siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Sidirect 511  
Biltr, Ernai, Rnaxs 498   817   1603   1664  
Biltr, Rnaxs 94   103   104   105   106   107   108   118   147   148   149   151   152   153   154   155   156   158   159   176  
177   191   245   280   281   287   288   289   297   298   346   347   348   373   374   404   405   406   409   410  
414   416   417   418   419   420   421   422   423   457   458   459   460   461   485   486   487   488   489   492  
493   497   499   500   505   506   528   532   533   534   535   536   537   538   539   540   563   564   565   575  
595   596   597   598   599   614   615   617   618   619   622   623   627   629   632   633   639   640   641   660  
661   662   663   665   666   669   670   687   688   697   699   703   704   705   706   707   710   711   712   717  
718   728   730   738   739   742   743   744   753   754   756   757   762   763   764   768   771   772   773   774  
775   776   777   781   782   783   812   813   815   816   818   819   820   821   822   823   826   827   842   845  
846   847   850   853   873   874   875   876   877   879   884   885   886   887   890   891   892   893   894   895  
896   897   899   900   901   903   904   910   919   920   921   922   924   926   927   928   929   930   931   932  
936   937   938   939   940   944   947   949   953   954   957   967   968   971   972   977   978   979   980   981  
982   984   985   989   990   991   992   993   997   998   999   1000   1001   1002   1004   1006   1007   1012   1047   1048  
1049   1050   1051   1052   1063   1064   1072   1073   1074   1075   1076   1077   1078   1079   1080   1081   1082   1092   1093   1094  
1096   1098   1100   1101   1102   1105   1113   1115   1116   1122   1123   1126   1127   1141   1142   1145   1146   1148   1149   1150  
1155   1156   1158   1159   1160   1175   1176   1177   1178   1179   1181   1185   1186   1195   1196   1197   1198   1200   1203   1204  
1205   1209   1210   1247   1248   1254   1255   1256   1260   1261   1263   1265   1266   1270   1271   1289   1290   1291   1292   1293  
1294   1295   1296   1297   1298   1299   1300   1324   1327   1363   1364   1365   1367   1368   1369   1370   1373   1374   1375   1376  
1377   1379   1390   1402   1407   1409   1410   1411   1412   1413   1415   1417   1418   1419   1420   1421   1423   1424   1425   1427  
1429   1431   1449   1450   1451   1452   1453   1455   1456   1458   1460   1461   1463   1464   1468   1469   1473   1475   1476   1481  
1482   1483   1487   1488   1489   1490   1493   1494   1495   1496   1497   1498   1499   1500   1501   1502   1506   1507   1508   1510  
1511   1512   1514   1518   1519   1520   1526   1527   1532   1533   1535   1536   1537   1550   1551   1554   1555   1556   1557   1558  
1560   1561   1564   1570   1571   1572   1580   1581   1582   1583   1585   1589   1590   1600   1601   1602   1604   1613   1614   1623  
1624   1625   1631   1632   1633   1634   1635   1638   1658   1659   1660   1662   1663   1665   1668   1669   1670   1691   1692   1693  
1694   1695   1697   1698   1699   1705   1706   1707   1708   1709   1712   1713   1720   1721   1726   1727   1728   1732   1733   1734  
1736   1738   1746   1758   1765   1767   1768   1769   1770   1771   1826   1827   1828   1829   1830   1831   1835   1837   1839   1842  
1843   1845   1846   1847   1848   1849   1850   1851   1852   1853   1857   1858   1862   1863   1864   1865   1866   1867   1868   1869  
1870   1871   1874   1875   1881   1882   1883   1896   1898   1899   1901   1903   1904   1905   1906   1907   1908  
Biltr, Sidirect 386   1005   1138   1170   1172   1384   1389   1521   1540   1586   1593   1879  
Biltr, Rnaxs, Sidirect 290   291   541   542   553   698   902   905   925   933   934   935   948   958   959   1008   1104   1106   1107   1134  
1135   1157   1180   1182   1257   1258   1259   1325   1326   1380   1403   1416   1422   1426   1430   1454   1459   1462   1474   1505  
1509   1513   1515   1534   1538   1559   1563   1584   1591   1854   1856   1889   1890   1902  
Biltr, Ernai 866   1038  
Biltr, Ernai, Rnaxs, Sidirect 878   1151   1562  


Target Position: 703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
703GAAGGCAGAGAUAUGGCAA92.951848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
456721GAAGGCAGAGATATGGCAATTGCCATATCTCTGCCTTC0.083800.008900.525900.750001.000001.00000


Target Position: 1100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1100CCAGGCGCUAAUUCAAGGA73.8808728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5661118CCAGGCGCTAATTCAAGGATCCTTGAATTAGCGCCTGG0.076500.018600.474100.750001.000001.00000


Target Position: 1369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1369UGUGGUUUCAUGUUAGUUA85.2678219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3691387TGTGGTTTCATGTTAGTTATAACTAACATGAAACCACA0.093800.018700.672400.750001.000001.00000


Target Position: 1870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1870UCUGUACCAGUUAAUUUUU70.3595923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921888TCTGTACCAGTTAATTTTTAAAAATTAACTGGTACAGA0.311800.041100.724100.750001.000001.00000


Target Position: 289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
289CGGAAGAAACUGGUGAUUG70.4136921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
279307CGGAAGAAACTGGTGATTGCAATCACCAGTTTCTTCCG0.141500.056500.767200.750001.000001.00000


Target Position: 1417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1417UUAAUGUAUGUUACCAAAA75.8872626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4541435TTAATGTATGTTACCAAAATTTTGGTAACATACATTAA0.113300.020800.534500.500001.000001.00000


Target Position: 1908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1908AGGCAGUUUUCUAAAAAAA88.3322129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1081926AGGCAGTTTTCTAAAAAAATTTTTTTAGAAAACTGCCT0.311500.202500.844800.750001.000001.00000


Target Position: 1560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1560AUGGAAAAUUCAUUUUUUA85.606209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4151578ATGGAAAATTCATTTTTTATAAAAAATGAATTTTCCAT0.232700.019700.620700.500001.000001.00000


Target Position: 885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885GCGGUUAAUUUUGAAGUGC58.67631455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
509903GCGGTTAATTTTGAAGTGCGCACTTCAAAATTAACCGC0.064000.003500.569000.500001.000001.00000


Target Position: 669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
669AGCCAAGAUGAAGCAGGAG63.48461267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
555687AGCCAAGATGAAGCAGGAGCTCCTGCTTCATCTTGGCT0.025200.003200.543100.500000.913000.62500


Target Position: 541, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
541CCUGAUAGUUUAGAAAACA88.6845119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
286559CCTGATAGTTTAGAAAACATGTTTTCTAAACTATCAGG0.138400.040400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
539-561GCCCTGATAGTTTAGAAAACATCUGUUUUCUAAACUAUCAGGGCCCUGAUAGUUUAGAAAACAUCU13.317.832


Target Position: 822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
822ACGUGGGAAGAAAAAAUCU72.7128786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
495840ACGTGGGAAGAAAAAATCTAGATTTTTTCTTCCCACGT0.259300.047200.551700.500001.000001.00000


Target Position: 563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
563CAGAAAAGUGGACCCCAGA83.3838276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
535581CAGAAAAGTGGACCCCAGATCTGGGGTCCACTTTTCTG0.097100.002700.560300.500000.989100.75000


Target Position: 149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
149GUCCUCCGUCGGUUCUCUC63.53981262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
574167GTCCTCCGTCGGTTCTCTCGAGAGAACCGACGGAGGAC0.030000.001300.508600.500000.929300.75000


Target Position: 94, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
94GCCCUCCCGCCGCCGCCCG34.33491887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
447112GCCCTCCCGCCGCCGCCCGCGGGCGGCGGCGGGAGGGC0.081800.007800.586200.500000.902200.87500


Target Position: 1631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1631CGGCCCCAUGUAUCUCAGU71.1947879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5661649CGGCCCCATGTATCTCAGTACTGAGATACATGGGGCCG0.319900.001400.706900.750000.989100.75000


Target Position: 1463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1463UAGUAUUUUUUGUAUAAUU82.2476319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341481TAGTATTTTTTGTATAATTAATTATACAAAAAATACTA0.452000.098800.663800.500001.000001.00000


Target Position: 1727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1727CCUGUCUCACCUGGACUUA79.0933451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301745CCTGTCTCACCTGGACTTATAAGTCCAGGTGAGACAGG0.137400.002900.810301.000000.918500.75000


Target Position: 1422, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1422GUAUGUUACCAAAAAUAAA97.66028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1781440GTATGTTACCAAAAATAAATTTATTTTTGGTAACATAC0.230900.061000.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1420-1442ATGTATGTTACCAAAAATAAATAUUUAUUUUUGGUAACAUACAUGUAUGUUACCAAAAAUAAAUAU-9.78.502


Target Position: 488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
488CCCUCUCCUACCCAGAUAC66.35191129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
232506CCCTCTCCTACCCAGATACGTATCTGGGTAGGAGAGGG0.298100.117000.810300.750000.983700.75000


Target Position: 920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
920UGUAUGAUUACUGGCCUUU65.48541177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
406938TGTATGATTACTGGCCTTTAAAGGCCAGTAATCATACA0.195900.009600.706900.750001.000001.00000


Target Position: 665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
665AGCUAGCCAAGAUGAAGCA80.4033395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513683AGCTAGCCAAGATGAAGCATGCTTCATCTTGGCTAGCT0.165600.010500.500000.500000.913000.62500


Target Position: 1363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1363CAGUUCUGUGGUUUCAUGU77.4083547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5581381CAGTTCTGTGGTTTCATGTACATGAAACCACAGAACTG0.182800.001700.577600.500001.000001.00000


Target Position: 763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
763ACCAAAGAUGGAGUGAGAG62.38681309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
577781ACCAAAGATGGAGTGAGAGCTCTCACTCCATCTTTGGT0.518500.508600.543100.500000.907600.62500


Target Position: 1413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413CCACUUAAUGUAUGUUACC68.42241012

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301431CCACTTAATGTATGTTACCGGTAACATACATTAAGTGG0.239600.106400.491400.500001.000001.00000


Target Position: 565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
565GAAAAGUGGACCCCAGAAG69.0414979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
572583GAAAAGTGGACCCCAGAAGCTTCTGGGGTCCACTTTTC0.086700.002100.534500.500000.989101.00000


Target Position: 485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
485GGCCCCUCUCCUACCCAGA74.1618710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
324503GGCCCCTCTCCTACCCAGATCTGGGTAGGAGAGGGGCC0.229500.078000.775900.750000.983700.62500


Target Position: 1179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1179GCUGUAACUACUUUAUAAC78.1022505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1631197GCTGTAACTACTTTATAACGTTATAAAGTAGTTACAGC0.477000.101300.706900.750001.000001.00000


Target Position: 1555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1555GUCAGAUGGAAAAUUCAUU81.97326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161573GTCAGATGGAAAATTCATTAATGAATTTTCCATCTGAC0.125800.003300.810300.750001.000001.00000


Target Position: 1709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1709CUUUGGAAGAUGGCAUAAC64.3441231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5341727CTTTGGAAGATGGCATAACGTTATGCCATCTTCCAAAG0.031900.015200.491400.500001.000001.00000


Target Position: 373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
373GUGUAUGUGCCCACAGUGU78.0675510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
592391GTGTATGTGCCCACAGTGTACACTGTGGGCACATACAC0.047800.001100.586200.500000.913000.87500


Target Position: 1600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1600UCUGAUAAAAGAUGGCCAU69.6743953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5361618TCTGATAAAAGATGGCCATATGGCCATCTTTTATCAGA0.031200.003300.569000.750001.000001.00000


Target Position: 493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
493UCCUACCCAGAUACCGAUG52.09261667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484511TCCTACCCAGATACCGATGCATCGGTATCTGGGTAGGA0.176200.005900.715500.500000.994600.62500


Target Position: 990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
990CCAGUAUUUAGAAGCCAAC69.8829943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2131008CCAGTATTTAGAAGCCAACGTTGGCTTCTAAATACTGG0.203600.079100.698300.750001.000001.00000


Target Position: 1126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1126AACUUCUUGCUUCUUUCUA77.2637551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5731144AACTTCTTGCTTCTTTCTATAGAAAGAAGCAAGAAGTT0.032200.003200.474100.500001.000001.00000


Target Position: 536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
536ACAGCCCUGAUAGUUUAGA67.87051037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
586554ACAGCCCTGATAGTTTAGATCTAAACTATCAGGGCTGT0.078800.037500.482800.500001.000001.00000


Target Position: 1474, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1474GUAUAAUUGGAUUUCCUAA96.644215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5791492GTATAATTGGATTTCCTAATTAGGAAATCCAATTATAC0.017200.012800.646600.750000.962000.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1472-1494TTGTATAATTGGATTTCCTAATAUUAGGAAAUCCAAUUAUACAAGUAUAAUUGGAUUUCCUAAUAU19.9-8.002


Target Position: 1521, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1521GUUUUUUAAAAAAGAAAGU68.5962998

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1519-1541TGGTTTTTTAAAAAAGAAAGTGTACUUUCUUUUUUAAAAAACCAGUUUUUUAAAAAAGAAAGUGUU10.3-9.101


Target Position: 1738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1738UGGACUUAAGCAUCUGGCU67.40811068

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5521756TGGACTTAAGCATCTGGCTAGCCAGATGCTTAAGTCCA0.028900.004000.491400.500000.983700.75000


Target Position: 1537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1537AGUGUAUUUGGAAAUAAAG73.8077734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5391555AGTGTATTTGGAAATAAAGCTTTATTTCCAAATACACT0.395300.030800.569000.500001.000001.00000


Target Position: 409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409GAUAUCGAGGUGGAUGGAA83.4438274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
474427GATATCGAGGTGGATGGAATTCCATCCACCTCGATATC0.125600.005700.508600.750001.000001.00000


Target Position: 993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
993GUAUUUAGAAGCCAACUAU88.4065126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2691011GTATTTAGAAGCCAACTATATAGTTGGCTTCTAAATAC0.200000.107200.637900.750001.000001.00000


Target Position: 959, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
959CUAAGAUUACAAAUCAGAA97.587210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
523977CTAAGATTACAAATCAGAATTCTGATTTGTAATCTTAG0.474900.034700.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
957-979ACCTAAGATTACAAATCAGAAGTUUCUGAUUUGUAAUCUUAGGUCUAAGAUUACAAAUCAGAAGUU20.46.922


