.35.502


Target Position: 2657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2657GUUAACUUUGUGGUCUAAA81.0062930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9042675GTTAACTTTGTGGTCTAAATTTAGACCACAAAGTTAAC0.039400.013500.646600.750001.000001.00000


Target Position: 2656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2656UGUUAACUUUGUGGUCUAA84.8021588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9372674TGTTAACTTTGTGGTCTAATTAGACCACAAAGTTAACA0.034000.011100.672400.750001.000001.00000


Target Position: 2826, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2826GUACUAGUCCUCUAGAAAU92.1294170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8902844GTACTAGTCCTCTAGAAATATTTCTAGAGGACTAGTAC0.143700.004400.672400.750000.907600.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2824-2846ATGTACTAGTCCTCTAGAAATAGAUUUCUAGAGGACUAGUACAUGUACUAGUCCUCUAGAAAUAGU11.718.833


Target Position: 3285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3285UCUUAGUGUCCACGUUGUU69.88962009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9123303TCTTAGTGTCCACGTTGTTAACAACGTGGACACTAAGA0.038100.025800.577600.750001.000001.00000


Target Position: 803, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
803GAGAUUGUGAAGAAACAUU86.727455

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
801-823AGGAGATTGTGAAGAAACATTCTAAUGUUUCUUCACAAUCUCCUGAGAUUGUGAAGAAACAUUCUU14.819.202


Target Position: 1439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1439GUCAAAAAAUGCUUAGAAC76.5611349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8261457GTCAAAAAATGCTTAGAACGTTCTAAGCATTTTTTGAC0.102500.045500.672400.500001.000001.00000


Target Position: 893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893GCUGAAGAAAAGGAAGACA84.5511610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
381911GCTGAAGAAAAGGAAGACATGTCTTCCTTTTCTTCAGC0.804100.761900.646600.750001.000001.00000


Target Position: 3287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3287UUAGUGUCCACGUUGUUUU65.69392401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8823305TTAGTGTCCACGTTGTTTTAAAACAACGTGGACACTAA0.042300.013300.534500.500001.000001.00000


Target Position: 2110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2110UUCCAUUAUUGAGACCUUA75.61811456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8302128TTCCATTATTGAGACCTTATAAGGTCTCAATAATGGAA0.066300.046600.637900.500001.000001.00000


Target Position: 913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
913AGAAGAAGAAAAAGAAAAA90.8959229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
149931AGAAGAAGAAAAAGAAAAATTTTTCTTTTTCTTCTTCT0.992800.971600.724100.750001.000001.00000


Target Position: 2955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2955GCUGUUCAAAAAUAACUCA87.9858371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4692973GCTGTTCAAAAATAACTCATGAGTTATTTTTGAACAGC0.254400.130600.629300.750001.000001.00000


Target Position: 1758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1758AGCCCAUUGAUGAGUACUG68.12892196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9131776AGCCCATTGATGAGTACTGCAGTACTCATCAATGGGCT0.037900.010100.569000.500000.929300.75000


Target Position: 955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
955ACCUGAAAUUGAAGAUGUU82.8821738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
599973ACCTGAAATTGAAGATGTTAACATCTTCAATTTCAGGT0.097500.084200.706900.750001.000001.00000


Target Position: 2102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2102CCUGACCAUUCCAUUAUUG71.36211869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5232120CCTGACCATTCCATTATTGCAATAATGGAATGGTCAGG0.251400.096900.698300.750001.000001.00000


Target Position: 1504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1504UGAGCAGUUCUCUAAAAAC72.87471708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7061522TGAGCAGTTCTCTAAAAACGTTTTTAGAGAACTGCTCA0.259300.017900.577600.500000.913000.62500


Target Position: 814, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
814GAAACAUUCUCAGUUUAUU88.3708347

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
812-834AAGAAACATTCTCAGTTTATTGGAAUAAACUGAGAAUGUUUCUUGAAACAUUCUCAGUUUAUUGGU4.65.312


Target Position: 2836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2836UCUAGAAAUAGGUUAAACU76.81231316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232854TCTAGAAATAGGTTAAACTAGTTTAACCTATTTCTAGA0.240700.026600.517200.500001.000001.00000


Target Position: 1183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1183UGAAGGACAGUUGGAAUUC57.92652913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9841201TGAAGGACAGTTGGAATTCGAATTCCAACTGTCCTTCA0.041000.002600.551700.500001.000001.00000


Target Position: 2042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2042GCCCUAAGAGACAACUCAA96.541556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7282060GCCCTAAGAGACAACTCAATTGAGTTGTCTCTTAGGGC0.072200.010000.853401.000000.907600.75000


Target Position: 588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
588AGUUCGGUGUUGGUUUUUA83.6501671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
375606AGTTCGGTGTTGGTTTTTATAAAAACCAACACCGAACT0.198200.044100.672400.750001.000001.00000


Target Position: 2006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2006UGGACAGCAAACAUGGAGA76.81031317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8962024TGGACAGCAAACATGGAGATCTCCATGTTTGCTGTCCA0.087000.004300.620700.500001.000001.00000


Target Position: 1484, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1484GAGAACUACAAGAAAUUCU81.8574847

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1482-1504AAGAGAACTACAAGAAATTCTATAGAAUUUCUUGUAGUUCUCUUGAGAACUACAAGAAAUUCUAUU10.418.902


Target Position: 644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
644ACCAAACAUAACGAUGAUG61.14032753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
783662ACCAAACATAACGATGATGCATCATCGTTATGTTTGGT0.061800.027000.698300.500001.000001.00000


Target Position: 2770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2770AUCUUGUAGGAUCUACUUU74.12641587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7972788ATCTTGTAGGATCTACTTTAAAGTAGATCCTACAAGAT0.076300.006800.681000.500000.907600.87500


Target Position: 2046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2046UAAGAGACAACUCAACAAU76.63171344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7862064TAAGAGACAACTCAACAATATTGTTGAGTTGTCTCTTA0.095300.060200.525900.500000.907600.87500


Target Position: 811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
811GAAGAAACAUUCUCAGUUU93.7331132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
660829GAAGAAACATTCTCAGTTTAAACTGAGAATGTTTCTTC0.085100.014900.672400.750000.956500.62500


Target Position: 1506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1506AGCAGUUCUCUAAAAACAU81.562875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4731524AGCAGTTCTCTAAAAACATATGTTTTTAGAGAACTGCT0.826000.173200.698300.750000.983700.75000


Target Position: 996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
996AGAAGGAUGGUGACAAGAA91.9252182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6831014AGAAGGATGGTGACAAGAATTCTTGTCACCATCCTTCT0.544400.460800.551700.750001.000001.00000


Target Position: 381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
381UGACAGAUCCCAGUAAAUU75.64381450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
875399TGACAGATCCCAGTAAATTAATTTACTGGGATCTGTCA0.043900.025600.715500.750001.000001.00000


Target Position: 2986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2986UGGAUGGAAAUGUAGUGCU68.53512156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9833004TGGATGGAAATGTAGTGCTAGCACTACATTTCCATCCA0.062800.004700.491400.500001.000001.00000


Target Position: 1251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1251ACAGAAAGAAAAAGAACAA86.8333447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7351269ACAGAAAGAAAAAGAACAATTGTTCTTTTTCTTTCTGT0.070900.009000.560300.750001.000001.00000


Target Position: 2782, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2782CUACUUUUUGAACUUUUCA81.7241860

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2780-2802ATCTACTTTTTGAACTTTTCATTUGAAAAGUUCAAAAAGUAGAUCUACUUUUUGAACUUUUCAUUU13.34.922


Target Position: 1914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1914UGAAAGACAUAUUGGAGAA88.4275338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6921932TGAAAGACATATTGGAGAATTCTCCAATATGTCTTTCA0.334600.173300.551700.750001.000001.00000


Target Position: 94, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
94CCCGUCGCUAUAUAAGGCA72.62771742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
972112CCCGTCGCTATATAAGGCATGCCTTATATAGCGACGGG0.436900.002800.637900.750000.967400.62500


Target Position: 1117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1117CGGAGAAUUCUAUAAGAGC73.79881625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7191135CGGAGAATTCTATAAGAGCGCTCTTATAGAATTCTCCG0.316100.021300.560300.500001.000001.00000


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783UGGAGGAACGAAGAAUAAA80.9561932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
445801TGGAGGAACGAAGAATAAATTTATTCTTCGTTCCTCCA0.262900.044500.844800.750001.000001.00000


Target Position: 2317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2317UGCUGCUGUAACUGAAGAA83.3675694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3352335TGCTGCTGTAACTGAAGAATTCTTCAGTTACAGCAGCA0.216700.055200.681000.750001.000001.00000


Target Position: 745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
745AGUUAUCCUACACCUGAAA84.654599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
782763AGTTATCCTACACCTGAAATTTCAGGTGTAGGATAACT0.071800.007200.706900.750000.994600.62500


Target Position: 2023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2023GAGAAUCAUGAAAGCUCAA93.9418127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8612041GAGAATCATGAAAGCTCAATTGAGCTTTCATGATTCTC0.048500.005100.663800.750001.000001.00000


Target Position: 858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
858AGAAGGAACGUGAUAAAGA87.3489410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
906876AGAAGGAACGTGATAAAGATCTTTATCACGTTCCTTCT0.291600.100800.500000.500001.000001.00000