Target Position: 1180, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1180CUGUAACUACUUUAUAACU84.7184235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241198CTGTAACTACTTTATAACTAGTTATAAAGTAGTTACAG0.487700.138400.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1178-1200GGCTGTAACTACTTTATAACTAAAGUUAUAAAGUAGUUACAGCCCUGUAACUACUUUAUAACUAAU1.419.001


Target Position: 597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
597UCCCAACGUGCCCAUCAUC55.85451562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
407615TCCCAACGTGCCCATCATCGATGATGGGCACGTTGGGA0.617500.034900.689700.500000.929300.87500


Target Position: 1659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1659AGCUGGGCUAAGUAAAUAG73.8086733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5081677AGCTGGGCTAAGTAAATAGCTATTTACTTAGCCCAGCT0.491900.003600.681000.500001.000001.00000


Target Position: 1882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1882AAUUUUUCCAACUACUAAU80.4824389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911900AATTTTTCCAACTACTAATATTAGTAGTTGGAAAAATT0.151900.141600.500000.500001.000001.00000


Target Position: 489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
489CCUCUCCUACCCAGAUACC60.74941382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
571507CCTCTCCTACCCAGATACCGGTATCTGGGTAGGAGAGG0.019100.009500.491400.500000.983700.75000


Target Position: 1712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1712UGGAAGAUGGCAUAACCUG63.65361257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5511730TGGAAGATGGCATAACCTGCAGGTTATGCCATCTTCCA0.026000.005300.560300.500000.923900.75000


Target Position: 287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
287UCCGGAAGAAACUGGUGAU71.2875874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
382305TCCGGAAGAAACTGGTGATATCACCAGTTTCTTCCGGA0.122900.012400.689700.750000.994600.75000


Target Position: 537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
537CAGCCCUGAUAGUUUAGAA97.61029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
384555CAGCCCTGATAGTTTAGAATTCTAAACTATCAGGGCTG0.085700.037500.612100.750001.000001.00000


Target Position: 1138, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1138CUUUCUAGAAAGAGAAACA89.0964110

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1136-1158TTCTTTCTAGAAAGAGAAACAGTUGUUUCUCUUUCUAGAAAGAACUUUCUAGAAAGAGAAACAGUU21.511.702


Target Position: 148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
148GGUCCUCCGUCGGUUCUCU77.9495520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
589166GGTCCTCCGTCGGTTCTCTAGAGAACCGACGGAGGACC0.014100.001200.629300.750000.929300.87500


Target Position: 981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
981AUCUUGCUACCAGUAUUUA79.4636437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
400999ATCTTGCTACCAGTATTTATAAATACTGGTAGCAAGAT0.560900.018200.646600.500001.000001.00000


Target Position: 850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
850GUCUUGUGAAACCUUGCUG66.51471118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
498868GTCTTGTGAAACCTTGCTGCAGCAAGGTTTCACAAGAC0.048200.014800.534500.500001.000001.00000


Target Position: 1665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1665GCUAAGUAAAUAGGAAUUG65.82651157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2351683GCTAAGTAAATAGGAATTGCAATTCCTATTTACTTAGC0.183000.087300.706900.750001.000001.00000


Target Position: 1591, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1591GUCACUUUUUCUGAUAAAA87.0293162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5401609GTCACTTTTTCTGATAAAATTTTATCAGAAAAAGTGAC0.030200.003000.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1589-1611TTGTCACTTTTTCTGATAAAAGAUUUUAUCAGAAAAAGUGACAAGUCACUUUUUCUGAUAAAAGAU8.919.221


Target Position: 1105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1105CGCUAAUUCAAGGAAUUUC68.9936982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3621123CGCTAATTCAAGGAATTTCGAAATTCCTTGAATTAGCG0.096300.071400.750000.750000.978300.75000


Target Position: 899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899AGUGCUGUUUAUUAAUCUU85.3942213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
408917AGTGCTGTTTATTAATCTTAAGATTAATAAACAGCACT0.173200.009500.569000.750001.000001.00000


Target Position: 1475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1475UAUAAUUGGAUUUCCUAAU72.0426823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5381493TATAATTGGATTTCCTAATATTAGGAAATCCAATTATA0.030900.008400.534500.500000.962001.00000


Target Position: 1451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1451CCAGACUAGAUGUAGUAUU82.2215320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451469CCAGACTAGATGTAGTATTAATACTACATCTAGTCTGG0.032000.002200.836201.000000.989100.87500


Target Position: 1254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1254CAGGGCUUUACUCCGUAAC60.49191393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171272CAGGGCTTTACTCCGTAACGTTACGGAGTAAAGCCCTG0.037400.009100.637900.500000.956500.75000


Target Position: 1635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1635CCCAUGUAUCUCAGUACCC63.47991268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121653CCCATGTATCTCAGTACCCGGGTACTGAGATACATGGG0.294800.018700.500000.500001.000001.00000


Target Position: 1694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1694UGAGGCAAUUAGACACUUU80.2914400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3621712TGAGGCAATTAGACACTTTAAAGTGTCTAATTGCCTCA0.342400.014300.724100.750001.000001.00000


Target Position: 1149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1149GAGAAACAGUUGGUAACUU85.9651197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3661167GAGAAACAGTTGGTAACTTAAGTTACCAACTGTTTCTC0.133500.013600.672400.750001.000001.00000


Target Position: 1733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1733UCACCUGGACUUAAGCAUC61.9461332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5671751TCACCTGGACTTAAGCATCGATGCTTAAGTCCAGGTGA0.030200.003400.543100.500000.978300.62500


Target Position: 660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
660GCGGGAGCUAGCCAAGAUG68.8977985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
554678GCGGGAGCTAGCCAAGATGCATCTTGGCTAGCTCCCGC0.320800.002000.767200.750001.000001.00000


Target Position: 1300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1300GGCAGUUUUUUGAAAAUGG69.759949

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5561318GGCAGTTTTTTGAAAATGGCCATTTTCAAAAAACTGCC0.025100.027100.655200.500001.000001.00000


Target Position: 1571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1571AUUUUUUAAAUUCCCGUUU58.60021459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201589ATTTTTTAAATTCCCGTTTAAACGGGAATTTAAAAAAT0.035300.019700.508600.500001.000001.00000


Target Position: 1863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1863CUUUUUUUCUGUACCAGUU79.0271455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5421881CTTTTTTTCTGTACCAGTTAACTGGTACAGAAAAAAAG0.071600.066700.491400.750001.000001.00000


Target Position: 1590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1590UGUCACUUUUUCUGAUAAA84.5342240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5601608TGTCACTTTTTCTGATAAATTTATCAGAAAAAGTGACA0.023200.002200.706900.750001.000001.00000


Target Position: 1462, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1462GUAGUAUUUUUUGUAUAAU86.0966193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2151480GTAGTATTTTTTGTATAATATTATACAAAAAATACTAC0.462100.090000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1460-1482ATGTAGTATTTTTTGTATAATTGAUUAUACAAAAAAUACUACAUGUAGUAUUUUUUGUAUAAUUGU8.56.302


Target Position: 1831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1831CACUCAGUCUCUCUUCUCU88.5044124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5481849CACTCAGTCTCTCTTCTCTAGAGAAGAGAGACTGAGTG0.711700.096400.569000.500001.000001.00000


Target Position: 938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
938UUUCAUUUAUCUAUAAUUU74.6283684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
521956TTTCATTTATCTATAATTTAAATTATAGATAAATGAAA0.527800.422200.500000.500001.000001.00000


Target Position: 419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
419UGGAUGGAAAGCAGGUAGA71.0284889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
558437TGGATGGAAAGCAGGTAGATCTACCTGCTTTCCATCCA0.211100.037300.620700.500001.000001.00000


Target Position: 1256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1256GGGCUUUACUCCGUAACAG74.7573679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121274GGGCTTTACTCCGTAACAGCTGTTACGGAGTAAAGCCC0.038800.015600.706900.750001.000001.00000


Target Position: 158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
158CGGUUCUCUCGUUAGUCCA84.5991239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
367176CGGTTCTCTCGTTAGTCCATGGACTAACGAGAGAACCG0.306300.123600.569000.750001.000001.00000


Target Position: 730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730GGCGCUUUUGGGUACAUGG65.67891166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
596748GGCGCTTTTGGGTACATGGCCATGTACCCAAAAGCGCC0.023100.001000.655200.500001.000001.00000


Target Position: 754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
754UCAGCAAAGACCAAAGAUG64.83621210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
502772TCAGCAAAGACCAAAGATGCATCTTTGGTCTTTGCTGA0.044700.015800.569000.500001.000001.00000


Target Position: 538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538AGCCCUGAUAGUUUAGAAA86.8273168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
349556AGCCCTGATAGTTTAGAAATTTCTAAACTATCAGGGCT0.101000.038000.853400.750001.000001.00000


Target Position: 662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
662GGGAGCUAGCCAAGAUGAA89.2776106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
477680GGGAGCTAGCCAAGATGAATTCATCTTGGCTAGCTCCC0.367600.005600.819001.000001.000001.00000


Target Position: 1205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1205UCCUGCCUAUUAUCUGUCA75.1258660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5081223TCCTGCCTATTATCTGTCATGACAGATAATAGGCAGGA0.249500.030900.646600.500001.000001.00000


Target Position: 935, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
935CUUUUUCAUUUAUCUAUAA93.449541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
321953CTTTTTCATTTATCTATAATTATAGATAAATGAAAAAG0.485400.435400.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
933-955GCCTTTTTCATTTATCTATAATTUUAUAGAUAAAUGAAAAAGGCCUUUUUCAUUUAUCUAUAAUUU8.27.702


Target Position: 1593, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593CACUUUUUCUGAUAAAAGA90.892579

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1591-1613GTCACTTTTTCTGATAAAAGATGUCUUUUAUCAGAAAAAGUGACCACUUUUUCUGAUAAAAGAUGU-4.33.212


Target Position: 967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
967ACAAAUCAGAAGUCAUCUU77.1358560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
577985ACAAATCAGAAGTCATCTTAAGATGACTTCTGATTTGT0.017400.009600.569000.750000.967400.62500


Target Position: 298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
298CUGGUGAUUGUUGGUGAUG60.89141375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
586316CTGGTGATTGTTGGTGATGCATCACCAACAATCACCAG0.014600.004200.629300.500001.000001.00000


Target Position: 1290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1290CUCUGGGGUGGGCAGUUUU71.8871832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5461308CTCTGGGGTGGGCAGTTTTAAAACTGCCCACCCCAGAG0.152500.002200.810300.750001.000001.00000


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204GUCCUGCCUAUUAUCUGUC64.89371204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051222GTCCTGCCTATTATCTGTCGACAGATAATAGGCAGGAC0.306400.052000.500000.500001.000001.00000


Target Position: 1500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1500AUCCUCAAAGAAAGUGUAU69.4525961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5641518ATCCTCAAAGAAAGTGTATATACACTTTCTTTGAGGAT0.053000.032400.637900.500000.989100.87500


Target Position: 1535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1535AAAGUGUAUUUGGAAAUAA88.3091130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5941553AAAGTGTATTTGGAAATAATTATTTCCAAATACACTTT0.112400.039600.465500.500001.000001.00000


Target Position: 1905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1905UAAAGGCAGUUUUCUAAAA82.3073316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4191923TAAAGGCAGTTTTCTAAAATTTTAGAAAACTGCCTTTA0.289700.203400.534500.500001.000001.00000


Target Position: 1155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1155CAGUUGGUAACUUUUGUGA83.4469273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671173CAGTTGGTAACTTTTGTGATCACAAAAGTTACCAACTG0.074600.020700.560300.500001.000001.00000


Target Position: 1373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1373GUUUCAUGUUAGUUACCUU93.227242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4781391GTTTCATGTTAGTTACCTTAAGGTAACTAACATGAAAC0.083800.048100.508600.750001.000001.00000


Target Position: 866, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
866CUGCAAGCACAGCCCUUAU79.3564440

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_586619CTGCAAGCACAGCCCTTAT1/1/0/094.96RHOANM_001664.21NANANA3:49397616..49397634(-)00RHOA(0.002)


Target Position: 1175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1175UUAGGCUGUAACUACUUUA79.0458454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5671193TTAGGCTGTAACTACTTTATAAAGTAGTTACAGCCTAA0.380000.001400.500000.500001.000001.00000


Target Position: 980, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
980CAUCUUGCUACCAGUAUUU82.4277311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342998CATCTTGCTACCAGTATTTAAATACTGGTAGCAAGATG0.500700.015700.655200.750001.000001.00000


Target Position: 1423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1423UAUGUUACCAAAAAUAAAU74.8843675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5351441TATGTTACCAAAAATAAATATTTATTTTTGGTAACATA0.163500.043800.534500.500001.000001.00000


Target Position: 884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
884UGCGGUUAAUUUUGAAGUG62.28561316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506902TGCGGTTAATTTTGAAGTGCACTTCAAAATTAACCGCA0.077100.005500.560300.500001.000001.00000


Target Position: 1899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1899AUAGAAUAAAGGCAGUUUU73.6488740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4071917ATAGAATAAAGGCAGTTTTAAAACTGCCTTTATTCTAT0.371800.034200.543100.500001.000001.00000


Target Position: 1850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1850CCAGCUGACUAAACUUUUU83.8326261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1401868CCAGCTGACTAAACTTTTTAAAAAGTTTAGTCAGCTGG0.681900.058800.844801.000000.989100.75000


Target Position: 1073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1073CCCUCCUCUGCACUCCCAC58.56551460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2971091CCCTCCTCTGCACTCCCACGTGGGAGTGCAGAGGAGGG0.132000.090900.698300.750001.000001.00000


Target Position: 1842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1842UCUUCUCUCCAGCUGACUA83.3086279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551860TCTTCTCTCCAGCTGACTATAGTCAGCTGGAGAGAAGA0.063700.057000.551700.750001.000001.00000


Target Position: 1582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1582UCCCGUUUUGUCACUUUUU64.78951212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641600TCCCGTTTTGTCACTTTTTAAAAAGTGACAAAACGGGA0.057900.048400.870700.750001.000001.00000


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050UCCUUUUGACACUGCUCUA80.7318379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2271068TCCTTTTGACACTGCTCTATAGAGCAGTGTCAAAAGGA0.194300.077300.698300.750001.000001.00000