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949AGACAAACCUGAAAUUGAA96.414358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
686967AGACAAACCTGAAATTGAATTCAATTTCAGGTTTGTCT0.274300.027100.551700.750001.000001.00000


Target Position: 3298, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3298GUUGUUUUGAUGUUAUUCA85.0991570

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3296-3318ACGTTGTTTTGATGTTATTCATGUGAAUAACAUCAAAACAACGUGUUGUUUUGAUGUUAUUCAUGU10.05.632


Target Position: 2815, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2815CAAUUCUGCAUGUACUAGU80.11271024

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2813-2835GACAATTCTGCATGTACTAGTCCACUAGUACAUGCAGAAUUGUCCAAUUCUGCAUGUACUAGUCCU18.812.032


Target Position: 1049, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049CAAGAAGAGCUCAACAAAA97.756638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001067CAAGAAGAGCTCAACAAAATTTTGTTGAGCTCTTCTTG0.947000.059100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1047-1069ATCAAGAAGAGCTCAACAAAACAUUUUGUUGAGCUCUUCUUGAUCAAGAAGAGCUCAACAAAACAU12.219.122


Target Position: 1925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1925UUGGAGAAAAAAGUUGAAA68.33492180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9081943TTGGAGAAAAAAGTTGAAATTTCAACTTTTTTCTCCAA0.638900.316400.646600.500001.000001.00000


Target Position: 917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
917GAAGAAAAAGAAAAAGAAG80.11441022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
971935GAAGAAAAAGAAAAAGAAGCTTCTTTTTCTTTTTCTTC0.978800.966200.534500.500001.000001.00000


Target Position: 2925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2925AGUUAAAAGCCUACCUAAG73.82591618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6562943AGTTAAAAGCCTACCTAAGCTTAGGTAGGCTTTTAACT0.115400.088500.569000.500001.000001.00000


Target Position: 1927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1927GGAGAAAAAAGUUGAAAAG78.08481206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4011945GGAGAAAAAAGTTGAAAAGCTTTTCAACTTTTTTCTCC0.564700.297400.732800.750001.000001.00000


Target Position: 956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
956CCUGAAAUUGAAGAUGUUG69.81142020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
859974CCTGAAATTGAAGATGTTGCAACATCTTCAATTTCAGG0.047000.030600.698300.750001.000001.00000


Target Position: 1814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1814GUGUCAGUCACCAAAGAAG77.40951258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8351832GTGTCAGTCACCAAAGAAGCTTCTTTGGTGACTGACAC0.143000.011100.655200.500001.000001.00000


Target Position: 2503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2503CAACUACUUUAAGGGGAAG70.68671922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8562521CAACTACTTTAAGGGGAAGCTTCCCCTTAAAGTAGTTG0.058400.032500.508600.500001.000001.00000


Target Position: 1260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1260AAAAGAACAACAUCAAAUU80.02781037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9661278AAAAGAACAACATCAAATTAATTTGATGTTGTTCTTTT0.112700.024900.491400.500001.000001.00000


Target Position: 1048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048UCAAGAAGAGCUCAACAAA85.873507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3781066TCAAGAAGAGCTCAACAAATTTGTTGAGCTCTTCTTGA0.197100.059300.724100.750001.000001.00000


Target Position: 857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
857GAGAAGGAACGUGAUAAAG73.78791626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
963875GAGAAGGAACGTGATAAAGCTTTATCACGTTCCTTCTC0.251100.087600.672400.500001.000001.00000


Target Position: 1111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1111GGAGUACGGAGAAUUCUAU91.7798190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8131129GGAGTACGGAGAATTCTATATAGAATTCTCCGTACTCC0.146100.006300.827601.000001.000001.00000


Target Position: 2954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2954AGCUGUUCAAAAAUAACUC67.49982244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8062972AGCTGTTCAAAAATAACTCGAGTTATTTTTGAACAGCT0.335900.085100.543100.500001.000001.00000


Target Position: 563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
563GGUGCAGAUAUCUCUAUGA96.161861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
792581GGTGCAGATATCTCTATGATCATAGAGATATCTGCACC0.060500.017700.629300.750000.934800.87500


Target Position: 795, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
795GAAUAAAGGAGAUUGUGAA100.9310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
927813GAATAAAGGAGATTGTGAATTCACAATCTCCTTTATTC0.058000.054400.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
793-815AAGAATAAAGGAGATTGTGAAGAUUCACAAUCUCCUUUAUUCUUGAAUAAAGGAGAUUGUGAAGAU20.5-4.301


Target Position: 1245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1245UUGAAAACAGAAAGAAAAA76.47631362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9491263TTGAAAACAGAAAGAAAAATTTTTCTTTCTGTTTTCAA0.276100.073800.646600.500001.000001.00000


Target Position: 489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
489AGGCUGACUUGAUCAAUAA95.132588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
303507AGGCTGACTTGATCAATAATTATTGATCAAGTCAGCCT0.241600.099900.810300.750000.962000.75000


Target Position: 1464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1464CUGAACUGGCGGAAGAUAA84.52612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2481482CTGAACTGGCGGAAGATAATTATCTTCCGCCAGTTCAG0.313700.066200.750000.750001.000001.00000


Target Position: 2937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2937ACCUAAGCAUAUCGUAAAG69.40272065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9012955ACCTAAGCATATCGTAAAGCTTTACGATATGCTTAGGT0.303800.065500.715500.500001.000001.00000


Target Position: 2454, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2454GGAUGUUUUUCUUUAUUUU91.8985184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5092472GGATGTTTTTCTTTATTTTAAAATAAAGAAAAACATCC0.130200.039300.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2452-2474AAGGATGTTTTTCTTTATTTTTGAAAAUAAAGAAAAACAUCCUUGGAUGUUUUUCUUUAUUUUUGU-9.714.801


Target Position: 2777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2777AGGAUCUACUUUUUGAACU73.12831690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8272795AGGATCTACTTTTTGAACTAGTTCAAAAAGTAGATCCT0.166200.018100.637900.500001.000001.00000


Target Position: 2294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2294GACCCUACUGCUGAUGAUA90.9668228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3242312GACCCTACTGCTGATGATATATCATCAGCAGTAGGGTC0.500300.117700.775900.750001.000001.00000


Target Position: 899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899GAAAAGGAAGACAAAGAAG78.08681205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
745917GAAAAGGAAGACAAAGAAGCTTCTTTGTCTTCCTTTTC0.860600.782400.534500.500001.000001.00000


Target Position: 1126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1126CUAUAAGAGCUUGACCAAU81.7941855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4031144CTATAAGAGCTTGACCAATATTGGTCAAGCTCTTATAG0.184900.087200.663800.750001.000001.00000


Target Position: 1476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1476AAGAUAAAGAGAACUACAA89.3996280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9871494AAGATAAAGAGAACTACAATTGTAGTTCTCTTTATCTT0.074800.003400.491400.500001.000001.00000


Target Position: 2468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2468AUUUUUGUUAAUAUUAAAA80.6058972

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8532486ATTTTTGTTAATATTAAAATTTTAATATTAACAAAAAT0.250500.091100.508600.500001.000001.00000


Target Position: 1843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1843UCCAGAGGAUGAAGAAGAG68.03012200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6681861TCCAGAGGATGAAGAAGAGCTCTTCTTCATCCTCTGGA0.821500.155900.560300.500000.994600.62500


Target Position: 2915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2915GGAGGAGCAAAGUUAAAAG81.9105839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8832933GGAGGAGCAAAGTTAAAAGCTTTTAACTTTGCTCCTCC0.226000.004500.732800.750001.000001.00000


Target Position: 2578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2578AGUAAUGCUUUUUGAGUUU76.78821320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3412596AGTAATGCTTTTTGAGTTTAAACTCAAAAAGCATTACT0.283600.044500.706900.750001.000001.00000


Target Position: 286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
286GAUCAUCAAUACUUUCUAC87.2348418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
907304GATCATCAATACTTTCTACGTAGAAAGTATTGATGATC0.263000.014400.500000.500001.000001.00000


Target Position: 272, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
272CAGUUGAUGUCAUUGAUCA97.288345

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
270-292CCCAGTTGATGTCATTGATCATCUGAUCAAUGACAUCAACUGGGCAGUUGAUGUCAUUGAUCAUCU16.219.202


Target Position: 1766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1766GAUGAGUACUGUGUCCAAC78.08331207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9361784GATGAGTACTGTGTCCAACGTTGGACACAGTACTCATC0.045500.007800.534500.500001.000001.00000


Target Position: 635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
635ACUGUGAUCACCAAACAUA88.4637336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
362653ACTGTGATCACCAAACATATATGTTTGGTGATCACAGT0.471900.040500.663800.750001.000001.00000


Target Position: 1868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1868AAGCAGGAAGAGAAAAAAA87.3532409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021886AAGCAGGAAGAGAAAAAAATTTTTTTCTCTTCCTGCTT0.343400.133400.637900.500001.000001.00000


Target Position: 2174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2174CUGGUCAUCUUGCUUUAUG68.39872172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732192CTGGTCATCTTGCTTTATGCATAAAGCAAGATGACCAG0.128500.010100.629300.500001.000001.00000