Target Position: 346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
346GUCUUCAGCAAGGACCAGU67.62711055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
584364GTCTTCAGCAAGGACCAGTACTGGTCCTTGCTGAAGAC0.014800.002700.612100.500000.978300.75000


Target Position: 1176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1176UAGGCUGUAACUACUUUAU74.9895669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751194TAGGCTGTAACTACTTTATATAAAGTAGTTACAGCCTA0.468300.008500.629300.500001.000001.00000


Target Position: 1829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1829GGCACUCAGUCUCUCUUCU83.7727264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1041847GGCACTCAGTCTCTCTTCTAGAAGAGAGACTGAGTGCC0.622000.111500.775900.750001.000001.00000


Target Position: 670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
670GCCAAGAUGAAGCAGGAGC57.4651505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
570688GCCAAGATGAAGCAGGAGCGCTCCTGCTTCATCTTGGC0.019200.014500.646600.500000.940200.75000


Target Position: 874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
874ACAGCCCUUAUGCGGUUAA71.885833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
547892ACAGCCCTTATGCGGTTAATTAACCGCATAAGGGCTGT0.097700.002200.672400.750000.902201.00000


Target Position: 1454, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1454GACUAGAUGUAGUAUUUUU97.100212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841472GACTAGATGTAGTATTTTTAAAAATACTACATCTAGTC0.124800.005400.819000.750000.989100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1452-1474CAGACTAGATGTAGTATTTTTTGAAAAAUACUACAUCUAGUCUGGACUAGAUGUAGUAUUUUUUGU-0.318.902


Target Position: 816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
816AGCUAGACGUGGGAAGAAA86.961166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
389834AGCTAGACGTGGGAAGAAATTTCTTCCCACGTCTAGCT0.212600.011700.853400.750001.000001.00000


Target Position: 1157, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1157GUUGGUAACUUUUGUGAAU83.985256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311175GTTGGTAACTTTTGTGAATATTCACAAAAGTTACCAAC0.070000.031000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1155-1177CAGTTGGTAACTTTTGTGAATTAAUUCACAAAAGUUACCAACUGGUUGGUAACUUUUGUGAAUUAU20.520.002


Target Position: 1151, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1151GAAACAGUUGGUAACUUUU87.461151

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6115119GAAACAGTTGGTAACTTTT1/1/0/094.96RHOANM_001664.21NANANA3:49397331..49397349(-)00RHOA(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3671169GAAACAGTTGGTAACTTTTAAAAGTTACCAACTGTTTC0.095000.017900.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1149-1171GAGAAACAGTTGGTAACTTTTGTAAAAGUUACCAACUGUUUCUCGAAACAGUUGGUAACUUUUGUU4.917.802


Target Position: 532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
532AUCGACAGCCCUGAUAGUU65.11191191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
424550ATCGACAGCCCTGATAGTTAACTATCAGGGCTGTCGAT0.080100.015100.534500.500001.000001.00000


Target Position: 968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
968CAAAUCAGAAGUCAUCUUG71.534856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
590986CAAATCAGAAGTCATCTTGCAAGATGACTTCTGATTTG0.013700.006400.500000.500000.967400.75000


Target Position: 1851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1851CAGCUGACUAAACUUUUUU80.0088411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2771869CAGCTGACTAAACTTTTTTAAAAAAGTTTAGTCAGCTG0.537500.026700.784500.750000.989100.62500


Target Position: 1562, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1562GGAAAAUUCAUUUUUUAAA92.022459

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10156219GGAAAATTCATTTTTTAAA1/1/0/093.97RHOANM_001664.21NANANA6:90440414..90440432(+)00RHOA(0.002)&ZFY(0.007)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1651580GGAAAATTCATTTTTTAAATTTAAAAAATGAATTTTCC0.244400.080600.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1560-1582ATGGAAAATTCATTTTTTAAATTUUUAAAAAAUGAAUUUUCCAUGGAAAAUUCAUUUUUUAAAUUU-9.10.402


Target Position: 876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
876AGCCCUUAUGCGGUUAAUU69.8762944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463894AGCCCTTATGCGGTTAATTAATTAACCGCATAAGGGCT0.109400.006300.844800.750000.902200.87500


Target Position: 1713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1713GGAAGAUGGCAUAACCUGU86.2296189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5741731GGAAGATGGCATAACCTGTACAGGTTATGCCATCTTCC0.018700.002600.663800.750000.923900.87500


Target Position: 704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
704AAGGCAGAGAUAUGGCAAA83.4339275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
491722AAGGCAGAGATATGGCAAATTTGCCATATCTCTGCCTT0.093000.013400.637900.500001.000001.00000


Target Position: 1289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1289GCUCUGGGGUGGGCAGUUU72.7882781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5971307GCTCTGGGGTGGGCAGTTTAAACTGCCCACCCCAGAGC0.137800.001000.853401.000001.000001.00000


Target Position: 1299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1299GGGCAGUUUUUUGAAAAUG69.3807962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5311317GGGCAGTTTTTTGAAAATGCATTTTCAAAAAACTGCCC0.032100.020800.836200.750001.000001.00000


Target Position: 1327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1327AGAAAAGCCCAAGUUCAUG65.51911176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131345AGAAAAGCCCAAGTTCATGCATGAACTTGGGCTTTTCT0.046100.019400.569000.500001.000001.00000


Target Position: 1514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514UGUAUUGGUUUUUUAAAAA83.0853286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3211532TGTATTGGTTTTTTAAAAATTTTTAAAAAACCAATACA0.220400.046800.706900.750001.000001.00000


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049GUCCUUUUGACACUGCUCU70.2237926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3691067GTCCTTTTGACACTGCTCTAGAGCAGTGTCAAAAGGAC0.171700.065200.594800.500000.983700.62500


Target Position: 152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
152CUCCGUCGGUUCUCUCGUU78.0791509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
561170CTCCGTCGGTTCTCTCGTTAACGAGAGAACCGACGGAG0.474900.001700.663800.750001.000001.00000


Target Position: 1830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1830GCACUCAGUCUCUCUUCUC74.6871683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4081848GCACTCAGTCTCTCTTCTCGAGAAGAGAGACTGAGTGC0.704100.101700.543100.750001.000001.00000


Target Position: 1260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1260UUUACUCCGUAACAGAUUU67.53821060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111278TTTACTCCGTAACAGATTTAAATCTGTTACGGAGTAAA0.069100.013300.500000.500001.000001.00000


Target Position: 1634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1634CCCCAUGUAUCUCAGUACC65.00131198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5361652CCCCATGTATCTCAGTACCGGTACTGAGATACATGGGG0.294500.022100.637900.500000.989100.75000


Target Position: 1411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1411UGCCACUUAAUGUAUGUUA78.5322486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2301429TGCCACTTAATGTATGTTATAACATACATTAAGTGGCA0.193300.084000.819000.750001.000001.00000


Target Position: 1450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1450CCCAGACUAGAUGUAGUAU83.9924255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5701468CCCAGACTAGATGTAGTATATACTACATCTAGTCTGGG0.025900.001400.948301.000000.989100.75000


Target Position: 108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
108GCCCGCCCUCGCUCUCUCG57.01571515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
567126GCCCGCCCTCGCTCTCTCGCGAGAGAGCGAGGGCGGGC0.020600.008000.706900.500000.913001.00000


Target Position: 813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
813GCAAGCUAGACGUGGGAAG65.18621189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
434831GCAAGCTAGACGTGGGAAGCTTCCCACGTCTAGCTTGC0.118200.007800.715500.750001.000001.00000


Target Position: 707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
707GCAGAGAUAUGGCAAACAG82.1781322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
360725GCAGAGATATGGCAAACAGCTGTTTGCCATATCTCTGC0.120700.039600.569000.750001.000001.00000


Target Position: 459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
459UGGGCAGGAAGAUUAUGAU78.4863489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433477TGGGCAGGAAGATTATGATATCATAATCTTCCTGCCCA0.146700.007800.663800.750001.000001.00000


Target Position: 1368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1368CUGUGGUUUCAUGUUAGUU78.7744469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241386CTGTGGTTTCATGTTAGTTAACTAACATGAAACCACAG0.144500.008300.637900.750001.000001.00000


Target Position: 1375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1375UUCAUGUUAGUUACCUUAU66.78791098

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4371393TTCATGTTAGTTACCTTATATAAGGTAACTAACATGAA0.073500.043800.629300.500001.000001.00000


Target Position: 1464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1464AGUAUUUUUUGUAUAAUUG74.0754716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5821482AGTATTTTTTGTATAATTGCAATTATACAAAAAATACT0.276000.096600.560300.500001.000001.00000


Target Position: 1746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1746AGCAUCUGGCUCUAAUUCA81.7318338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5331764AGCATCTGGCTCTAATTCATGAATTAGAGCCAGATGCT0.436200.002800.629300.500000.972800.62500


Target Position: 1866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1866UUUUUCUGUACCAGUUAAU64.52311220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5391884TTTTTCTGTACCAGTTAATATTAACTGGTACAGAAAAA0.077200.058000.491400.500001.000001.00000


Target Position: 1498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1498UCAUCCUCAAAGAAAGUGU64.8871205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5271516TCATCCTCAAAGAAAGTGTACACTTTCTTTGAGGATGA0.057300.030900.517200.500000.989100.87500


Target Position: 929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
929ACUGGCCUUUUUCAUUUAU70.9354896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
259947ACTGGCCTTTTTCATTTATATAAATGAAAAAGGCCAGT0.588500.132400.663800.750001.000001.00000


Target Position: 1156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1156AGUUGGUAACUUUUGUGAA90.392585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301174AGTTGGTAACTTTTGTGAATTCACAAAAGTTACCAACT0.073700.022900.534500.750001.000001.00000


Target Position: 1145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1145GAAAGAGAAACAGUUGGUA90.235588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5311163GAAAGAGAAACAGTTGGTATACCAACTGTTTCTCTTTC0.089400.005500.491400.750001.000001.00000


Target Position: 618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
618GGUUGGGAAUAAGAAGGAU86.63175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
317636GGTTGGGAATAAGAAGGATATCCTTCTTATTCCCAACC0.117100.020000.672401.000001.000001.00000


Target Position: 1867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1867UUUUCUGUACCAGUUAAUU66.37391128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431885TTTTCTGTACCAGTTAATTAATTAACTGGTACAGAAAA0.074100.055200.491400.500001.000001.00000


Target Position: 615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
615CCUGGUUGGGAAUAAGAAG71.4807860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
552633CCTGGTTGGGAATAAGAAGCTTCTTATTCCCAACCAGG0.307700.002000.706900.750001.000001.00000


Target Position: 1072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1072GCCCUCCUCUGCACUCCCA78.1676502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2281090GCCCTCCTCTGCACTCCCATGGGAGTGCAGAGGAGGGC0.308600.188100.655200.750000.989100.62500


Target Position: 1614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1614GCCAUAUUACCCCUUUUCG63.87271248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5871632GCCATATTACCCCTTTTCGCGAAAAGGGGTAATATGGC0.032100.030000.706900.500001.000001.00000


Target Position: 1494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1494ACUGUCAUCCUCAAAGAAA84.6892237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1801512ACTGTCATCCTCAAAGAAATTTCTTTGAGGATGACAGT0.230500.174800.706900.750001.000001.00000


Target Position: 1461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1461UGUAGUAUUUUUUGUAUAA90.360986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921479TGTAGTATTTTTTGTATAATTATACAAAAAATACTACA0.317900.052200.672400.750001.000001.00000


Target Position: 901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
901UGCUGUUUAUUAAUCUUAG72.2828812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
370919TGCTGTTTATTAATCTTAGCTAAGATTAATAAACAGCA0.116300.015600.681000.500001.000001.00000


Target Position: 1390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1390UUAUAGUUACUGUGUAAUU76.1345611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5821408TTATAGTTACTGTGTAATTAATTACACAGTAACTATAA0.015100.001200.525900.500001.000001.00000


Target Position: 1495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1495CUGUCAUCCUCAAAGAAAG77.4863542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631513CTGTCATCCTCAAAGAAAGCTTTCTTTGAGGATGACAG0.210500.171400.646600.500001.000001.00000


Target Position: 153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
153UCCGUCGGUUCUCUCGUUA69.6841951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
549171TCCGTCGGTTCTCTCGTTATAACGAGAGAACCGACGGA0.417800.002100.836200.750001.000001.00000


Target Position: 1853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1853GCUGACUAAACUUUUUUUC63.49921266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4051871GCTGACTAAACTTTTTTTCGAAAAAAAGTTTAGTCAGC0.455500.009700.681000.750001.000001.00000


Target Position: 1082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1082GCACUCCCACCUGACACAC63.98831243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031100GCACTCCCACCTGACACACGTGTGTCAGGTGGGAGTGC0.044200.035100.560300.750001.000001.00000


Target Position: 1209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1209GCCUAUUAUCUGUCAGCUG75.9897620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3301227GCCTATTATCTGTCAGCTGCAGCTGACAGATAATAGGC0.179400.017900.715500.750001.000001.00000


Target Position: 291, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
291GAAGAAACUGGUGAUUGUU84.8037231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
447309GAAGAAACTGGTGATTGTTAACAATCACCAGTTTCTTC0.201800.056100.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
289-311CGGAAGAAACTGGTGATTGTTGGAACAAUCACCAGUUUCUUCCGGAAGAAACUGGUGAUUGUUGGU20.513.322


Target Position: 894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
894UUUGAAGUGCUGUUUAUUA80.581384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
578912TTTGAAGTGCTGTTTATTATAATAAACAGCACTTCAAA0.148300.012700.465500.500001.000001.00000


Target Position: 1468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1468UUUUUUGUAUAAUUGGAUU69.167975

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5291486TTTTTTGTATAATTGGATTAATCCAATTATACAAAAAA0.307800.136500.491400.500001.000001.00000


Target Position: 417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
417GGUGGAUGGAAAGCAGGUA87.4998150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190435GGTGGATGGAAAGCAGGTATACCTGCTTTCCATCCACC0.247600.041700.672401.000001.000001.00000


Target Position: 1502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1502CCUCAAAGAAAGUGUAUUG76.3785597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941520CCTCAAAGAAAGTGTATTGCAATACACTTTCTTTGAGG0.046600.026700.698300.750000.989100.62500