Target Position: 1499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1499UUCUAUGAGCAGUUCUCUA82.6933757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9361517TTCTATGAGCAGTTCTCTATAGAGAACTGCTCATAGAA0.159600.004000.500000.500000.913000.75000


Target Position: 3222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3222UAGGCACAGAAAACAGGAA80.27371004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9203240TAGGCACAGAAAACAGGAATTCCTGTTTTCTGTGCCTA0.165300.024600.500000.500001.000001.00000


Target Position: 1635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1635CCAGAAUGAAGGAGAACCA87.4789399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8981653CCAGAATGAAGGAGAACCATGGTTCTCCTTCATTCTGG0.110200.013600.500000.750000.972800.75000


Target Position: 1643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1643AAGGAGAACCAGAAACAUA92.9182145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6411661AAGGAGAACCAGAAACATATATGTTTCTGGTTCTCCTT0.521200.059200.594800.500000.972800.75000


Target Position: 406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
406UGGGAAAGAGCUGCAUAUU70.79271915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
520424TGGGAAAGAGCTGCATATTAATATGCAGCTCTTTCCCA0.287900.020400.836200.750001.000001.00000


Target Position: 2078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2078GCAAAGAAACACCUGGAGA85.002578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4662096GCAAAGAAACACCTGGAGATCTCCAGGTGTTTCTTTGC0.194900.200700.629300.750001.000001.00000


Target Position: 3271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3271AGUUACAUGUGUUCUCUUA92.1861166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7933289AGTTACATGTGTTCTCTTATAAGAGAACACATGTAACT0.169600.006900.672400.750001.000001.00000


Target Position: 1707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1707CCUUUGUGGAACGUCUUCG59.84582824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9801725CCTTTGTGGAACGTCTTCGCGAAGACGTTCCACAAAGG0.076900.005700.551700.500001.000001.00000


Target Position: 859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
859GAAGGAACGUGAUAAAGAA105.1262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
947877GAAGGAACGTGATAAAGAATTCTTTATCACGTTCCTTC0.317300.111100.500000.750001.000001.00000


Target Position: 407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
407GGGAAAGAGCUGCAUAUUA95.889969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
314425GGGAAAGAGCTGCATATTATAATATGCAGCTCTTTCCC0.756000.050500.956901.000001.000001.00000


Target Position: 1073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1073CCCAUCUGGACCAGAAAUC58.55032891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8721091CCCATCTGGACCAGAAATCGATTTCTGGTCCAGATGGG0.146900.004800.810300.750000.918501.00000


Target Position: 1874, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1874GAAGAGAAAAAAACAAAGU79.09331116

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1872-1894AGGAAGAGAAAAAAACAAAGTTTACUUUGUUUUUUUCUCUUCCUGAAGAGAAAAAAACAAAGUUUU10.319.111


Target Position: 3015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3015UCUGCUUAAAGUUGUAACA74.56771547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9183033TCTGCTTAAAGTTGTAACATGTTACAACTTTAAGCAGA0.052200.009500.517200.500001.000001.00000


Target Position: 1494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1494AGAAAUUCUAUGAGCAGUU78.23211191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941512AGAAATTCTATGAGCAGTTAACTGCTCATAGAATTTCT0.024300.010600.577600.750001.000001.00000


Target Position: 3033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3033AAAUACAGAUGAGUUAAAA89.6208270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9503051AAATACAGATGAGTTAAAATTTTAACTCATCTGTATTT0.031600.007100.500000.500001.000001.00000


Target Position: 2458, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2458GUUUUUCUUUAUUUUUGUU80.1351020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8852476GTTTTTCTTTATTTTTGTTAACAAAAATAAAGAAAAAC0.109000.055400.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2456-2478ATGTTTTTCTTTATTTTTGTTAAAACAAAAAUAAAGAAAAACAUGUUUUUCUUUAUUUUUGUUAAU5.65.501


Target Position: 2749, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2749GUUUAGAAAAGUAUUCGUU81.305900

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2747-2769ATGTTTAGAAAAGTATTCGTTACAACGAAUACUUUUCUAAACAUGUUUAGAAAAGUAUUCGUUACU16.57.132


Target Position: 465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
465UGGAUACUGGAAUUGGAAU74.10831592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
606483TGGATACTGGAATTGGAATATTCCAATTCCAGTATCCA0.096700.043400.836200.750001.000001.00000


Target Position: 2453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2453AGGAUGUUUUUCUUUAUUU80.6894967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6282471AGGATGTTTTTCTTTATTTAAATAAAGAAAAACATCCT0.141200.014100.844800.750001.000001.00000


Target Position: 2602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2602UGGUUUAUUUUCACAGAUU78.4051177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6242620TGGTTTATTTTCACAGATTAATCTGTGAAAATAAACCA0.093400.017300.836200.750001.000001.00000


Target Position: 323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
323CUGAGAGAGCUCAUUUCAA94.0909118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
968341CTGAGAGAGCTCATTTCAATTGAAATGAGCTCTCTCAG0.395000.002800.637900.750000.902200.62500


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779UACUUGGAGGAACGAAGAA76.64171342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
859797TACTTGGAGGAACGAAGAATTCTTCGTTCCTCCAAGTA0.285200.008000.508600.500001.000001.00000


Target Position: 3081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3081GGAAAGGGGAGUAUCUGGA83.5045681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583099GGAAAGGGGAGTATCTGGATCCAGATACTCCCCTTTCC0.085700.037500.500000.750001.000001.00000


Target Position: 384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
384CAGAUCCCAGUAAAUUAGA81.0321928

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
788402CAGATCCCAGTAAATTAGATCTAATTTACTGGGATCTG0.807600.020800.560300.500001.000001.00000


Target Position: 2402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2402GGAUGACUUACCUGUUCAG83.4224690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8972420GGATGACTTACCTGTTCAGCTGAACAGGTAAGTCATCC0.087900.004300.586200.750001.000001.00000


Target Position: 2772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2772CUUGUAGGAUCUACUUUUU83.4939683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8872790CTTGTAGGATCTACTTTTTAAAAAGTAGATCCTACAAG0.109400.004400.637900.750000.907600.87500


Target Position: 1617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1617CUCUCAAGGACUACUGCAC69.70112029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8781635CTCTCAAGGACTACTGCACGTGCAGTAGTCCTTGAGAG0.066000.004600.517200.500001.000001.00000


Target Position: 1896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1896AGAACCUCUGCAAAAUCAU76.98991302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8981914AGAACCTCTGCAAAATCATATGATTTTGCAGAGGTTCT0.385300.004300.569000.750001.000001.00000


Target Position: 2769, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2769CAUCUUGUAGGAUCUACUU86.361480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8842787CATCTTGTAGGATCTACTTAAGTAGATCCTACAAGATG0.042700.004500.517200.750000.907600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2767-2789TACATCTTGTAGGATCTACTTTTAAGUAGAUCCUACAAGAUGUACAUCUUGUAGGAUCUACUUUUU18.919.232


Target Position: 2463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2463UCUUUAUUUUUGUUAAUAU81.8471848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4552481TCTTTATTTTTGTTAATATATATTAACAAAAATAAAGA0.154000.068800.681000.750001.000001.00000


Target Position: 1009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1009CAAGAAGAAGAAGAAGAAG75.09711507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8601027CAAGAAGAAGAAGAAGAAGCTTCTTCTTCTTCTTCTTG0.646800.649800.508600.500001.000001.00000


Target Position: 2591, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2591GAGUUUCAUGUUGGUUUAU80.03811034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7862609GAGTTTCATGTTGGTTTATATAAACCAACATGAAACTC0.061600.018600.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2589-2611TTGAGTTTCATGTTGGTTTATTTAUAAACCAACAUGAAACUCAAGAGUUUCAUGUUGGUUUAUUUU20.019.222


Target Position: 331, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
331GCUCAUUUCAAAUUCAUCA88.8148316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473349GCTCATTTCAAATTCATCATGATGAATTTGAAATGAGC0.242200.089000.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
329-351GAGCTCATTTCAAATTCATCAGAUGAUGAAUUUGAAAUGAGCUCGCUCAUUUCAAAUUCAUCAGAU16.212.002


Target Position: 2727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2727GUGUUCUGAGCUGUAUCUU75.42821468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7272745GTGTTCTGAGCTGTATCTTAAGATACAGCTCAGAACAC0.578300.009000.655200.750001.000001.00000


Target Position: 1637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1637AGAAUGAAGGAGAACCAGA84.9977579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8771655AGAATGAAGGAGAACCAGATCTGGTTCTCCTTCATTCT0.272300.080400.500000.500000.972800.87500


Target Position: 1570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1570AGAGCUGUUAAGGUACUAC70.8691909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9211588AGAGCTGTTAAGGTACTACGTAGTACCTTAACAGCTCT0.073500.003900.543100.500001.000001.00000


Target Position: 3282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3282UUCUCUUAGUGUCCACGUU69.19652083

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9223300TTCTCTTAGTGTCCACGTTAACGTGGACACTAAGAGAA0.036800.020700.525900.500001.000001.00000


Target Position: 834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
834GAUAUCCCAUUACUCUUUU81.3612896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
838852GATATCCCATTACTCTTTTAAAAGAGTAATGGGATATC0.066300.005600.681000.750001.000001.00000


Target Position: 3139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3139AGGAGAUGGUUAAACACUA94.0778119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7663157AGGAGATGGTTAAACACTATAGTGTTTAACCATCTCCT0.065600.010900.672400.750001.000001.00000


Target Position: 367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
367CCGGUAUGAAAGCUUGACA83.7171663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
941385CCGGTATGAAAGCTTGACATGTCAAGCTTTCATACCGG0.131000.003500.706900.750001.000001.00000


Target Position: 802, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
802GGAGAUUGUGAAGAAACAU87.9063379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
996820GGAGATTGTGAAGAAACATATGTTTCTTCACAATCTCC0.024200.004900.715501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
800-822AAGGAGATTGTGAAGAAACATTCAUGUUUCUUCACAAUCUCCUUGGAGAUUGUGAAGAAACAUUCU19.220.402


Target Position: 945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
945CGGAAGACAAACCUGAAAU81.5074883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
667963CGGAAGACAAACCTGAAATATTTCAGGTTTGTCTTCCG0.183600.012000.905201.000000.956500.75000


Target Position: 2948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2948UCGUAAAGCUGUUCAAAAA87.0409435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1522966TCGTAAAGCTGTTCAAAAATTTTTGAACAGCTTTACGA0.652800.156600.793100.750001.000001.00000


Target Position: 2646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2646UGUAACAUGAUGUUAACUU73.33991666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7352664TGTAACATGATGTTAACTTAAGTTAACATCATGTTACA0.083600.008700.569000.750000.956500.75000


Target Position: 2231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2231CCCCAGACACAUGCUAACA80.7922952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5462249CCCCAGACACATGCTAACATGTTAGCATGTGTCTGGGG0.114400.062200.784500.750001.000001.00000


Target Position: 1284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1284UACGCAGAGUUUUCAUCAU77.76331234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9381302TACGCAGAGTTTTCATCATATGATGAAAACTCTGCGTA0.042000.030300.525900.500001.000001.00000


Target Position: 1281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1281AUGUACGCAGAGUUUUCAU73.88651611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9591299ATGTACGCAGAGTTTTCATATGAAAACTCTGCGTACAT0.057400.012700.500000.500001.000001.00000


Target Position: 1633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1633CACCAGAAUGAAGGAGAAC67.54622241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6571651CACCAGAATGAAGGAGAACGTTCTCCTTCATTCTGGTG0.142900.012500.646600.500000.967400.75000


Target Position: 1848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1848AGGAUGAAGAAGAGAAAAA87.5851391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411866AGGATGAAGAAGAGAAAAATTTTTCTCTTCTTCATCCT0.919700.710200.844800.750001.000001.00000


Target Position: 903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
903AGGAAGACAAAGAAGAAGA82.1018820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
750921AGGAAGACAAAGAAGAAGATCTTCTTCTTTGTCTTCCT0.972200.834900.620700.500001.000001.00000


Target Position: 2098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2098AAACCCUGACCAUUCCAUU74.5291550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9632116AAACCCTGACCATTCCATTAATGGAATGGTCAGGGTTT0.165600.020100.491400.500001.000001.00000


Target Position: 2464, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2464CUUUAUUUUUGUUAAUAUU84.7258595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4702482CTTTATTTTTGTTAATATTAATATTAACAAAAATAAAG0.204600.077400.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2462-2484TTCTTTATTTTTGTTAATATTAAAAUAUUAACAAAAAUAAAGAACUUUAUUUUUGUUAAUAUUAAU-8.0-9.702


Target Position: 2511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2511UUAAGGGGAAGAUAAGAUU68.86762120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9272529TTAAGGGGAAGATAAGATTAATCTTATCTTCCCCTTAA0.051200.012700.525900.500001.000001.00000


Target Position: 1232, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1232CCUUUUGAUCUGUUUGAAA91.1497217

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1230-1252CTCCTTTTGATCTGTTTGAAAACUUUCAAACAGAUCAAAAGGAGCCUUUUGAUCUGUUUGAAAACU14.912.212


Target Position: 2827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2827UACUAGUCCUCUAGAAAUA88.2088357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9552845TACTAGTCCTCTAGAAATATATTTCTAGAGGACTAGTA0.030800.004000.637900.500000.907600.75000


Target Position: 916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
916AGAAGAAAAAGAAAAAGAA91.8974185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
705934AGAAGAAAAAGAAAAAGAATTCTTTTTCTTTTTCTTCT0.989300.978200.551700.750001.000001.00000


Target Position: 746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
746GUUAUCCUACACCUGAAAG68.68192137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
858764GTTATCCTACACCTGAAAGCTTTCAGGTGTAGGATAAC0.081200.008600.508600.500001.000001.00000


Target Position: 1652, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1652CAGAAACAUAUCUAUUAUA100.39414

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1650-1672ACCAGAAACATATCTATTATATCUAUAAUAGAUAUGUUUCUGGUCAGAAACAUAUCUAUUAUAUCU-2.719.211


Target Position: 2541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2541AGUGAUGCUGUGAUACCUU82.4937775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7912559AGTGATGCTGTGATACCTTAAGGTATCACAGCATCACT0.137100.006900.569000.750001.000001.00000


Target Position: 2320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2320UGCUGUAACUGAAGAAAUG72.03631801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6252338TGCTGTAACTGAAGAAATGCATTTCTTCAGTTACAGCA0.491400.050300.698300.500001.000001.00000


Target Position: 2825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2825UGUACUAGUCCUCUAGAAA89.5269277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9572843TGTACTAGTCCTCTAGAAATTTCTAGAGGACTAGTACA0.030700.005600.706900.750000.907600.87500


Target Position: 2112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2112CCAUUAUUGAGACCUUAAG72.44351764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9112130CCATTATTGAGACCTTAAGCTTAAGGTCTCAATAATGG0.038300.027400.706900.750001.000001.00000


Target Position: 3007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3007AGUCACAUUCUGCUUAAAG70.74331919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8473025AGTCACATTCTGCTTAAAGCTTTAAGCAGAATGTGACT0.050000.008600.569000.500001.000001.00000


Target Position: 1253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1253AGAAAGAAAAAGAACAACA85.8616509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8301271AGAAAGAAAAAGAACAACATGTTGTTCTTTTTCTTTCT0.060400.014200.517200.500001.000001.00000


Target Position: 2703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2703AGUAGACCAAAUCUUGUUA87.3849408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4162721AGTAGACCAAATCTTGTTATAACAAGATTTGGTCTACT0.278300.030400.672400.750000.972800.87500


Target Position: 2565, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2565CUAAAGCAGAGCUAGUAAU82.7748748

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2563-2585CACTAAAGCAGAGCTAGTAATGCAUUACUAGCUCUGCUUUAGUGCUAAAGCAGAGCUAGUAAUGCU11.319.732


Target Position: 863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
863GAACGUGAUAAAGAAGUAA93.8608129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
541881GAACGTGATAAAGAAGTAATTACTTCTTTATCACGTTC0.115700.029100.637900.750001.000001.00000


Target Position: 2536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2536UACUAAGUGAUGCUGUGAU76.39591380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9392554TACTAAGTGATGCTGTGATATCACAGCATCACTTAGTA0.112200.003500.500000.500001.000001.00000


Target Position: 1242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1242UGUUUGAAAACAGAAAGAA78.84161142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7621260TGTTTGAAAACAGAAAGAATTCTTTCTGTTTTCAAACA0.136700.026700.534500.750001.000001.00000


Target Position: 868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
868UGAUAAAGAAGUAAGCGAU82.0568825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
833886TGATAAAGAAGTAAGCGATATCGCTTACTTCTTTATCA0.053500.026700.543100.750001.000001.00000


Target Position: 1641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1641UGAAGGAGAACCAGAAACA81.6298868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8991659TGAAGGAGAACCAGAAACATGTTTCTGGTTCTCCTTCA0.332800.063200.517200.500000.972801.00000


Target Position: 2172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2172AUCUGGUCAUCUUGCUUUA84.014635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7482190ATCTGGTCATCTTGCTTTATAAAGCAAGATGACCAGAT0.173900.013000.646600.500001.000001.00000


Target Position: 2316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2316GUGCUGCUGUAACUGAAGA84.5527609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952334GTGCTGCTGTAACTGAAGATCTTCAGTTACAGCAGCAC0.206600.041900.569000.500001.000001.00000


Target Position: 2801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2801UUCCCUGUAGUUGACAAUU61.19372746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7552819TTCCCTGTAGTTGACAATTAATTGTCAACTACAGGGAA0.710000.007900.663800.500001.000001.00000


Target Position: 464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
464GUGGAUACUGGAAUUGGAA89.7735265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
516482GTGGATACTGGAATTGGAATTCCAATTCCAGTATCCAC0.211700.055500.620700.750001.000001.00000


Target Position: 833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833GGAUAUCCCAUUACUCUUU85.8338513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
812851GGATATCCCATTACTCTTTAAAGAGTAATGGGATATCC0.070600.006300.870701.000001.000001.00000


Target Position: 1033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1033GGAAAAGUACAUCGAUCAA97.152547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7761051GGAAAAGTACATCGATCAATTGATCGATGTACTTTTCC0.062900.051600.724101.000001.000001.00000