Target Position: 1771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1771UCUUUUCUCCUCACUGUAU74.4812695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3151789TCTTTTCTCCTCACTGTATATACAGTGAGGAGAAAAGA0.118400.072900.681000.750001.000001.00000


Target Position: 1483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1483GAUUUCCUAAUACUGUCAU80.7868377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041501GATTTCCTAATACTGTCATATGACAGTATTAGGAAATC0.054600.004100.525900.750001.000001.00000


Target Position: 1558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1558AGAUGGAAAAUUCAUUUUU77.8675524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921576AGATGGAAAATTCATTTTTAAAAATGAATTTTCCATCT0.164100.005000.724100.750001.000001.00000


Target Position: 1094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1094GACACACCAGGCGCUAAUU79.1164449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2571112GACACACCAGGCGCTAATTAATTAGCGCCTGGTGTGTC0.307400.027800.810300.750000.907600.62500


Target Position: 1115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1115AGGAAUUUCUUAACUUCUU77.9582519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4501133AGGAATTTCTTAACTTCTTAAGAAGTTAAGAAATTCCT0.064800.043500.706900.750001.000001.00000


Target Position: 1170, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1170GUGAAUUAGGCUGUAACUA84.3343245

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1168-1190TTGTGAATTAGGCTGTAACTACTUAGUUACAGCCUAAUUCACAAGUGAAUUAGGCUGUAACUACUU19.08.903


Target Position: 1420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1420AUGUAUGUUACCAAAAAUA85.0561225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3651438ATGTATGTTACCAAAAATATATTTTTGGTAACATACAT0.254100.023600.612100.500001.000001.00000


Target Position: 1407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1407UUAGUGCCACUUAAUGUAU70.825904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281425TTAGTGCCACTTAATGTATATACATTAAGTGGCACTAA0.174800.043900.491400.500001.000001.00000


Target Position: 1534, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1534GAAAGUGUAUUUGGAAAUA92.301256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4131552GAAAGTGTATTTGGAAATATATTTCCAAATACACTTTC0.076200.030400.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1532-1554AAGAAAGTGTATTTGGAAATAAAUAUUUCCAAAUACACUUUCUUGAAAGUGUAUUUGGAAAUAAAU20.117.802


Target Position: 1847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1847UCUCCAGCUGACUAAACUU77.2406552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3361865TCTCCAGCTGACTAAACTTAAGTTTAGTCAGCTGGAGA0.420100.064900.586200.750000.962000.62500


Target Position: 1198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1198UAACAUGUCCUGCCUAUUA83.8162263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901216TAACATGTCCTGCCTATTATAATAGGCAGGACATGTTA0.116900.065100.500000.500000.940200.62500


Target Position: 1827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1827GUGGCACUCAGUCUCUCUU80.6089382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5191845GTGGCACTCAGTCTCTCTTAAGAGAGACTGAGTGCCAC0.234300.003200.655200.750001.000001.00000


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768AGAUGGAGUGAGAGAGGUU86.7463171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
593786AGATGGAGTGAGAGAGGTTAACCTCTCTCACTCCATCT0.012900.002100.577600.750001.000001.00000


Target Position: 1005, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1005CAACUAUGAUUAUUAACGA93.707937

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1003-1025GCCAACTATGATTATTAACGATGUCGUUAAUAAUCAUAGUUGGCCAACUAUGAUUAUUAACGAUGU6.911.603


Target Position: 772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
772GGAGUGAGAGAGGUUUUUG76.3098600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
582790GGAGTGAGAGAGGTTTTTGCAAAAACCTCTCTCACTCC0.021500.001200.724100.750001.000001.00000


Target Position: 1496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1496UGUCAUCCUCAAAGAAAGU70.0325937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5961514TGTCATCCTCAAAGAAAGTACTTTCTTTGAGGATGACA0.205900.169700.500000.500000.989100.62500


Target Position: 1259, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1259CUUUACUCCGUAACAGAUU73.367752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381277CTTTACTCCGTAACAGATTAATCTGTTACGGAGTAAAG0.068200.015400.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1257-1279GGCTTTACTCCGTAACAGATTTTAAUCUGUUACGGAGUAAAGCCCUUUACUCCGUAACAGAUUUUU19.214.603


Target Position: 1297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1297GUGGGCAGUUUUUUGAAAA85.7717207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3751315GTGGGCAGTTTTTTGAAAATTTTCAAAAAACTGCCCAC0.090600.043100.793100.750001.000001.00000


Target Position: 1509, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1509GAAAGUGUAUUGGUUUUUU84.1347250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671527GAAAGTGTATTGGTTTTTTAAAAAACCAATACACTTTC0.057600.013300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1507-1529AAGAAAGTGTATTGGTTTTTTAAAAAAAACCAAUACACUUUCUUGAAAGUGUAUUGGUUUUUUAAU12.617.802


Target Position: 1075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1075CUCCUCUGCACUCCCACCU60.17691404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5871093CTCCTCTGCACTCCCACCTAGGTGGGAGTGCAGAGGAG0.124500.069800.465500.500001.000001.00000


Target Position: 1768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1768UGCUCUUUUCUCCUCACUG64.78541213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5761786TGCTCTTTTCTCCTCACTGCAGTGAGGAGAAAAGAGCA0.115800.025000.569000.500001.000001.00000


Target Position: 948, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
948CUAUAAUUUACCUAAGAUU87.7434143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
295966CTATAATTTACCTAAGATTAATCTTAGGTAAATTATAG0.133100.103200.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
946-968ATCTATAATTTACCTAAGATTACAAUCUUAGGUAAAUUAUAGAUCUAUAAUUUACCUAAGAUUACU11.6-8.002


Target Position: 1146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1146AAAGAGAAACAGUUGGUAA92.238957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5791164AAAGAGAAACAGTTGGTAATTACCAACTGTTTCTCTTT0.097600.005700.465500.500001.000001.00000


Target Position: 1384, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1384GUUACCUUAUAGUUACUGU82.285318

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1382-1404TAGTTACCTTATAGTTACTGTGTACAGUAACUAUAAGGUAACUAGUUACCUUAUAGUUACUGUGUU19.018.603


Target Position: 1325, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1325CCAGAAAAGCCCAAGUUCA87.0511160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611343CCAGAAAAGCCCAAGTTCATGAACTTGGGCTTTTCTGG0.060300.010700.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1323-1345AACCAGAAAAGCCCAAGTTCATGUGAACUUGGGCUUUUCUGGUUCCAGAAAAGCCCAAGUUCAUGU19.212.202


Target Position: 1079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1079UCUGCACUCCCACCUGACA74.2864705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5941097TCTGCACTCCCACCTGACATGTCAGGTGGGAGTGCAGA0.064100.041200.517200.500001.000001.00000


Target Position: 1732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1732CUCACCUGGACUUAAGCAU71.9523828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281750CTCACCTGGACTTAAGCATATGCTTAAGTCCAGGTGAG0.032800.005200.655200.750000.978300.62500


Target Position: 1047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1047GGGUCCUUUUGACACUGCU79.6823426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031065GGGTCCTTTTGACACTGCTAGCAGTGTCAAAAGGACCC0.129100.004100.637900.750000.940200.75000


Target Position: 1507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1507AAGAAAGUGUAUUGGUUUU77.83526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4871525AAGAAAGTGTATTGGTTTTAAAACCAATACACTTTCTT0.048900.012200.637900.500001.000001.00000


Target Position: 1511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1511AAGUGUAUUGGUUUUUUAA90.737582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5691529AAGTGTATTGGTTTTTTAATTAAAAAACCAATACACTT0.225900.015000.603400.500001.000001.00000


Target Position: 1248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1248CCACUUCAGGGCUUUACUC68.40361013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421266CCACTTCAGGGCTTTACTCGAGTAAAGCCCTGAAGTGG0.069000.009200.534500.750000.983700.75000


Target Position: 486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
486GCCCCUCUCCUACCCAGAU74.3015703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141504GCCCCTCTCCTACCCAGATATCTGGGTAGGAGAGGGGC0.272400.088900.819001.000000.983700.62500


Target Position: 710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
710GAGAUAUGGCAAACAGGAU88.928115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
283728GAGATATGGCAAACAGGATATCCTGTTTGCCATATCTC0.287900.035200.629300.750001.000001.00000


Target Position: 1291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1291UCUGGGGUGGGCAGUUUUU62.17271325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171309TCTGGGGTGGGCAGTTTTTAAAAACTGCCCACCCCAGA0.162300.003300.724100.750001.000001.00000


Target Position: 1427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1427UUACCAAAAAUAAAUAUAU76.1671608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5351445TTACCAAAAATAAATATATATATATTTATTTTTGGTAA0.066900.021300.491400.500001.000001.00000


Target Position: 1581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1581UUCCCGUUUUGUCACUUUU63.3941275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5621599TTCCCGTTTTGTCACTTTTAAAAGTGACAAAACGGGAA0.070100.011000.672400.500001.000001.00000


Target Position: 1551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1551UAAAGUCAGAUGGAAAAUU69.6488954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5921569TAAAGTCAGATGGAAAATTAATTTTCCATCTGACTTTA0.014500.003400.525900.500001.000001.00000


Target Position: 1889, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1889CCAACUACUAAUAGAAUAA95.592721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3731907CCAACTACTAATAGAATAATTATTCTATTAGTAGTTGG0.091700.028200.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1887-1909TTCCAACTACTAATAGAATAAAGUUAUUCUAUUAGUAGUUGGAACCAACUACUAAUAGAAUAAAGU8.419.012


Target Position: 1903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1903AAUAAAGGCAGUUUUCUAA87.6254144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5721921AATAAAGGCAGTTTTCTAATTAGAAAACTGCCTTTATT0.228500.187500.474100.500001.000001.00000


Target Position: 1294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1294GGGGUGGGCAGUUUUUUGA79.0066456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471312GGGGTGGGCAGTTTTTTGATCAAAAAACTGCCCACCCC0.101900.061800.767200.750001.000001.00000


Target Position: 1589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1589UUGUCACUUUUUCUGAUAA82.1232324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5691607TTGTCACTTTTTCTGATAATTATCAGAAAAAGTGACAA0.019900.002900.612100.500001.000001.00000


Target Position: 1469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1469UUUUUGUAUAAUUGGAUUU63.71521254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041487TTTTTGTATAATTGGATTTAAATCCAATTATACAAAAA0.307600.155600.500000.500001.000001.00000


Target Position: 1585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1585CGUUUUGUCACUUUUUCUG70.2549924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5471603CGTTTTGTCACTTTTTCTGCAGAAAAAGTGACAAAACG0.039400.023500.491400.750001.000001.00000


Target Position: 1038, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1038GGCCCACCAGGGUCCUUUU76.8609576

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9103819GGCCCACCAGGGTCCTTTT1/1/0/093.97RHOANM_001664.21NANANA3:49397444..49397462(-)00RHOA(0.002)


Target Position: 1559, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1559GAUGGAAAAUUCAUUUUUU91.686364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4291577GATGGAAAATTCATTTTTTAAAAAATGAATTTTCCATC0.193700.008000.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1557-1579CAGATGGAAAATTCATTTTTTAAAAAAAAUGAAUUUUCCAUCUGGAUGGAAAAUUCAUUUUUUAAU-3.320.102


Target Position: 1063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1063GCUCUAACAGCCCUCCUCU79.6613427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3101081GCTCTAACAGCCCTCCTCTAGAGGAGGGCTGTTAGAGC0.520500.187900.629300.750000.929300.62500


Target Position: 782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
782AGGUUUUUGAAAUGGCUAC62.2221320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
564800AGGTTTTTGAAATGGCTACGTAGCCATTTCAAAAACCT0.079100.001500.663800.500001.000001.00000


Target Position: 1389, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1389CUUAUAGUUACUGUGUAAU78.1422503

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1387-1409ACCTTATAGTTACTGTGTAATTAAUUACACAGUAACUAUAAGGUCUUAUAGUUACUGUGUAAUUAU20.46.302


Target Position: 1734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1734CACCUGGACUUAAGCAUCU79.2936442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5621752CACCTGGACTTAAGCATCTAGATGCTTAAGTCCAGGTG0.022700.002600.569000.500000.978300.62500


Target Position: 717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
717GGCAAACAGGAUUGGCGCU72.4132802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
575735GGCAAACAGGATTGGCGCTAGCGCCAATCCTGTTTGCC0.018200.007100.646600.750001.000001.00000


Target Position: 706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
706GGCAGAGAUAUGGCAAACA86.7357172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
339724GGCAGAGATATGGCAAACATGTTTGCCATATCTCTGCC0.107500.033700.793100.750001.000001.00000


Target Position: 1699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1699CAAUUAGACACUUUGGAAG75.899624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821717CAATTAGACACTTTGGAAGCTTCCAAAGTGTCTAATTG0.103700.027200.508600.500001.000001.00000


Target Position: 933, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
933GCCUUUUUCAUUUAUCUAU81.8706333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
37951GCCTTTTTCATTTATCTATATAGATAAATGAAAAAGGC0.511400.369200.956901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
931-953TGGCCTTTTTCATTTATCTATAAAUAGAUAAAUGAAAAAGGCCAGCCUUUUUCAUUUAUCUAUAAU8.49.502


Target Position: 1564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1564AAAAUUCAUUUUUUAAAUU76.482594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5441582AAAATTCATTTTTTAAATTAATTTAAAAAATGAATTTT0.328500.097600.491400.500001.000001.00000


Target Position: 1561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1561UGGAAAAUUCAUUUUUUAA85.2126220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2611579TGGAAAATTCATTTTTTAATTAAAAAATGAATTTTCCA0.232400.049500.810300.750001.000001.00000


Target Position: 1858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1858CUAAACUUUUUUUCUGUAC64.42281225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5361876CTAAACTTTTTTTCTGTACGTACAGAAAAAAAGTTTAG0.263300.240500.491400.500001.000001.00000


Target Position: 817, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
817GCUAGACGUGGGAAGAAAA95.159622

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_481719GCTAGACGTGGGAAGAAAA1/1/0/094.96RHOANM_001664.21NANANA3:49397665..49397683(-)00RHOA(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
277835GCTAGACGTGGGAAGAAAATTTTCTTCCCACGTCTAGC0.314400.024700.853401.000001.000001.00000


Target Position: 1293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1293UGGGGUGGGCAGUUUUUUG60.52811390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051311TGGGGTGGGCAGTTTTTTGCAAAAAACTGCCCACCCCA0.109600.070200.698300.500001.000001.00000