Target Position: 2590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2590UGAGUUUCAUGUUGGUUUA83.6812667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8382608TGAGTTTCATGTTGGTTTATAAACCAACATGAAACTCA0.052300.016300.689700.750001.000001.00000


Target Position: 882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
882GCGAUGAUGAGGCUGAAGA82.3389789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
477900GCGATGATGAGGCTGAAGATCTTCAGCCTCATCATCGC0.143400.076000.698300.750001.000001.00000


Target Position: 2737, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2737CUGUAUCUUGAUGUUUAGA81.5443880

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2735-2757AGCTGTATCTTGATGTTTAGAAAUCUAAACAUCAAGAUACAGCUCUGUAUCUUGAUGUUUAGAAAU11.820.322


Target Position: 2020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2020GGAGAGAAUCAUGAAAGCU85.0049576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9852038GGAGAGAATCATGAAAGCTAGCTTTCATGATTCTCTCC0.025100.005100.517200.750001.000001.00000


Target Position: 1388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1388CGUGAGAUGUUGCAACAAA98.612127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8951406CGTGAGATGTTGCAACAAATTTGTTGCAACATCTCACG0.040800.005900.775901.000001.000001.00000


Target Position: 424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
424UAACCUUAUACCGAACAAA80.26871006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
944442TAACCTTATACCGAACAAATTTGTTCGGTATAAGGTTA0.375600.299900.534500.500001.000001.00000


Target Position: 1528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1528GCUUGGAAUACACGAAGAC72.09841794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7721546GCTTGGAATACACGAAGACGTCTTCGTGTATTCCAAGC0.131600.017700.534500.750001.000001.00000


Target Position: 1639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1639AAUGAAGGAGAACCAGAAA86.0444498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9221657AATGAAGGAGAACCAGAAATTTCTGGTTCTCCTTCATT0.331400.072800.508600.500000.972801.00000


Target Position: 1267, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1267CAACAUCAAAUUGUAUGUA89.2903285

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1265-1287AACAACATCAAATTGTATGTACGUACAUACAAUUUGAUGUUGUUCAACAUCAAAUUGUAUGUACGU20.420.503


Target Position: 2847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2847GUUAAACUGAAGCAACUUG70.54261941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9542865GTTAAACTGAAGCAACTTGCAAGTTGCTTCAGTTTAAC0.030900.012000.500000.500001.000001.00000


Target Position: 1503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1503AUGAGCAGUUCUCUAAAAA84.258621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5901521ATGAGCAGTTCTCTAAAAATTTTTAGAGAACTGCTCAT0.232400.016100.655200.500000.913000.75000


Target Position: 2284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2284UGAUGAAGAUGACCCUACU82.7953744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8702302TGATGAAGATGACCCTACTAGTAGGGTCATCTTCATCA0.152200.062200.517200.500001.000001.00000


Target Position: 809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
809GUGAAGAAACAUUCUCAGU79.0381123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
786827GTGAAGAAACATTCTCAGTACTGAGAATGTTTCTTCAC0.067200.007200.586200.500000.956500.75000


Target Position: 415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
415GCUGCAUAUUAACCUUAUA97.555441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
64433GCTGCATATTAACCTTATATATAAGGTTAATATGCAGC0.814100.619800.810301.000001.000001.00000


Target Position: 2543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2543UGAUGCUGUGAUACCUUAG69.22932077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8202561TGATGCTGTGATACCTTAGCTAAGGTATCACAGCATCA0.152600.005900.551700.500001.000001.00000


Target Position: 1125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1125UCUAUAAGAGCUUGACCAA83.5488678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6131143TCTATAAGAGCTTGACCAATTGGTCAAGCTCTTATAGA0.188700.099800.577600.750001.000001.00000


Target Position: 1683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1683CCAAGGACCAGGUAGCUAA91.526199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7101701CCAAGGACCAGGTAGCTAATTAGCTACCTGGTCCTTGG0.078300.009800.810301.000000.978300.75000


Target Position: 1626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1626ACUACUGCACCAGAAUGAA83.215709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7461644ACTACTGCACCAGAATGAATTCATTCTGGTGCAGTAGT0.142500.027200.534500.750001.000001.00000


Target Position: 3295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3295CACGUUGUUUUGAUGUUAU86.1152492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5703313CACGTTGTTTTGATGTTATATAACATCAAAACAACGTG0.127500.017400.750000.750001.000001.00000


Target Position: 210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
210CCCAAGACCAACCGAUGGA72.67091733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
884228CCCAAGACCAACCGATGGATCCATCGGTTGGTCTTGGG0.042200.021400.620700.750000.913000.62500


Target Position: 1400, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1400CAACAAAGCAAAAUUUUGA87.2309419

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1398-1420TGCAACAAAGCAAAATTTTGAAAUCAAAAUUUUGCUUUGUUGCACAACAAAGCAAAAUUUUGAAAU-3.310.311


Target Position: 1323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1323UCCCUGAAUAUCUGAACUU69.44892060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3871341TCCCTGAATATCTGAACTTAAGTTCAGATATTCAGGGA0.193700.049000.732800.750001.000001.00000


Target Position: 3006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3006GAGUCACAUUCUGCUUAAA97.658740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8553024GAGTCACATTCTGCTTAAATTTAAGCAGAATGTGACTC0.047800.006000.810300.750001.000001.00000


Target Position: 3348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3348UAAUUCCUUGGCCUUAAAA75.19341494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7713366TAATTCCTTGGCCTTAAAATTTTAAGGCCAAGGAATTA0.939400.106100.534500.500001.000001.00000


Target Position: 1052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1052GAAGAGCUCAACAAAACAA96.538957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8091070GAAGAGCTCAACAAAACAATTGTTTTGTTGAGCTCTTC0.966700.069100.525900.750000.951100.75000


Target Position: 3284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3284CUCUUAGUGUCCACGUUGU76.44971368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9163302CTCTTAGTGTCCACGTTGTACAACGTGGACACTAAGAG0.037700.027400.603400.500001.000001.00000


Target Position: 1850, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1850GAUGAAGAAGAGAAAAAGA94.874494

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1848-1870AGGATGAAGAAGAGAAAAAGAAGUCUUUUUCUCUUCUUCAUCCUGAUGAAGAAGAGAAAAAGAAGU5.520.411


Target Position: 2293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2293UGACCCUACUGCUGAUGAU80.6973963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7312311TGACCCTACTGCTGATGATATCATCAGCAGTAGGGTCA0.443700.108800.543100.750001.000001.00000


Target Position: 2809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2809AGUUGACAAUUCUGCAUGU83.068723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9192827AGTTGACAATTCTGCATGTACATGCAGAATTGTCAACT0.074600.017600.500000.500001.000001.00000


Target Position: 2278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2278GGGUAUUGAUGAAGAUGAC83.5077680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6692296GGGTATTGATGAAGATGACGTCATCTTCATCAATACCC0.097300.011800.672400.750001.000001.00000


Target Position: 377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
377AGCUUGACAGAUCCCAGUA85.1958560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
936395AGCTTGACAGATCCCAGTATACTGGGATCTGTCAAGCT0.034200.021700.672400.750001.000001.00000


Target Position: 25, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
25CGGCGGCUGGGGAGGGUUC55.2733044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86043CGGCGGCTGGGGAGGGTTCGAACCCTCCCCAGCCGCCG0.099500.005100.741400.750001.000001.00000


Target Position: 2239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2239ACAUGCUAACAGGAUCUAC68.31012181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9472257ACATGCTAACAGGATCTACGTAGATCCTGTTAGCATGT0.061700.003300.525900.500001.000001.00000


Target Position: 805, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
805GAUUGUGAAGAAACAUUCU86.9702441

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
803-825GAGATTGTGAAGAAACATTCTCAAGAAUGUUUCUUCACAAUCUCGAUUGUGAAGAAACAUUCUCAU14.820.502


Target Position: 1508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1508CAGUUCUCUAAAAACAUAA90.8166233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171526CAGTTCTCTAAAAACATAATTATGTTTTTAGAGAACTG0.882700.186700.750000.750000.983700.75000


Target Position: 1114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1114GUACGGAGAAUUCUAUAAG76.54791350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8371132GTACGGAGAATTCTATAAGCTTATAGAATTCTCCGTAC0.219000.016700.543100.500001.000001.00000


Target Position: 2639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2639AGACGUAUGUAACAUGAUG78.73751151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772657AGACGTATGTAACATGATGCATCATGTTACATACGTCT0.026400.007800.569000.500000.983700.75000


Target Position: 2291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2291GAUGACCCUACUGCUGAUG63.19132602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8942309GATGACCCTACTGCTGATGCATCAGCAGTAGGGTCATC0.362400.089800.525900.500001.000001.00000


Target Position: 412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
412AGAGCUGCAUAUUAACCUU85.6732527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
572430AGAGCTGCATATTAACCTTAAGGTTAATATGCAGCTCT0.797300.165400.586200.750001.000001.00000


Target Position: 730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730GGGUCGUGGAACAAAAGUU85.5165540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
959748GGGTCGTGGAACAAAAGTTAACTTTTGTTCCACGACCC0.300400.003000.844801.000001.000001.00000


Target Position: 2647, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2647GUAACAUGAUGUUAACUUU92.6089151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7472665GTAACATGATGTTAACTTTAAAGTTAACATCATGTTAC0.087600.008400.681000.750000.956500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2645-2667ATGTAACATGATGTTAACTTTGTAAAGUUAACAUCAUGUUACAUGUAACAUGAUGUUAACUUUGUU4.913.513


Target Position: 3283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3283UCUCUUAGUGUCCACGUUG61.95882681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9263301TCTCTTAGTGTCCACGTTGCAACGTGGACACTAAGAGA0.036400.021400.577600.500001.000001.00000


Target Position: 3112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3112CCAAAAUGUAAAACAUGAG74.11361590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7563130CCAAAATGTAAAACATGAGCTCATGTTTTACATTTTGG0.088400.027800.534500.750001.000001.00000


Target Position: 2800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2800AUUCCCUGUAGUUGACAAU71.12411890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9342818ATTCCCTGTAGTTGACAATATTGTCAACTACAGGGAAT0.710700.008700.500000.500001.000001.00000


Target Position: 2319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2319CUGCUGUAACUGAAGAAAU83.2297706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4412337CTGCTGTAACTGAAGAAATATTTCTTCAGTTACAGCAG0.162200.050800.775900.750001.000001.00000


Target Position: 1847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1847GAGGAUGAAGAAGAGAAAA91.1195220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3951865GAGGATGAAGAAGAGAAAATTTTCTCTTCTTCATCCTC0.931700.677500.810300.750001.000001.00000


Target Position: 1902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1902UCUGCAAAAUCAUGAAAGA80.7224960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8781920TCTGCAAAATCATGAAAGATCTTTCATGATTTTGCAGA0.386500.024200.500000.500001.000001.00000


Target Position: 2238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2238CACAUGCUAACAGGAUCUA83.2438705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9242256CACATGCTAACAGGATCTATAGATCCTGTTAGCATGTG0.072600.003800.620700.750001.000001.00000


Target Position: 2370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2370GCAUGGAAGAAGUAGACUA98.918526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4402388GCATGGAAGAAGTAGACTATAGTCTACTTCTTCCATGC0.313500.027400.681001.000001.000001.00000


Target Position: 2890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2890UGUUUUCCAAAGAAAAGUA81.4932886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8132908TGTTTTCCAAAGAAAAGTATACTTTTCTTTGGAAAACA0.157200.009000.525900.750000.913000.62500


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682ACCAAGGACCAGGUAGCUA76.59071348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9621700ACCAAGGACCAGGTAGCTATAGCTACCTGGTCCTTGGT0.029600.009800.681000.750000.902200.62500


Target Position: 2589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2589UUGAGUUUCAUGUUGGUUU65.10442448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8602607TTGAGTTTCATGTTGGTTTAAACCAACATGAAACTCAA0.046800.017900.646600.500001.000001.00000


Target Position: 1417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1417GAAAGUUAUCAGGAAGAAU89.2612288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7061435GAAAGTTATCAGGAAGAATATTCTTCCTGATAACTTTC0.076400.029000.663800.750001.000001.00000


Target Position: 2117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2117AUUGAGACCUUAAGGCAAA80.9532933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672135ATTGAGACCTTAAGGCAAATTTGCCTTAAGGTCTCAAT0.085800.009300.508600.500000.934800.87500


Target Position: 3030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3030AACAAAUACAGAUGAGUUA87.09432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9753048AACAAATACAGATGAGTTATAACTCATCTGTATTTGTT0.171900.049100.612100.500001.000001.00000


Target Position: 2576, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2576CUAGUAAUGCUUUUUGAGU76.81741315

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2574-2596AGCTAGTAATGCTTTTTGAGTTTACUCAAAAAGCAUUACUAGCUCUAGUAAUGCUUUUUGAGUUUU12.26.312


Target Position: 1243, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1243GUUUGAAAACAGAAAGAAA98.191231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521261GTTTGAAAACAGAAAGAAATTTCTTTCTGTTTTCAAAC0.156400.040800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1241-1263CTGTTTGAAAACAGAAAGAAAAAUUUCUUUCUGUUUUCAAACAGGUUUGAAAACAGAAAGAAAAAU14.87.701


Target Position: 889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
889UGAGGCUGAAGAAAAGGAA78.8751139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
682907TGAGGCTGAAGAAAAGGAATTCCTTTTCTTCAGCCTCA0.853400.131300.551700.750001.000001.00000


Target Position: 3332, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3332GUUAAAUACAGUCACUUAA91.6461196

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3330-3352GTGTTAAATACAGTCACTTAATTUUAAGUGACUGUAUUUAACACGUUAAAUACAGUCACUUAAUUU20.3-7.523


Target Position: 950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
950GACAAACCUGAAAUUGAAG75.17351500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
951968GACAAACCTGAAATTGAAGCTTCAATTTCAGGTTTGTC0.281700.107900.681000.500001.000001.00000


Target Position: 330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
330AGCUCAUUUCAAAUUCAUC73.31641670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
815348AGCTCATTTCAAATTCATCGATGAATTTGAAATGAGCT0.264500.094700.672400.500001.000001.00000


Target Position: 2636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2636GUAAGACGUAUGUAACAUG80.8519948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8782654GTAAGACGTATGTAACATGCATGTTACATACGTCTTAC0.047700.015000.525900.500000.983700.62500


Target Position: 2780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2780AUCUACUUUUUGAACUUUU71.96381810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7532798ATCTACTTTTTGAACTTTTAAAAGTTCAAAAAGTAGAT0.310800.050900.681000.500001.000001.00000


Target Position: 2083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2083GAAACACCUGGAGAUAAAC74.28861571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7872101GAAACACCTGGAGATAAACGTTTATCTCCAGGTGTTTC0.400700.155100.525900.500001.000001.00000


Target Position: 1437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1437UGGUCAAAAAAUGCUUAGA73.30011671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531455TGGTCAAAAAATGCTTAGATCTAAGCATTTTTTGACCA0.162900.060300.620700.500001.000001.00000


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766AGACCAAACUGAGUACUUG77.61961246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
943784AGACCAAACTGAGTACTTGCAAGTACTCAGTTTGGTCT0.032700.016200.577600.500001.000001.00000


Target Position: 867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
867GUGAUAAAGAAGUAAGCGA85.8064520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
879885GTGATAAAGAAGTAAGCGATCGCTTACTTCTTTATCAC0.056400.021500.500000.500001.000001.00000


Target Position: 1218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1218UCCCACGACGUGCUCCUUU59.0682867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5501236TCCCACGACGTGCTCCTTTAAAGGAGCACGTCGTGGGA0.149900.119500.870700.750000.983700.87500


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590UUCGGUGUUGGUUUUUAUU63.27852596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
714608TTCGGTGTTGGTTTTTATTAATAAAAACCAACACCGAA0.260400.052900.663800.500001.000001.00000


Target Position: 1163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1163GCAGUGAAGCAUUUUUCAG76.11671407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9871181GCAGTGAAGCATTTTTCAGCTGAAAAATGCTTCACTGC0.094500.002600.569000.750000.962000.62500


Target Position: 3111, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3111GCCAAAAUGUAAAACAUGA88.8575313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5873129GCCAAAATGTAAAACATGATCATGTTTTACATTTTGGC0.100400.038200.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3109-3131GTGCCAAAATGTAAAACATGAGGUCAUGUUUUACAUUUUGGCACGCCAAAAUGUAAAACAUGAGGU12.111.322


Target Position: 733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
733UCGUGGAACAAAAGUUAUC59.35712846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
695751TCGTGGAACAAAAGTTATCGATAACTTTTGTTCCACGA0.121100.010200.612100.500001.000001.00000


Target Position: 1196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1196GAAUUCAGAGCCCUUCUAU87.0197439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9641214GAATTCAGAGCCCTTCTATATAGAAGGGCTCTGAATTC0.103600.002900.629300.750000.994600.62500


Target Position: 291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
291UCAAUACUUUCUACUCGAA85.3289553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
702309TCAATACTTTCTACTCGAATTCGAGTAGAAAGTATTGA0.198100.033300.551700.750000.989100.62500


Target Position: 3082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3082GAAAGGGGAGUAUCUGGAU85.2199559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9883100GAAAGGGGAGTATCTGGATATCCAGATACTCCCCTTTC0.092700.038700.491400.750001.000001.00000


Target Position: 2185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2185GCUUUAUGAAACUGCGCUC69.6672033

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7192203GCTTTATGAAACTGCGCTCGAGCGCAGTTTCATAAAGC0.142900.065400.543100.750001.000001.00000


Target Position: 1908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1908AAAUCAUGAAAGACAUAUU87.0946430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9721926AAATCATGAAAGACATATTAATATGTCTTTCATGATTT0.222600.180700.491400.500000.972800.75000


Target Position: 2457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2457UGUUUUUCUUUAUUUUUGU68.34482177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9032475TGTTTTTCTTTATTTTTGTACAAAAATAAAGAAAAACA0.113300.054200.500000.500001.000001.00000


Target Position: 1507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1507GCAGUUCUCUAAAAACAUA98.18932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
941525GCAGTTCTCTAAAAACATATATGTTTTTAGAGAACTGC0.822900.176400.810301.000000.983700.75000


Target Position: 1166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1166GUGAAGCAUUUUUCAGUUG69.80062021

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9311184GTGAAGCATTTTTCAGTTGCAACTGAAAAATGCTTCAC0.083600.014900.646600.500000.962000.62500