Target Position: 892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892AUUUUGAAGUGCUGUUUAU79.196445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
583910ATTTTGAAGTGCTGTTTATATAAACAGCACTTCAAAAT0.053000.013400.465500.500001.000001.00000


Target Position: 1266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1266CCGUAACAGAUUUUGUUGG61.81721339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5091284CCGTAACAGATTTTGTTGGCCAACAAAATCTGTTACGG0.048400.004500.569000.500000.983700.75000


Target Position: 622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
622GGGAAUAAGAAGGAUCUUC70.8723903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
522640GGGAATAAGAAGGATCTTCGAAGATCCTTCTTATTCCC0.034600.007600.819000.750000.913000.62500


Target Position: 904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
904UGUUUAUUAAUCUUAGUGU74.0157719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
530922TGTTTATTAATCTTAGTGTACACTAAGATTAATAAACA0.071500.054100.500000.500001.000001.00000


Target Position: 897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
897GAAGUGCUGUUUAUUAAUC76.9133573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
537915GAAGTGCTGTTTATTAATCGATTAATAAACAGCACTTC0.405200.019300.491400.500001.000001.00000


Target Position: 756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756AGCAAAGACCAAAGAUGGA79.8965416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
562774AGCAAAGACCAAAGATGGATCCATCTTTGGTCTTTGCT0.538300.017300.482800.500000.907600.62500


Target Position: 1765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1765CAGUGCUCUUUUCUCCUCA87.4121152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4591783CAGTGCTCTTTTCTCCTCATGAGGAGAAAAGAGCACTG0.222900.021400.560300.500001.000001.00000


Target Position: 1488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1488CCUAAUACUGUCAUCCUCA90.984477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531506CCTAATACTGTCATCCTCATGAGGATGACAGTATTAGG0.287600.006700.620700.750001.000001.00000


Target Position: 873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
873CACAGCCCUUAUGCGGUUA77.2153555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
556891CACAGCCCTTATGCGGTTATAACCGCATAAGGGCTGTG0.096600.001900.758600.750000.902200.87500


Target Position: 1901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1901AGAAUAAAGGCAGUUUUCU72.0258824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961919AGAATAAAGGCAGTTTTCTAGAAAACTGCCTTTATTCT0.265000.082200.500000.500001.000001.00000


Target Position: 744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
744CAUGGAGUGUUCAGCAAAG80.4378392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
522762CATGGAGTGTTCAGCAAAGCTTTGCTGAACACTCCATG0.076600.006100.517200.500001.000001.00000


Target Position: 1670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1670GUAAAUAGGAAUUGGUUUC66.2761133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011688GTAAATAGGAATTGGTTTCGAAACCAATTCCTATTTAC0.044900.028600.508600.500001.000001.00000


Target Position: 418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
418GUGGAUGGAAAGCAGGUAG68.19871019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
416436GTGGATGGAAAGCAGGTAGCTACCTGCTTTCCATCCAC0.250900.042800.620700.500001.000001.00000


Target Position: 1081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1081UGCACUCCCACCUGACACA76.3655598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431099TGCACTCCCACCTGACACATGTGTCAGGTGGGAGTGCA0.045100.037500.646600.500001.000001.00000


Target Position: 1458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1458AGAUGUAGUAUUUUUUGUA94.549526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4161476AGATGTAGTATTTTTTGTATACAAAAAATACTACATCT0.217000.016900.543100.750001.000001.00000


Target Position: 1430, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1430CCAAAAAUAAAUAUAUCUA95.635720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991448CCAAAAATAAATATATCTATAGATATATTTATTTTTGG0.045300.046100.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1428-1450TACCAAAAATAAATATATCTACCUAGAUAUAUUUAUUUUUGGUACCAAAAAUAAAUAUAUCUACCU8.2-3.302


Target Position: 564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
564AGAAAAGUGGACCCCAGAA84.4378243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
543582AGAAAAGTGGACCCCAGAATTCTGGGGTCCACTTTTCT0.098900.002400.551700.750000.989100.87500


Target Position: 1848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1848CUCCAGCUGACUAAACUUU75.1749657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2501866CTCCAGCTGACTAAACTTTAAAGTTTAGTCAGCTGGAG0.524400.065400.810300.750000.962000.62500


Target Position: 1370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1370GUGGUUUCAUGUUAGUUAC73.9018727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071388GTGGTTTCATGTTAGTTACGTAACTAACATGAAACCAC0.091300.033500.612100.500001.000001.00000


Target Position: 1296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1296GGUGGGCAGUUUUUUGAAA91.603565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3721314GGTGGGCAGTTTTTTGAAATTTCAAAAAACTGCCCACC0.092400.046300.853401.000001.000001.00000


Target Position: 1424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1424AUGUUACCAAAAAUAAAUA83.6084270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4681442ATGTTACCAAAAATAAATATATTTATTTTTGGTAACAT0.132500.034900.612100.500001.000001.00000


Target Position: 1247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1247ACCACUUCAGGGCUUUACU67.37791072

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4491265ACCACTTCAGGGCTTTACTAGTAAAGCCCTGAAGTGGT0.064900.009300.646600.500000.945700.75000


Target Position: 177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
177CGGUCUGGUCUUCAGCUAC74.9554671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
388195CGGTCTGGTCTTCAGCTACGTAGCTGAAGACCAGACCG0.158500.011800.732800.750000.929301.00000


Target Position: 1122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1122UCUUAACUUCUUGCUUCUU66.49241119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5631140TCTTAACTTCTTGCTTCTTAAGAAGCAAGAAGTTAAGA0.022400.011200.586200.750001.000001.00000


Target Position: 1625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1625CCUUUUCGGCCCCAUGUAU74.4012698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5731643CCTTTTCGGCCCCATGTATATACATGGGGCCGAAAAGG0.195000.001300.801701.000000.994600.75000


Target Position: 930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
930CUGGCCUUUUUCAUUUAUC64.17321238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
553948CTGGCCTTTTTCATTTATCGATAAATGAAAAAGGCCAG0.577600.237900.603400.500001.000001.00000


Target Position: 757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
757GCAAAGACCAAAGAUGGAG66.94561087

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
413775GCAAAGACCAAAGATGGAGCTCCATCTTTGGTCTTTGC0.528200.014600.543100.750000.907600.75000


Target Position: 632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
632AGGAUCUUCGGAAUGAUGA75.8609628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
351650AGGATCTTCGGAATGATGATCATCATTCCGAAGATCCT0.229200.026800.620700.500001.000001.00000


Target Position: 705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
705AGGCAGAGAUAUGGCAAAC67.4721063

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
392723AGGCAGAGATATGGCAAACGTTTGCCATATCTCTGCCT0.096300.022600.698300.500001.000001.00000


Target Position: 1402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1402UGUAAUUAGUGCCACUUAA87.5316148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4171420TGTAATTAGTGCCACTTAATTAAGTGGCACTAATTACA0.168700.009000.672400.750001.000001.00000


Target Position: 1663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1663GGGCUAAGUAAAUAGGAAU89.708494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2421681GGGCTAAGTAAATAGGAATATTCCTATTTACTTAGCCC0.177100.099600.982801.000001.000001.00000


Target Position: 492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
492CUCCUACCCAGAUACCGAU78.0952506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
458510CTCCTACCCAGATACCGATATCGGTATCTGGGTAGGAG0.193300.006500.629300.750001.000001.00000


Target Position: 633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
633GGAUCUUCGGAAUGAUGAG80.2191401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
388651GGATCTTCGGAATGATGAGCTCATCATTCCGAAGATCC0.210900.026400.560300.750001.000001.00000


Target Position: 1721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1721GCAUAACCUGUCUCACCUG78.5465485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5831739GCATAACCTGTCTCACCTGCAGGTGAGACAGGTTATGC0.014900.002900.569000.750001.000001.00000


Target Position: 902, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
902GCUGUUUAUUAAUCUUAGU82.2031321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352920GCTGTTTATTAATCTTAGTACTAAGATTAATAAACAGC0.099700.015700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
900-922GTGCTGTTTATTAATCTTAGTGTACUAAGAUUAAUAAACAGCACGCUGUUUAUUAAUCUUAGUGUU11.611.803


Target Position: 982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
982UCUUGCUACCAGUAUUUAG68.10941024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741000TCTTGCTACCAGTATTTAGCTAAATACTGGTAGCAAGA0.362200.025200.551700.500001.000001.00000


Target Position: 1501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1501UCCUCAAAGAAAGUGUAUU68.00781030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841519TCCTCAAAGAAAGTGTATTAATACACTTTCTTTGAGGA0.049500.039400.862100.750000.989100.75000


Target Position: 1602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1602UGAUAAAAGAUGGCCAUAU75.7589632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161620TGATAAAAGATGGCCATATATATGGCCATCTTTTATCA0.037500.005000.681000.750001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781GAGGUUUUUGAAAUGGCUA87.4055153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
577799GAGGTTTTTGAAATGGCTATAGCCATTTCAAAAACCTC0.387000.001200.637900.750001.000001.00000


Target Position: 1106, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1106GCUAAUUCAAGGAAUUUCU78.2762496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3661124GCTAATTCAAGGAATTTCTAGAAATTCCTTGAATTAGC0.095400.051100.629300.750000.978300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1104-1126GCGCTAATTCAAGGAATTTCTTAAGAAAUUCCUUGAAUUAGCGCGCUAAUUCAAGGAAUUUCUUAU10.46.902


Target Position: 984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
984UUGCUACCAGUAUUUAGAA79.9782412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5701002TTGCTACCAGTATTTAGAATTCTAAATACTGGTAGCAA0.195500.102100.474100.500001.000001.00000


Target Position: 1708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1708ACUUUGGAAGAUGGCAUAA77.7441527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131726ACTTTGGAAGATGGCATAATTATGCCATCTTCCAAAGT0.038000.017800.672400.750001.000001.00000


Target Position: 1416, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1416CUUAAUGUAUGUUACCAAA93.504740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3411434CTTAATGTATGTTACCAAATTTGGTAACATACATTAAG0.104500.022600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1414-1436CACTTAATGTATGTTACCAAAAAUUUGGUAACAUACAUUAAGUGCUUAAUGUAUGUUACCAAAAAU20.06.902


Target Position: 1508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1508AGAAAGUGUAUUGGUUUUU69.2341971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821526AGAAAGTGTATTGGTTTTTAAAAACCAATACACTTTCT0.050400.013000.724100.750001.000001.00000


Target Position: 1890, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1890CAACUACUAAUAGAAUAAA94.590225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4061908CAACTACTAATAGAATAAATTTATTCTATTAGTAGTTG0.076600.026100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1888-1910TCCAACTACTAATAGAATAAAGGUUUAUUCUAUUAGUAGUUGGACAACUACUAAUAGAAUAAAGGU6.917.613


Target Position: 629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
629AGAAGGAUCUUCGGAAUGA82.1527323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
515647AGAAGGATCTTCGGAATGATCATTCCGAAGATCCTTCT0.088300.018200.500000.500000.923900.62500


Target Position: 661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
661CGGGAGCUAGCCAAGAUGA83.64267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
507679CGGGAGCTAGCCAAGATGATCATCTTGGCTAGCTCCCG0.436000.003700.689700.750001.000001.00000


Target Position: 1518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1518UUGGUUUUUUAAAAAAGAA75.0985661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5641536TTGGTTTTTTAAAAAAGAATTCTTTTTTAAAAAACCAA0.199300.036700.474100.500001.000001.00000


Target Position: 1270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1270AACAGAUUUUGUUGGCAUA87.8654139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4091288AACAGATTTTGTTGGCATATATGCCAACAAAATCTGTT0.076400.018800.603400.500001.000001.00000


Target Position: 989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
989ACCAGUAUUUAGAAGCCAA89.547101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2401007ACCAGTATTTAGAAGCCAATTGGCTTCTAAATACTGGT0.179700.076100.706900.750001.000001.00000


Target Position: 1536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1536AAGUGUAUUUGGAAAUAAA97.92747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421554AAGTGTATTTGGAAATAAATTTATTTCCAAATACACTT0.141500.040200.637900.500001.000001.00000


Target Position: 1720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1720GGCAUAACCUGUCUCACCU83.9822257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5471738GGCATAACCTGTCTCACCTAGGTGAGACAGGTTATGCC0.028300.005600.655200.750000.994600.62500


Target Position: 698, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
698CUGAAGAAGGCAGAGAUAU76.9808566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
425716CTGAAGAAGGCAGAGATATATATCTCTGCCTTCTTCAG0.139100.008300.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
696-718ACCTGAAGAAGGCAGAGATATGGAUAUCUCUGCCUUCUUCAGGUCUGAAGAAGGCAGAGAUAUGGU20.220.422


Target Position: 1113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1113CAAGGAAUUUCUUAACUUC81.8873332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5931131CAAGGAATTTCTTAACTTCGAAGTTAAGAAATTCCTTG0.079900.005700.474100.500001.000001.00000


Target Position: 937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
937UUUUCAUUUAUCUAUAAUU75.0456666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
548955TTTTCATTTATCTATAATTAATTATAGATAAATGAAAA0.496400.431500.491400.500001.000001.00000


Target Position: 812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
812UGCAAGCUAGACGUGGGAA73.5124744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
470830TGCAAGCTAGACGTGGGAATTCCCACGTCTAGCTTGCA0.113400.005900.681000.750001.000001.00000


Target Position: 1669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1669AGUAAAUAGGAAUUGGUUU78.4911488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4891687AGTAAATAGGAATTGGTTTAAACCAATTCCTATTTACT0.048800.031600.706900.750001.000001.00000


Target Position: 1096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1096CACACCAGGCGCUAAUUCA87.0242163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5191114CACACCAGGCGCTAATTCATGAATTAGCGCCTGGTGTG0.271600.019900.569000.500000.945700.62500


Target Position: 895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
895UUGAAGUGCUGUUUAUUAA82.7672299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
585913TTGAAGTGCTGTTTATTAATTAATAAACAGCACTTCAA0.215300.013300.612100.500001.000001.00000


Target Position: 461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
461GGCAGGAAGAUUAUGAUCG69.8109947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
446479GGCAGGAAGATTATGATCGCGATCATAATCTTCCTGCC0.078700.011700.706900.500001.000001.00000


Target Position: 1006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1006AACUAUGAUUAUUAACGAU87.8597140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5801024AACTATGATTATTAACGATATCGTTAATAATCATAGTT0.316400.085200.465500.500001.000001.00000