Target Position: 1221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1221CACGACGUGCUCCUUUUGA77.12821286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9741239CACGACGTGCTCCTTTTGATCAAAAGGAGCACGTCGTG0.164700.114000.569000.500001.000001.00000


Target Position: 1020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1020AGAAGAAGAUUAAGGAAAA94.958993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2291038AGAAGAAGATTAAGGAAAATTTTCCTTAATCTTCTTCT0.449800.346500.724100.750001.000001.00000


Target Position: 1878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1878AGAAAAAAACAAAGUUUGA82.4396780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9041896AGAAAAAAACAAAGTTTGATCAAACTTTGTTTTTTTCT0.203300.153500.500000.500001.000001.00000


Target Position: 1007, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1007GACAAGAAGAAGAAGAAGA88.5484326

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1005-1027GTGACAAGAAGAAGAAGAAGAAGUCUUCUUCUUCUUCUUGUCACGACAAGAAGAAGAAGAAGAAGU19.119.201


Target Position: 1233, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1233CUUUUGAUCUGUUUGAAAA91.8759186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8781251CTTTTGATCTGTTTGAAAATTTTCAAACAGATCAAAAG0.042900.005700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1231-1253TCCTTTTGATCTGTTTGAAAACAUUUUCAAACAGAUCAAAAGGACUUUUGAUCUGUUUGAAAACAU7.77.412


Target Position: 1918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1918AGACAUAUUGGAGAAAAAA88.8805309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2911936AGACATATTGGAGAAAAAATTTTTTCTCCAATATGTCT0.419800.186700.724100.750001.000001.00000


Target Position: 587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
587CAGUUCGGUGUUGGUUUUU67.9612205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484605CAGTTCGGTGTTGGTTTTTAAAAACCAACACCGAACTG0.241100.022600.784500.750001.000001.00000


Target Position: 1277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1277UUGUAUGUACGCAGAGUUU71.67921836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8051295TTGTATGTACGCAGAGTTTAAACTCTGCGTACATACAA0.099500.006500.646600.500001.000001.00000


Target Position: 3217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3217ACACGUAGGCACAGAAAAC71.96981809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9353235ACACGTAGGCACAGAAAACGTTTTCTGTGCCTACGTGT0.273700.050600.560300.500001.000001.00000


Target Position: 791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791CGAAGAAUAAAGGAGAUUG75.68831447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
732809CGAAGAATAAAGGAGATTGCAATCTCCTTTATTCTTCG0.071600.072600.646600.750001.000001.00000


Target Position: 3290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3290GUGUCCACGUUGUUUUGAU83.914644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7613308GTGTCCACGTTGTTTTGATATCAAAACAACGTGGACAC0.097300.007700.612100.750001.000001.00000


Target Position: 820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820UUCUCAGUUUAUUGGAUAU76.36921385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
925838TTCTCAGTTTATTGGATATATATCCAATAAACTGAGAA0.047900.011700.629300.500001.000001.00000


Target Position: 1845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1845CAGAGGAUGAAGAAGAGAA96.704652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5251863CAGAGGATGAAGAAGAGAATTCTCTTCTTCATCCTCTG0.874100.547900.612100.750001.000001.00000


Target Position: 3293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3293UCCACGUUGUUUUGAUGUU67.30612265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7463311TCCACGTTGTTTTGATGTTAACATCAAAACAACGTGGA0.136100.008400.724100.750001.000001.00000


Target Position: 2784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2784ACUUUUUGAACUUUUCAUU72.64851739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2772802ACTTTTTGAACTTTTCATTAATGAAAAGTTCAAAAAGT0.416600.106500.698300.750001.000001.00000


Target Position: 1653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1653AGAAACAUAUCUAUUAUAU89.5586274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2661671AGAAACATATCTATTATATATATAATAGATATGTTTCT0.322100.270400.681000.750001.000001.00000


Target Position: 2433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2433CCUCUGAUAAUAUAUUUUC73.35161665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9052451CCTCTGATAATATATTTTCGAAAATATATTATCAGAGG0.039400.005200.672400.750001.000001.00000


Target Position: 1108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1108UGAGGAGUACGGAGAAUUC70.38591957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9961126TGAGGAGTACGGAGAATTCGAATTCTCCGTACTCCTCA0.048500.004000.551700.500001.000001.00000


Target Position: 922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
922AAAAGAAAAAGAAGAGAAA87.2576414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
998940AAAAGAAAAAGAAGAGAAATTTCTCTTCTTTTTCTTTT0.955800.946300.500000.500001.000001.00000


Target Position: 2603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2603GGUUUAUUUUCACAGAUUG80.09961027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6382621GGTTTATTTTCACAGATTGCAATCTGTGAAAATAAACC0.089200.021100.706900.750001.000001.00000


Target Position: 3017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3017UGCUUAAAGUUGUAACAAA91.3703205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8023035TGCTTAAAGTTGTAACAAATTTGTTACAACTTTAAGCA0.058800.030400.853400.750001.000001.00000


Target Position: 292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
292CAAUACUUUCUACUCGAAC71.35281872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
884310CAATACTTTCTACTCGAACGTTCGAGTAGAAAGTATTG0.238400.043300.500000.500000.989100.62500


Target Position: 2628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2628CGUGCACUGUAAGACGUAU88.3789345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9092646CGTGCACTGTAAGACGTATATACGTCTTACAGTGCACG0.112300.004000.732801.000000.994600.62500


Target Position: 1895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895GAGAACCUCUGCAAAAUCA91.9459181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9481913GAGAACCTCTGCAAAATCATGATTTTGCAGAGGTTCTC0.049500.004400.586200.500001.000001.00000


Target Position: 1537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1537ACACGAAGACUCUCAAAAU88.0771365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3331555ACACGAAGACTCTCAAAATATTTTGAGAGTCTTCGTGT0.231900.046500.698300.750001.000001.00000


Target Position: 1632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1632GCACCAGAAUGAAGGAGAA97.196246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6761650GCACCAGAATGAAGGAGAATTCTCCTTCATTCTGGTGC0.155800.011200.681001.000000.967400.87500


Target Position: 3216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3216CACACGUAGGCACAGAAAA88.0405366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2023234CACACGTAGGCACAGAAAATTTTCTGTGCCTACGTGTG0.449500.087600.793100.750001.000001.00000


Target Position: 1372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1372CCCUCUAAACAUAUCCCGU76.08091410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941390CCCTCTAAACATATCCCGTACGGGATATGTTTAGAGGG0.134800.024600.715500.750001.000001.00000


Target Position: 937, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
937GAAAGAGUCGGAAGACAAA97.679839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
940955GAAAGAGTCGGAAGACAAATTTGTCTTCCGACTCTTTC0.062300.003500.672400.750000.913000.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
935-957GAGAAAGAGTCGGAAGACAAACCUUUGUCUUCCGACUCUUUCUCGAAAGAGUCGGAAGACAAACCU19.217.713


Target Position: 3299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3299UUGUUUUGAUGUUAUUCAU75.04921513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9643317TTGTTTTGATGTTATTCATATGAATAACATCAAAACAA0.046500.021900.491400.500001.000001.00000


Target Position: 339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
339CAAAUUCAUCAGAUGCAUU87.9178377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
969357CAAATTCATCAGATGCATTAATGCATCTGATGAATTTG0.028000.026700.637900.750001.000001.00000


Target Position: 369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
369GGUAUGAAAGCUUGACAGA89.6137271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506387GGTATGAAAGCTTGACAGATCTGTCAAGCTTTCATACC0.131000.028900.629300.750001.000001.00000


Target Position: 2632, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2632CACUGUAAGACGUAUGUAA99.278123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7422650CACTGTAAGACGTATGTAATTACATACGTCTTACAGTG0.069800.038300.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2630-2652TGCACTGTAAGACGTATGTAACAUUACAUACGUCUUACAGUGCACACUGUAAGACGUAUGUAACAU15.819.033


Target Position: 2949, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2949CGUAAAGCUGUUCAAAAAU82.4897776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1232967CGTAAAGCTGTTCAAAAATATTTTTGAACAGCTTTACG0.672900.166500.767201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2947-2969ATCGTAAAGCTGTTCAAAAATAAAUUUUUGAACAGCUUUACGAUCGUAAAGCUGUUCAAAAAUAAU7.720.922


Target Position: 3309, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3309GUUAUUCAUGGAAUACCUU80.9952931

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3307-3329ATGTTATTCATGGAATACCTTCTAAGGUAUUCCAUGAAUAACAUGUUAUUCAUGGAAUACCUUCUU18.58.923


Target Position: 3339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3339ACAGUCACUUAAUUCCUUG68.88972118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8183357ACAGTCACTTAATTCCTTGCAAGGAATTAAGTGACTGT0.124600.006000.560300.500001.000001.00000


Target Position: 2043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2043CCCUAAGAGACAACUCAAC69.91152006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7292061CCCTAAGAGACAACTCAACGTTGAGTTGTCTCTTAGGG0.072200.061700.844800.750000.907600.87500


Target Position: 1575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1575UGUUAAGGUACUACACAUC68.48052163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8741593TGTTAAGGTACTACACATCGATGTGTAGTACCTTAACA0.488700.021300.525900.500001.000001.00000