Target Position: 1265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1265UCCGUAACAGAUUUUGUUG60.18441403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991283TCCGTAACAGATTTTGTTGCAACAAAATCTGTTACGGA0.050800.004400.724100.500000.983700.62500


Target Position: 992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
992AGUAUUUAGAAGCCAACUA84.711236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361010AGTATTTAGAAGCCAACTATAGTTGGCTTCTAAATACT0.213500.091800.534500.750001.000001.00000


Target Position: 978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
978GUCAUCUUGCUACCAGUAU74.7988677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
371996GTCATCTTGCTACCAGTATATACTGGTAGCAAGATGAC0.394700.013300.775900.750001.000001.00000


Target Position: 1658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1658GAGCUGGGCUAAGUAAAUA93.931436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5551676GAGCTGGGCTAAGTAAATATATTTACTTAGCCCAGCTC0.407300.001900.767200.750000.994600.62500


Target Position: 1572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1572UUUUUUAAAUUCCCGUUUU61.17461363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5421590TTTTTTAAATTCCCGTTTTAAAACGGGAATTTAAAAAA0.029900.020500.500000.500001.000001.00000


Target Position: 533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
533UCGACAGCCCUGAUAGUUU72.998771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
420551TCGACAGCCCTGATAGTTTAAACTATCAGGGCTGTCGA0.073900.065200.793100.750001.000001.00000


Target Position: 1875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1875ACCAGUUAAUUUUUCCAAC64.5221221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3621893ACCAGTTAATTTTTCCAACGTTGGAAAAATTAACTGGT0.528400.028800.706900.500001.000001.00000


Target Position: 281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
281CUGCCAUCCGGAAGAAACU72.6071792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
579299CTGCCATCCGGAAGAAACTAGTTTCTTCCGGATGGCAG0.148700.005500.577600.500000.989100.62500


Target Position: 1482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1482GGAUUUCCUAAUACUGUCA91.007576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5641500GGATTTCCTAATACTGTCATGACAGTATTAGGAAATCC0.022000.007000.646600.750001.000001.00000


Target Position: 1158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1158UUGGUAACUUUUGUGAAUU65.08071193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5141176TTGGTAACTTTTGTGAATTAATTCACAAAAGTTACCAA0.037900.021300.637900.500001.000001.00000


Target Position: 1580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1580AUUCCCGUUUUGUCACUUU69.6264956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4751598ATTCCCGTTTTGTCACTTTAAAGTGACAAAACGGGAAT0.073700.011400.508600.500001.000001.00000


Target Position: 931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
931UGGCCUUUUUCAUUUAUCU72.8692778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
514949TGGCCTTTTTCATTTATCTAGATAAATGAAAAAGGCCA0.579400.374700.620700.500001.000001.00000


Target Position: 1898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1898AAUAGAAUAAAGGCAGUUU76.0507613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5901916AATAGAATAAAGGCAGTTTAAACTGCCTTTATTCTATT0.406200.033400.508600.500001.000001.00000


Target Position: 1367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1367UCUGUGGUUUCAUGUUAGU66.93921089

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671385TCTGTGGTTTCATGTTAGTACTAACATGAAACCACAGA0.162400.010400.517200.500001.000001.00000


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949UAUAAUUUACCUAAGAUUA85.9344198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473967TATAATTTACCTAAGATTATAATCTTAGGTAAATTATA0.129500.101300.508600.500001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051CCUUUUGACACUGCUCUAA83.1849281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2121069CCTTTTGACACTGCTCTAATTAGAGCAGTGTCAAAAGG0.205500.075300.810301.000001.000001.00000


Target Position: 1868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1868UUUCUGUACCAGUUAAUUU73.2127757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5191886TTTCTGTACCAGTTAATTTAAATTAACTGGTACAGAAA0.070200.051100.500000.500001.000001.00000


Target Position: 1907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1907AAGGCAGUUUUCUAAAAAA91.596566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5701925AAGGCAGTTTTCTAAAAAATTTTTTAGAAAACTGCCTT0.301500.199800.637900.500001.000001.00000


Target Position: 1449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1449CCCCAGACUAGAUGUAGUA89.5388102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5921467CCCCAGACTAGATGTAGTATACTACATCTAGTCTGGGG0.013000.001100.810301.000000.989100.62500


Target Position: 598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
598CCCAACGUGCCCAUCAUCC54.68881598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
439616CCCAACGTGCCCATCATCCGGATGATGGGCACGTTGGG0.558000.032500.620700.500000.929300.87500


Target Position: 1698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1698GCAAUUAGACACUUUGGAA97.015613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3051716GCAATTAGACACTTTGGAATTCCAAAGTGTCTAATTGC0.124900.037100.681001.000001.000001.00000


Target Position: 687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
687GCCGGUGAAACCUGAAGAA86.2716185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
526705GCCGGTGAAACCTGAAGAATTCTTCAGGTTTCACCGGC0.033000.006500.827601.000000.945700.87500


Target Position: 1837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1837GUCUCUCUUCUCUCCAGCU80.5301386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5951855GTCTCTCTTCTCTCCAGCTAGCTGGAGAGAAGAGAGAC0.260700.236500.465500.500001.000001.00000


Target Position: 1002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1002AGCCAACUAUGAUUAUUAA97.230411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2531020AGCCAACTATGATTATTAATTAATAATCATAGTTGGCT0.402400.209200.819000.750001.000001.00000


Target Position: 497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
497ACCCAGAUACCGAUGUUAU79.5201435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482515ACCCAGATACCGATGTTATATAACATCGGTATCTGGGT0.112500.005400.810300.750001.000001.00000


Target Position: 539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
539GCCCUGAUAGUUUAGAAAA89.888192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
323557GCCCTGATAGTTTAGAAAATTTTCTAAACTATCAGGGC0.114200.037601.000001.000001.000001.00000


Target Position: 1186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1186CUACUUUAUAACUAACAUG77.3406550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5681204CTACTTTATAACTAACATGCATGTTAGTTATAAAGTAG0.430600.264700.517200.500001.000001.00000


Target Position: 1826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1826GGUGGCACUCAGUCUCUCU86.4492180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5861844GGTGGCACTCAGTCTCTCTAGAGAGACTGAGTGCCACC0.195800.001100.629300.750001.000001.00000


Target Position: 712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
712GAUAUGGCAAACAGGAUUG71.3447871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
422730GATATGGCAAACAGGATTGCAATCCTGTTTGCCATATC0.112200.011200.534500.500001.000001.00000


Target Position: 958, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958CCUAAGAUUACAAAUCAGA85.6044210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
297976CCTAAGATTACAAATCAGATCTGATTTGTAATCTTAGG0.651600.095500.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
956-978TACCTAAGATTACAAATCAGAAGUCUGAUUUGUAAUCUUAGGUACCUAAGAUUACAAAUCAGAAGU12.011.622


Target Position: 1048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048GGUCCUUUUGACACUGCUC73.8554729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4051066GGTCCTTTTGACACTGCTCGAGCAGTGTCAAAAGGACC0.115400.018900.543100.750000.940200.62500


Target Position: 998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
998UAGAAGCCAACUAUGAUUA79.7955421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931016TAGAAGCCAACTATGATTATAATCATAGTTGGCTTCTA0.291500.133000.637900.500001.000001.00000


Target Position: 1403, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1403GUAAUUAGUGCCACUUAAU85.8487203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3871421GTAATTAGTGCCACTTAATATTAAGTGGCACTAATTAC0.655600.011900.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1401-1423GTGTAATTAGTGCCACTTAATGTAUUAAGUGGCACUAAUUACACGUAAUUAGUGCCACUUAAUGUU11.8-2.302


Target Position: 1864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1864UUUUUUUCUGUACCAGUUA70.75906

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5971882TTTTTTTCTGTACCAGTTATAACTGGTACAGAAAAAAA0.082800.063500.465500.500001.000001.00000


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742UACAUGGAGUGUUCAGCAA82.3336313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
578760TACATGGAGTGTTCAGCAATTGCTGAACACTCCATGTA0.017200.005200.534500.500001.000001.00000


Target Position: 774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
774AGUGAGAGAGGUUUUUGAA91.296370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
571792AGTGAGAGAGGTTTTTGAATTCAAAAACCTCTCTCACT0.046300.001400.534500.750001.000001.00000


Target Position: 905, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
905GUUUAUUAAUCUUAGUGUA96.419317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
585923GTTTATTAATCTTAGTGTATACACTAAGATTAATAAAC0.257300.049300.465500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
903-925CTGTTTATTAATCTTAGTGTATGUACACUAAGAUUAAUAAACAGGUUUAUUAAUCUUAGUGUAUGU19.0-7.501


Target Position: 1758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1758UAAUUCACAGUGCUCUUUU71.1564882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5901776TAATTCACAGTGCTCTTTTAAAAGAGCACTGTGAATTA0.068900.001100.534500.500001.000001.00000


Target Position: 1127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1127ACUUCUUGCUUCUUUCUAG75.8721627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5571145ACTTCTTGCTTCTTTCTAGCTAGAAAGAAGCAAGAAGT0.024200.002000.534500.500001.000001.00000


Target Position: 1515, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1515GUAUUGGUUUUUUAAAAAA90.809280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2211533GTATTGGTTTTTTAAAAAATTTTTTAAAAAACCAATAC0.232100.048200.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1513-1535GTGTATTGGTTTTTTAAAAAAGAUUUUUUAAAAAACCAAUACACGUAUUGGUUUUUUAAAAAAGAU-9.120.002


Target Position: 423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
423UGGAAAGCAGGUAGAGUUG62.17591324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
597441TGGAAAGCAGGTAGAGTTGCAACTCTACCTGCTTTCCA0.116200.011600.698300.500001.000001.00000


Target Position: 853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
853UUGUGAAACCUUGCUGCAA73.5429743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
581871TTGTGAAACCTTGCTGCAATTGCAGCAAGGTTTCACAA0.015300.008000.500000.500001.000001.00000


Target Position: 1538, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1538GUGUAUUUGGAAAUAAAGU77.1429558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3431556GTGTATTTGGAAATAAAGTACTTTATTTCCAAATACAC0.148100.028100.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1536-1558AAGTGTATTTGGAAATAAAGTCAACUUUAUUUCCAAAUACACUUGUGUAUUUGGAAAUAAAGUCAU-4.36.902


Target Position: 1431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1431CAAAAAUAAAUAUAUCUAC79.7657423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5921449CAAAAATAAATATATCTACGTAGATATATTTATTTTTG0.042300.041900.465500.500001.000001.00000


Target Position: 1601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1601CUGAUAAAAGAUGGCCAUA83.3425278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5181619CTGATAAAAGATGGCCATATATGGCCATCTTTTATCAG0.037200.004100.741400.750001.000001.00000


Target Position: 663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
663GGAGCUAGCCAAGAUGAAG78.1212504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
452681GGAGCTAGCCAAGATGAAGCTTCATCTTGGCTAGCTCC0.216200.006800.732800.750001.000001.00000


Target Position: 1456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1456CUAGAUGUAGUAUUUUUUG73.0857766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4511474CTAGATGTAGTATTTTTTGCAAAAAATACTACATCTAG0.211500.007600.525900.500001.000001.00000


Target Position: 1177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1177AGGCUGUAACUACUUUAUA89.1973107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3381195AGGCTGTAACTACTTTATATATAAAGTAGTTACAGCCT0.504400.016300.801700.750001.000001.00000


Target Position: 924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
924UGAUUACUGGCCUUUUUCA81.3647354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501942TGATTACTGGCCTTTTTCATGAAAAAGGCCAGTAATCA0.497100.036400.500000.500001.000001.00000


Target Position: 528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
528UUCCAUCGACAGCCCUGAU66.00141150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
566546TTCCATCGACAGCCCTGATATCAGGGCTGTCGATGGAA0.168100.010800.491400.500001.000001.00000


Target Position: 1326, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1326CAGAAAAGCCCAAGUUCAU84.265248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4031344CAGAAAAGCCCAAGTTCATATGAACTTGGGCTTTTCTG0.078000.018300.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1324-1346ACCAGAAAAGCCCAAGTTCATGCAUGAACUUGGGCUUUUCUGGUCAGAAAAGCCCAAGUUCAUGCU19.210.302


Target Position: 614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
614UCCUGGUUGGGAAUAAGAA78.2543497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
559632TCCTGGTTGGGAATAAGAATTCTTATTCCCAACCAGGA0.164700.001700.698300.750000.945700.62500


Target Position: 1116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1116GGAAUUUCUUAACUUCUUG77.7236529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051134GGAATTTCTTAACTTCTTGCAAGAAGTTAAGAAATTCC0.043400.035500.724100.750001.000001.00000


Target Position: 348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
348CUUCAGCAAGGACCAGUUC62.35651313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
596366CTTCAGCAAGGACCAGTTCGAACTGGTCCTTGCTGAAG0.064700.003000.465500.500001.000001.00000


Target Position: 1707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1707CACUUUGGAAGAUGGCAUA88.0014137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151725CACTTTGGAAGATGGCATATATGCCATCTTCCAAAGTG0.037600.019700.750000.750001.000001.00000


Target Position: 1896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1896CUAAUAGAAUAAAGGCAGU78.192499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5761914CTAATAGAATAAAGGCAGTACTGCCTTTATTCTATTAG0.682400.029600.465500.500001.000001.00000


Target Position: 900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
900GUGCUGUUUAUUAAUCUUA88.2443133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
414918GTGCTGTTTATTAATCTTATAAGATTAATAAACAGCAC0.138500.009100.758600.750001.000001.00000


Target Position: 457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
457GCUGGGCAGGAAGAUUAUG66.48441121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
464475GCTGGGCAGGAAGATTATGCATAATCTTCCTGCCCAGC0.141100.006200.698300.750001.000001.00000


Target Position: 460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
460GGGCAGGAAGAUUAUGAUC74.5197691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486478GGGCAGGAAGATTATGATCGATCATAATCTTCCTGCCC0.225300.005300.810300.750001.000001.00000


Target Position: 487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
487CCCCUCUCCUACCCAGAUA80.3677398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
132505CCCCTCTCCTACCCAGATATATCTGGGTAGGAGAGGGG0.284700.105300.948301.000000.983700.75000


Target Position: 1365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1365GUUCUGUGGUUUCAUGUUA88.6936118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4041383GTTCTGTGGTTTCATGTTATAACATGAAACCACAGAAC0.173300.010200.612100.750001.000001.00000


Target Position: 619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
619GUUGGGAAUAAGAAGGAUC69.5221959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
593637GTTGGGAATAAGAAGGATCGATCCTTCTTATTCCCAAC0.089500.018900.465500.500001.000001.00000


Target Position: 1490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1490UAAUACUGUCAUCCUCAAA84.0259253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4251508TAATACTGTCATCCTCAAATTTGAGGATGACAGTATTA0.606600.009000.534500.500001.000001.00000


Target Position: 1624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1624CCCUUUUCGGCCCCAUGUA74.3331700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5721642CCCTTTTCGGCCCCATGTATACATGGGGCCGAAAAGGG0.019000.001400.810301.000000.929300.75000


Target Position: 595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
595UGUCCCAACGUGCCCAUCA71.4412863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
560613TGTCCCAACGTGCCCATCATGATGGGCACGTTGGGACA0.588400.044000.482800.500000.929300.62500


Target Position: 1181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1181UGUAACUACUUUAUAACUA85.8993201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4451199TGTAACTACTTTATAACTATAGTTATAAAGTAGTTACA0.492300.297300.534500.750001.000001.00000


Target Position: 1426, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1426GUUACCAAAAAUAAAUAUA87.5786146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3821444GTTACCAAAAATAAATATATATATTTATTTTTGGTAAC0.087400.025400.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1424-1446ATGTTACCAAAAATAAATATATCUAUAUUUAUUUUUGGUAACAUGUUACCAAAAAUAAAUAUAUCU-8.020.001


Target Position: 728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
728UUGGCGCUUUUGGGUACAU59.58321420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
585746TTGGCGCTTTTGGGTACATATGTACCCAAAAGCGCCAA0.075200.001100.491400.500001.000001.00000


Target Position: 879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879CCUUAUGCGGUUAAUUUUG65.48411178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
284897CCTTATGCGGTTAATTTTGCAAAATTAACCGCATAAGG0.346700.023200.698300.750000.962000.75000


Target Position: 191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
191GCUACCCGCCUUCGUCUCC53.64361624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
559209GCTACCCGCCTTCGTCTCCGGAGACGAAGGCGGGTAGC0.033200.004800.482800.500001.000001.00000


Target Position: 1533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1533AGAAAGUGUAUUUGGAAAU76.9095574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4161551AGAAAGTGTATTTGGAAATATTTCCAAATACACTTTCT0.074900.025000.715500.750001.000001.00000


Target Position: 819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819UAGACGUGGGAAGAAAAAA76.2925601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
450837TAGACGTGGGAAGAAAAAATTTTTTCTTCCCACGTCTA0.396900.043000.672400.500001.000001.00000


Target Position: 290, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
290GGAAGAAACUGGUGAUUGU91.118572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
271308GGAAGAAACTGGTGATTGTACAATCACCAGTTTCTTCC0.150400.058200.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
288-310CCGGAAGAAACTGGTGATTGTTGACAAUCACCAGUUUCUUCCGGGGAAGAAACUGGUGAUUGUUGU20.514.832


Target Position: 821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
821GACGUGGGAAGAAAAAAUC68.6343996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482839GACGTGGGAAGAAAAAATCGATTTTTTCTTCCCACGTC0.242700.042400.637900.500001.000001.00000


Target Position: 458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
458CUGGGCAGGAAGAUUAUGA79.5439434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
456476CTGGGCAGGAAGATTATGATCATAATCTTCCTGCCCAG0.129000.006900.560300.500001.000001.00000


Target Position: 1512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1512AGUGUAUUGGUUUUUUAAA86.7897169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3231530AGTGTATTGGTTTTTTAAATTTAAAAAACCAATACACT0.219500.018500.706900.750001.000001.00000


Target Position: 575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
575CCCCAGAAGUCAAGCAUUU77.8362525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
576593CCCCAGAAGTCAAGCATTTAAATGCTTGACTTCTGGGG0.018100.006100.991401.000001.000001.00000


Target Position: 699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
699UGAAGAAGGCAGAGAUAUG75.0894662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
451717TGAAGAAGGCAGAGATATGCATATCTCTGCCTTCTTCA0.096100.007100.569000.500001.000001.00000


Target Position: 1052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1052CUUUUGACACUGCUCUAAC71.4097867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5631070CTTTTGACACTGCTCTAACGTTAGAGCAGTGTCAAAAG0.180600.067400.491400.500001.000001.00000


Target Position: 1554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1554AGUCAGAUGGAAAAUUCAU82.9681290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011572AGTCAGATGGAAAATTCATATGAATTTTCCATCTGACT0.095400.004100.551700.750001.000001.00000


Target Position: 1271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1271ACAGAUUUUGUUGGCAUAG60.17511405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931289ACAGATTTTGTTGGCATAGCTATGCCAACAAAATCTGT0.065100.004900.534500.500001.000001.00000


Target Position: 103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
103CCGCCGCCCGCCCUCGCUC46.75081778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
356121CCGCCGCCCGCCCTCGCTCGAGCGAGGGCGGGCGGCGG0.102900.014800.603400.750000.907600.75000


Target Position: 939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
939UUCAUUUAUCUAUAAUUUA80.1822402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
578957TTCATTTATCTATAATTTATAAATTATAGATAAATGAA0.596800.423000.637900.500001.000001.00000


Target Position: 972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
972UCAGAAGUCAUCUUGCUAC66.28151132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
537990TCAGAAGTCATCTTGCTACGTAGCAAGATGACTTCTGA0.031100.006900.543100.500000.967400.75000


Target Position: 1295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1295GGGUGGGCAGUUUUUUGAA89.713393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3591313GGGTGGGCAGTTTTTTGAATTCAAAAAACTGCCCACCC0.097400.053500.819001.000001.000001.00000


Target Position: 1078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1078CUCUGCACUCCCACCUGAC66.60631108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5271096CTCTGCACTCCCACCTGACGTCAGGTGGGAGTGCAGAG0.074400.048200.491400.500001.000001.00000


Target Position: 688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
688CCGGUGAAACCUGAAGAAG64.75831215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
583706CCGGTGAAACCTGAAGAAGCTTCTTCAGGTTTCACCGG0.018900.001100.775900.750000.945700.75000


Target Position: 775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
775GUGAGAGAGGUUUUUGAAA89.61898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
565793GTGAGAGAGGTTTTTGAAATTTCAAAAACCTCTCTCAC0.059900.001400.793100.750001.000001.00000


Target Position: 932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
932GGCCUUUUUCAUUUAUCUA93.199143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
36950GGCCTTTTTCATTTATCTATAGATAAATGAAAAAGGCC0.597000.394100.827601.000001.000001.00000


Target Position: 1532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1532AAGAAAGUGUAUUUGGAAA88.6368120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4441550AAGAAAGTGTATTTGGAAATTTCCAAATACACTTTCTT0.070900.022700.637900.500001.000001.00000


Target Position: 896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
896UGAAGUGCUGUUUAUUAAU78.0164515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352914TGAAGTGCTGTTTATTAATATTAATAAACAGCACTTCA0.416000.015200.715500.750001.000001.00000


Target Position: 1584, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1584CCGUUUUGUCACUUUUUCU79.5994433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2921602CCGTTTTGTCACTTTTTCTAGAAAAAGTGACAAAACGG0.135300.032300.689700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1582-1604TCCCGTTTTGTCACTTTTTCTGAAGAAAAAGUGACAAAACGGGACCGUUUUGUCACUUUUUCUGAU5.512.532


Target Position: 893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893UUUUGAAGUGCUGUUUAUU68.10731025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
550911TTTTGAAGTGCTGTTTATTAATAAACAGCACTTCAAAA0.093000.012400.491400.500001.000001.00000


Target Position: 505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
505ACCGAUGUUAUACUGAUGU66.24411134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
568523ACCGATGTTATACTGATGTACATCAGTATAACATCGGT0.020300.013200.646600.500001.000001.00000


Target Position: 934, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
934CCUUUUUCAUUUAUCUAUA93.522339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
66952CCTTTTTCATTTATCTATATATAGATAAATGAAAAAGG0.490500.377300.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
932-954GGCCTTTTTCATTTATCTATAATUAUAGAUAAAUGAAAAAGGCCCCUUUUUCAUUUAUCUAUAAUU8.25.502


Target Position: 159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
159GGUUCUCUCGUUAGUCCAC74.9029673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
391177GGTTCTCTCGTTAGTCCACGTGGACTAACGAGAGAACC0.232400.179300.560300.750001.000001.00000


Target Position: 1527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1527UAAAAAAGAAAGUGUAUUU76.7609580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151545TAAAAAAGAAAGTGTATTTAAATACACTTTCTTTTTTA0.246800.112600.534500.500001.000001.00000


Target Position: 762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
762GACCAAAGAUGGAGUGAGA95.035823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
552780GACCAAAGATGGAGTGAGATCTCACTCCATCTTTGGTC0.476900.007200.594800.500000.907600.75000


Target Position: 1499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1499CAUCCUCAAAGAAAGUGUA92.147858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5651517CATCCTCAAAGAAAGTGTATACACTTTCTTTGAGGATG0.056600.031600.474100.750000.989101.00000


Target Position: 738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
738UGGGUACAUGGAGUGUUCA76.0729612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
461756TGGGTACATGGAGTGTTCATGAACACTCCATGTACCCA0.065700.006300.620700.500001.000001.00000


Target Position: 1632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1632GGCCCCAUGUAUCUCAGUA91.894862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5601650GGCCCCATGTATCTCAGTATACTGAGATACATGGGGCC0.305500.001700.819001.000000.989100.62500


Target Position: 1839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1839CUCUCUUCUCUCCAGCUGA82.7273300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5601857CTCTCTTCTCTCCAGCTGATCAGCTGGAGAGAAGAGAG0.061300.034200.586200.500000.983700.62500


Target Position: 1519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1519UGGUUUUUUAAAAAAGAAA77.0243564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2081537TGGTTTTTTAAAAAAGAAATTTCTTTTTTAAAAAACCA0.208000.111000.844800.750001.000001.00000


Target Position: 1557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1557CAGAUGGAAAAUUCAUUUU79.2127444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5061575CAGATGGAAAATTCATTTTAAAATGAATTTTCCATCTG0.154600.003900.784500.750001.000001.00000


Target Position: 1142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1142CUAGAAAGAGAAACAGUUG75.5277636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5271160CTAGAAAGAGAAACAGTTGCAACTGTTTCTCTTTCTAG0.058100.002900.525900.500001.000001.00000


Target Position: 764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
764CCAAAGAUGGAGUGAGAGA85.9253199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
303782CCAAAGATGGAGTGAGAGATCTCTCACTCCATCTTTGG0.508600.507700.620700.750000.940200.62500


Target Position: 991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
991CAGUAUUUAGAAGCCAACU76.9516568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5881009CAGTATTTAGAAGCCAACTAGTTGGCTTCTAAATACTG0.216200.083500.577600.500001.000001.00000


Target Position: 1196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1196ACUAACAUGUCCUGCCUAU77.987516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3101214ACTAACATGTCCTGCCTATATAGGCAGGACATGTTAGT0.121100.075800.663800.750000.940200.75000


Target Position: 420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420GGAUGGAAAGCAGGUAGAG75.4173641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
389438GGATGGAAAGCAGGTAGAGCTCTACCTGCTTTCCATCC0.230700.039800.560300.750001.000001.00000


Target Position: 926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926AUUACUGGCCUUUUUCAUU71.2987873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
574944ATTACTGGCCTTTTTCATTAATGAAAAAGGCCAGTAAT0.529500.063300.500000.500001.000001.00000


Target Position: 553, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
553GAAAACAUCCCAGAAAAGU72.612791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
588571GAAAACATCCCAGAAAAGTACTTTTCTGGGATGTTTTC0.062800.024400.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
551-573TAGAAAACATCCCAGAAAAGTGGACUUUUCUGGGAUGUUUUCUAGAAAACAUCCCAGAAAAGUGGU10.35.322


Target Position: 1691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1691GCCUGAGGCAAUUAGACAC74.1438712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791709GCCTGAGGCAATTAGACACGTGTCTAATTGCCTCAGGC0.255300.005500.706900.750000.929300.62500


Target Position: 818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
818CUAGACGUGGGAAGAAAAA81.0797363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
258836CTAGACGTGGGAAGAAAAATTTTTCTTCCCACGTCTAG0.329800.027600.672400.750001.000001.00000


Target Position: 1092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1092CUGACACACCAGGCGCUAA85.5702211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4471110CTGACACACCAGGCGCTAATTAGCGCCTGGTGTGTCAG0.065500.017100.750000.750000.907600.75000


Target Position: 1160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1160GGUAACUUUUGUGAAUUAG73.3994751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5801178GGTAACTTTTGTGAATTAGCTAATTCACAAAAGTTACC0.015500.012800.681000.750001.000001.00000


Target Position: 1000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1000GAAGCCAACUAUGAUUAUU85.3881214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2251018GAAGCCAACTATGATTATTAATAATCATAGTTGGCTTC0.342000.156400.663800.750001.000001.00000


Target Position: 815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
815AAGCUAGACGUGGGAAGAA81.7037339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
577833AAGCTAGACGTGGGAAGAATTCTTCCCACGTCTAGCTT0.212100.008000.465500.500001.000001.00000


Target Position: 1261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1261UUACUCCGUAACAGAUUUU64.26991234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411279TTACTCCGTAACAGATTTTAAAATCTGTTACGGAGTAA0.067200.010600.534500.500001.000001.00000


Target Position: 1453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1453AGACUAGAUGUAGUAUUUU82.9709288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5101471AGACTAGATGTAGTATTTTAAAATACTACATCTAGTCT0.056400.003500.724100.750000.989100.75000


Target Position: 1418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1418UAAUGUAUGUUACCAAAAA88.5438122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5461436TAATGTATGTTACCAAAAATTTTTGGTAACATACATTA0.162600.021100.534500.500001.000001.00000


Target Position: 1854, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1854CUGACUAAACUUUUUUUCU77.039563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4041872CTGACTAAACTTTTTTTCTAGAAAAAAAGTTTAGTCAG0.455000.115100.560300.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1852-1874AGCTGACTAAACTTTTTTTCTGTAGAAAAAAAGUUUAGUCAGCUCUGACUAAACUUUUUUUCUGUU0.720.312