Target Position: 1916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1916AAAGACAUAUUGGAGAAAA84.9256582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8941934AAAGACATATTGGAGAAAATTTTCTCCAATATGTCTTT0.516400.173100.500000.500001.000001.00000


Target Position: 2146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2146UGAUAAGAACGACAAGUCU78.19581195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9862164TGATAAGAACGACAAGTCTAGACTTGTCGTTCTTATCA0.027700.002600.500000.500001.000001.00000


Target Position: 1241, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1241CUGUUUGAAAACAGAAAGA80.4161990

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1239-1261ATCTGTTTGAAAACAGAAAGAAAUCUUUCUGUUUUCAAACAGAUCUGUUUGAAAACAGAAAGAAAU16.620.511


Target Position: 869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
869GAUAAAGAAGUAAGCGAUG74.5051552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
806887GATAAAGAAGTAAGCGATGCATCGCTTACTTCTTTATC0.058300.042300.525900.500001.000001.00000


Target Position: 1197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1197AAUUCAGAGCCCUUCUAUU83.3563695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9501215AATTCAGAGCCCTTCTATTAATAGAAGGGCTCTGAATT0.133300.003200.500000.500000.994600.75000


Target Position: 2170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2170GGAUCUGGUCAUCUUGCUU88.5363328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992188GGATCTGGTCATCTTGCTTAAGCAAGATGACCAGATCC0.089200.004200.732801.000000.967400.62500


Target Position: 3085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3085AGGGGAGUAUCUGGAUGAC68.22282188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9873103AGGGGAGTATCTGGATGACGTCATCCAGATACTCCCCT0.113600.047100.525900.500001.000001.00000


Target Position: 2495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2495UGGCAUGACAACUACUUUA85.8262516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5812513TGGCATGACAACTACTTTATAAAGTAGTTGTCATGCCA0.245700.016800.810300.750001.000001.00000


Target Position: 3297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3297CGUUGUUUUGAUGUUAUUC70.87151908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8293315CGTTGTTTTGATGTTATTCGAATAACATCAAAACAACG0.054200.027700.603400.750001.000001.00000


Target Position: 2946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2946UAUCGUAAAGCUGUUCAAA80.862946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772964TATCGTAAAGCTGTTCAAATTTGAACAGCTTTACGATA0.227900.146900.543100.500001.000001.00000


Target Position: 2781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2781UCUACUUUUUGAACUUUUC60.33912793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6772799TCTACTTTTTGAACTTTTCGAAAAGTTCAAAAAGTAGA0.329500.056400.551700.500001.000001.00000


Target Position: 756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756ACCUGAAAGAAGACCAAAC67.39192256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
642774ACCTGAAAGAAGACCAAACGTTTGGTCTTCTTTCAGGT0.196500.031600.706900.500001.000001.00000


Target Position: 3077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3077AGGGGGAAAGGGGAGUAUC58.15942904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9793095AGGGGGAAAGGGGAGTATCGATACTCCCCTTTCCCCCT0.096700.057100.663800.500001.000001.00000


Target Position: 3209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3209GGUGGAGCACACGUAGGCA90.3505243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9323227GGTGGAGCACACGTAGGCATGCCTACGTGTGCTCCACC0.097600.003600.500000.750000.962000.62500


Target Position: 1747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1747CUAUAUGAUUGAGCCCAUU80.5569978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5851765CTATATGATTGAGCCCATTAATGGGCTCAATCATATAG0.101100.023100.663800.750000.956500.62500


Target Position: 3286, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3286CUUAGUGUCCACGUUGUUU76.15281404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6313304CTTAGTGTCCACGTTGTTTAAACAACGTGGACACTAAG0.091200.025100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3284-3306CTCTTAGTGTCCACGTTGTTTTGAAACAACGUGGACACUAAGAGCUUAGUGUCCACGUUGUUUUGU19.819.033


Target Position: 1711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1711UGUGGAACGUCUUCGGAAA83.9665638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451729TGTGGAACGTCTTCGGAAATTTCCGAAGACGTTCCACA0.123800.018500.706900.750001.000001.00000


Target Position: 758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
758CUGAAAGAAGACCAAACUG70.53071945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
918776CTGAAAGAAGACCAAACTGCAGTTTGGTCTTCTTTCAG0.178700.115600.500000.500001.000001.00000


Target Position: 1500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1500UCUAUGAGCAGUUCUCUAA83.6768668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8271518TCTATGAGCAGTTCTCTAATTAGAGAACTGCTCATAGA0.170200.005700.689700.750000.913000.87500


Target Position: 2169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2169AGGAUCUGGUCAUCUUGCU72.56031753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9812187AGGATCTGGTCATCTTGCTAGCAAGATGACCAGATCCT0.075500.002600.491400.500000.967400.75000


Target Position: 1780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1780CCAACAGCUGAAGGAAUUU75.54321460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9991798CCAACAGCTGAAGGAATTTAAATTCCTTCAGCTGTTGG0.129400.002300.844801.000001.000001.00000


Target Position: 707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
707AGGACAGACACAGGUGAAC62.982615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
948725AGGACAGACACAGGTGAACGTTCACCTGTGTCTGTCCT0.031900.004300.698300.500001.000001.00000


Target Position: 2537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2537ACUAAGUGAUGCUGUGAUA91.2992210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8322555ACTAAGTGATGCTGTGATATATCACAGCATCACTTAGT0.106300.005700.663800.750001.000001.00000


Target Position: 2373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2373UGGAAGAAGUAGACUAAUC70.59621934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6482391TGGAAGAAGTAGACTAATCGATTAGTCTACTTCTTCCA0.087700.051500.663800.500001.000001.00000


Target Position: 2834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2834CCUCUAGAAAUAGGUUAAA84.6217603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6232852CCTCTAGAAATAGGTTAAATTTAACCTATTTCTAGAGG0.185800.014400.844801.000000.951100.62500


Target Position: 1227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1227GUGCUCCUUUUGAUCUGUU78.71431153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9661245GTGCTCCTTTTGATCTGTTAACAGATCAAAAGGAGCAC0.028700.028800.646600.750001.000001.00000


Target Position: 409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409GAAAGAGCUGCAUAUUAAC80.8488949

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
814427GAAAGAGCTGCATATTAACGTTAATATGCAGCTCTTTC0.802400.126900.525900.500001.000001.00000


Target Position: 2093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2093GAGAUAAACCCUGACCAUU83.7845656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4362111GAGATAAACCCTGACCATTAATGGTCAGGGTTTATCTC0.219900.032600.801700.750001.000001.00000


Target Position: 3253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3253GCAUCCCCUGCGUCCAUGA79.40771088

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6893271GCATCCCCTGCGTCCATGATCATGGACGCAGGGGATGC0.202400.010600.629300.750000.929300.62500


Target Position: 2045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2045CUAAGAGACAACUCAACAA95.272584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8172063CTAAGAGACAACTCAACAATTGTTGAGTTGTCTCTTAG0.083900.061300.525900.750000.907601.00000


Target Position: 2044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2044CCUAAGAGACAACUCAACA90.1132256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7122062CCTAAGAGACAACTCAACATGTTGAGTTGTCTCTTAGG0.075300.061700.637900.750000.907601.00000


Target Position: 1572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1572AGCUGUUAAGGUACUACAC71.58691845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8591590AGCTGTTAAGGTACTACACGTGTAGTACCTTAACAGCT0.068000.013700.560300.500001.000001.00000


Target Position: 944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
944UCGGAAGACAAACCUGAAA73.92171606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
734962TCGGAAGACAAACCTGAAATTTCAGGTTTGTCTTCCGA0.195400.008800.793100.750000.956500.75000


Target Position: 1226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1226CGUGCUCCUUUUGAUCUGU75.61311457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9211244CGTGCTCCTTTTGATCTGTACAGATCAAAAGGAGCACG0.036900.027200.569000.750001.000001.00000


Target Position: 1290, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1290GAGUUUUCAUCAUGGAUAA98.53530

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1288-1310CAGAGTTTTCATCATGGATAACTUUAUCCAUGAUGAAAACUCUGGAGUUUUCAUCAUGGAUAACUU21.213.312


Target Position: 1858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1858AGAGAAAAAGAAGCAGGAA85.5132541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6911876AGAGAAAAAGAAGCAGGAATTCCTGCTTCTTTTTCTCT0.214400.232200.551700.750001.000001.00000


Target Position: 1568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1568UCAGAGCUGUUAAGGUACU68.79692127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9711586TCAGAGCTGTTAAGGTACTAGTACCTTAACAGCTCTGA0.175900.002800.517200.500001.000001.00000


Target Position: 977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
977UCUGAUGAGGAAGAAGAAA76.15711403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
198995TCTGATGAGGAAGAAGAAATTTCTTCTTCCTCATCAGA0.817200.190200.724100.750001.000001.00000


Target Position: 3219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3219ACGUAGGCACAGAAAACAG71.12721889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9923237ACGTAGGCACAGAAAACAGCTGTTTTCTGTGCCTACGT0.215800.039500.491400.500001.000001.00000


Target Position: 790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
790ACGAAGAAUAAAGGAGAUU67.6662227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
655808ACGAAGAATAAAGGAGATTAATCTCCTTTATTCTTCGT0.086000.085300.767200.750001.000001.00000