Target Position: 1769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1769GCUCUUUUCUCCUCACUGU81.958327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3291787GCTCTTTTCTCCTCACTGTACAGTGAGGAGAAAAGAGC0.111600.074800.646600.750001.000001.00000


Target Position: 944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
944UUAUCUAUAAUUUACCUAA85.9049200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
559962TTATCTATAATTTACCTAATTAGGTAAATTATAGATAA0.323700.228700.500000.500001.000001.00000


Target Position: 1178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1178GGCUGUAACUACUUUAUAA108.8751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811196GGCTGTAACTACTTTATAATTATAAAGTAGTTACAGCC0.467400.093200.965501.000001.000001.00000


Target Position: 596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
596GUCCCAACGUGCCCAUCAU81.6048342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
216614GTCCCAACGTGCCCATCATATGATGGGCACGTTGGGAC0.644000.036000.663800.750000.929300.75000


Target Position: 1664, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1664GGCUAAGUAAAUAGGAAUU84.7194234

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7166419GGCTAAGTAAATAGGAATT1/1/0/094.96RHOANM_001664.21NANANA3:49396818..49396836(-)00RHOA(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2651682GGCTAAGTAAATAGGAATTAATTCCTATTTACTTAGCC0.157700.101600.991401.000001.000001.00000


Target Position: 846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
846CCUUGUCUUGUGAAACCUU82.8655295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
511864CCTTGTCTTGTGAAACCTTAAGGTTTCACAAGACAAGG0.320700.003400.706901.000000.994600.87500


Target Position: 1846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1846CUCUCCAGCUGACUAAACU78.7408471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3751864CTCTCCAGCTGACTAAACTAGTTTAGTCAGCTGGAGAG0.203000.064100.603400.500000.962000.62500


Target Position: 1550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1550AUAAAGUCAGAUGGAAAAU69.6919950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5531568ATAAAGTCAGATGGAAAATATTTTCCATCTGACTTTAT0.025900.003400.534500.500001.000001.00000


Target Position: 535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
535GACAGCCCUGAUAGUUUAG71.0313888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
437553GACAGCCCTGATAGTTTAGCTAAACTATCAGGGCTGTC0.068300.037500.646600.500001.000001.00000


Target Position: 953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
953AUUUACCUAAGAUUACAAA81.5903343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
500971ATTTACCTAAGATTACAAATTTGTAATCTTAGGTAAAT0.137900.102700.508600.500001.000001.00000


Target Position: 1556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1556UCAGAUGGAAAAUUCAUUU71.7886838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5181574TCAGATGGAAAATTCATTTAAATGAATTTTCCATCTGA0.137800.003300.724100.750001.000001.00000


Target Position: 1008, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1008CUAUGAUUAUUAACGAUGU83.7008265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5861026CTATGATTATTAACGATGTACATCGTTAATAATCATAG0.247000.069900.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1006-1028AACTATGATTATTAACGATGTCCACAUCGUUAAUAAUCAUAGUUCUAUGAUUAUUAACGAUGUCCU21.18.703


Target Position: 1101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1101CAGGCGCUAAUUCAAGGAA83.6993266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4021119CAGGCGCTAATTCAAGGAATTCCTTGAATTAGCGCCTG0.078000.023600.612100.750001.000001.00000


Target Position: 386, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
386CAGUGUUUGAGAACUAUGU81.005369

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
384-406CACAGTGTTTGAGAACTATGTGGACAUAGUUCUCAAACACUGUGCAGUGUUUGAGAACUAUGUGGU11.617.823


Target Position: 1662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1662UGGGCUAAGUAAAUAGGAA87.6241145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2101680TGGGCTAAGTAAATAGGAATTCCTATTTACTTAGCCCA0.314300.048800.672400.750001.000001.00000


Target Position: 1540, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1540GUAUUUGGAAAUAAAGUCA87.067158

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1538-1560GTGTATTTGGAAATAAAGTCAGAUGACUUUAUUUCCAAAUACACGUAUUUGGAAAUAAAGUCAGAU14.612.802


Target Position: 1869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1869UUCUGUACCAGUUAAUUUU70.5609914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3501887TTCTGTACCAGTTAATTTTAAAATTAACTGGTACAGAA0.100900.046500.672400.500001.000001.00000


Target Position: 936, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
936UUUUUCAUUUAUCUAUAAU72.3131808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
545954TTTTTCATTTATCTATAATATTATAGATAAATGAAAAA0.487900.434700.491400.500001.000001.00000


Target Position: 1879, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1879GUUAAUUUUUCCAACUACU80.4304393

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1877-1899CAGTTAATTTTTCCAACTACTAAAGUAGUUGGAAAAAUUAACUGGUUAAUUUUUCCAACUACUAAU19.0-9.712


Target Position: 1902, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1902GAAUAAAGGCAGUUUUCUA102.9022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951920GAATAAAGGCAGTTTTCTATAGAAAACTGCCTTTATTC0.232000.190300.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1900-1922TAGAATAAAGGCAGTTTTCTAAAUAGAAAACUGCCUUUAUUCUAGAAUAAAGGCAGUUUUCUAAAU13.3-4.312


Target Position: 1613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1613GGCCAUAUUACCCCUUUUC66.00491149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1411631GGCCATATTACCCCTTTTCGAAAAGGGGTAATATGGCC0.505100.058400.827600.750000.945700.62500


Target Position: 406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
406GCAGAUAUCGAGGUGGAUG72.0674822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
550424GCAGATATCGAGGTGGATGCATCCACCTCGATATCTGC0.125100.002100.698300.750001.000001.00000


Target Position: 1473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1473UGUAUAAUUGGAUUUCCUA87.5018149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981491TGTATAATTGGATTTCCTATAGGAAATCCAATTATACA0.045500.030900.534500.750000.962000.75000


Target Position: 1883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1883AUUUUUCCAACUACUAAUA78.8916463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5891901ATTTTTCCAACTACTAATATATTAGTAGTTGGAAAAAT0.099300.092500.465500.500001.000001.00000


Target Position: 776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
776UGAGAGAGGUUUUUGAAAU79.6464428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
576794TGAGAGAGGTTTTTGAAATATTTCAAAAACCTCTCTCA0.057700.001300.715500.750001.000001.00000


Target Position: 1874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1874UACCAGUUAAUUUUUCCAA76.6076586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921892TACCAGTTAATTTTTCCAATTGGAAAAATTAACTGGTA0.553100.031800.534500.500001.000001.00000


Target Position: 903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
903CUGUUUAUUAAUCUUAGUG70.891901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
551921CTGTTTATTAATCTTAGTGCACTAAGATTAATAAACAG0.078800.021500.491400.500001.000001.00000


Target Position: 1697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1697GGCAAUUAGACACUUUGGA80.7306380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2871715GGCAATTAGACACTTTGGATCCAAAGTGTCTAATTGCC0.195500.062900.629300.750001.000001.00000


Target Position: 743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
743ACAUGGAGUGUUCAGCAAA88.3778128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
504761ACATGGAGTGTTCAGCAAATTTGCTGAACACTCCATGT0.043700.005700.706900.750001.000001.00000


Target Position: 1148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1148AGAGAAACAGUUGGUAACU73.4683748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4681166AGAGAAACAGTTGGTAACTAGTTACCAACTGTTTCTCT0.108900.008900.517200.500001.000001.00000


Target Position: 1906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1906AAAGGCAGUUUUCUAAAAA85.1136224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171924AAAGGCAGTTTTCTAAAAATTTTTAGAAAACTGCCTTT0.291900.200600.500000.500001.000001.00000


Target Position: 1376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1376UCAUGUUAGUUACCUUAUA85.8568202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4331394TCATGTTAGTTACCTTATATATAAGGTAACTAACATGA0.069000.035900.681000.750001.000001.00000


Target Position: 1857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1857ACUAAACUUUUUUUCUGUA86.3487183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4481875ACTAAACTTTTTTTCTGTATACAGAAAAAAAGTTTAGT0.274500.251400.525900.750001.000001.00000


Target Position: 1007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1007ACUAUGAUUAUUAACGAUG65.79841161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811025ACTATGATTATTAACGATGCATCGTTAATAATCATAGT0.247100.066600.551700.500001.000001.00000


Target Position: 1429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1429ACCAAAAAUAAAUAUAUCU76.4835593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791447ACCAAAAATAAATATATCTAGATATATTTATTTTTGGT0.051900.033800.629300.500001.000001.00000


Target Position: 999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
999AGAAGCCAACUAUGAUUAU81.0476366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2441017AGAAGCCAACTATGATTATATAATCATAGTTGGCTTCT0.319500.148600.681000.750001.000001.00000


Target Position: 627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
627UAAGAAGGAUCUUCGGAAU77.224553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
455645TAAGAAGGATCTTCGGAATATTCCGAAGATCCTTCTTA0.167600.015300.525900.500000.913000.62500


Target Position: 1843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1843CUUCUCUCCAGCUGACUAA85.2076221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4461861CTTCTCTCCAGCTGACTAATTAGTCAGCTGGAGAGAAG0.065700.059400.603400.750001.000001.00000


Target Position: 718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
718GCAAACAGGAUUGGCGCUU62.24161319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
597736GCAAACAGGATTGGCGCTTAAGCGCCAATCCTGTTTGC0.011600.004800.715501.000001.000001.00000


Target Position: 156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
156GUCGGUUCUCUCGUUAGUC65.85211155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
518174GTCGGTTCTCTCGTTAGTCGACTAACGAGAGAACCGAC0.291100.006800.500000.500001.000001.00000


Target Position: 1197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1197CUAACAUGUCCUGCCUAUU78.1919500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3301215CTAACATGTCCTGCCTATTAATAGGCAGGACATGTTAG0.111500.067400.663800.750000.940200.75000


Target Position: 1583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1583CCCGUUUUGUCACUUUUUC61.78091342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2761601CCCGTTTTGTCACTTTTTCGAAAAAGTGACAAAACGGG0.146900.041900.819000.750001.000001.00000


Target Position: 1862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1862ACUUUUUUUCUGUACCAGU72.3204807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5101880ACTTTTTTTCTGTACCAGTACTGGTACAGAAAAAAAGT0.076300.073500.500000.500001.000001.00000


Target Position: 155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
155CGUCGGUUCUCUCGUUAGU77.9438521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
468173CGTCGGTTCTCTCGTTAGTACTAACGAGAGAACCGACG0.370200.006000.569000.750001.000001.00000


Target Position: 1093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1093UGACACACCAGGCGCUAAU69.0633978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3861111TGACACACCAGGCGCTAATATTAGCGCCTGGTGTGTCA0.085000.022700.715500.750000.907600.75000


Target Position: 1487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1487UCCUAAUACUGUCAUCCUC65.67151167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4541505TCCTAATACTGTCATCCTCGAGGATGACAGTATTAGGA0.277800.006600.560300.500001.000001.00000


Target Position: 1767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1767GUGCUCUUUUCUCCUCACU72.335804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721785GTGCTCTTTTCTCCTCACTAGTGAGGAGAAAAGAGCAC0.104900.013200.586200.500001.000001.00000


Target Position: 985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
985UGCUACCAGUAUUUAGAAG67.01941085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451003TGCTACCAGTATTTAGAAGCTTCTAAATACTGGTAGCA0.171300.086000.715500.500001.000001.00000


Target Position: 1257, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257GGCUUUACUCCGUAACAGA92.624451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4651275GGCTTTACTCCGTAACAGATCTGTTACGGAGTAAAGCC0.057700.016900.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1255-1277AGGGCTTTACTCCGTAACAGATTUCUGUUACGGAGUAAAGCCCUGGCUUUACUCCGUAACAGAUUU19.020.903


Target Position: 753, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
753UUCAGCAAAGACCAAAGAU66.19131136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
546771TTCAGCAAAGACCAAAGATATCTTTGGTCTTTGCTGAA0.039900.013500.491400.500000.972800.62500


Target Position: 1064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1064CUCUAACAGCCCUCCUCUG69.1557976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531082CTCTAACAGCCCTCCTCTGCAGAGGAGGGCTGTTAGAG0.307700.045500.525900.500000.994600.62500


Target Position: 1845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1845UCUCUCCAGCUGACUAAAC57.86421485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111863TCTCTCCAGCTGACTAAACGTTTAGTCAGCTGGAGAGA0.076300.063200.577600.500000.962000.62500


Target Position: 1633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1633GCCCCAUGUAUCUCAGUAC75.1729658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2651651GCCCCATGTATCTCAGTACGTACTGAGATACATGGGGC0.296000.026400.819000.750000.989100.62500


Target Position: 154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
154CCGUCGGUUCUCUCGUUAG71.8879831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
523172CCGTCGGTTCTCTCGTTAGCTAACGAGAGAACCGACGG0.372100.003100.741400.750001.000001.00000


Target Position: 639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
639UCGGAAUGAUGAGCACACA78.7611470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
511657TCGGAATGATGAGCACACATGTGTGCTCATCATTCCGA0.194700.067400.586200.500001.000001.00000


Target Position: 1077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1077CCUCUGCACUCCCACCUGA82.794298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3801095CCTCTGCACTCCCACCTGATCAGGTGGGAGTGCAGAGG0.088000.053900.620700.750001.000001.00000


Target Position: 826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
826GGGAAGAAAAAAUCUGGGU72.7265785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
529844GGGAAGAAAAAATCTGGGTACCCAGATTTTTTCTTCCC0.032300.034200.637900.750000.994601.00000


Target Position: 957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
957ACCUAAGAUUACAAAUCAG77.3543549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
537975ACCTAAGATTACAAATCAGCTGATTTGTAATCTTAGGT0.295400.098200.569000.500001.000001.00000


Target Position: 623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
623GGAAUAAGAAGGAUCUUCG77.6958532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
525641GGAATAAGAAGGATCTTCGCGAAGATCCTTCTTATTCC0.033100.017400.577600.500000.913000.75000


Target Position: 1104, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1104GCGCUAAUUCAAGGAAUUU78.0831508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3781122GCGCTAATTCAAGGAATTTAAATTCCTTGAATTAGCGC0.088600.072100.922401.000000.978300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1102-1124AGGCGCTAATTCAAGGAATTTCTAAAUUCCUUGAAUUAGCGCCUGCGCUAAUUCAAGGAAUUUCUU18.720.403


Target Position: 599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
599CCAACGUGCCCAUCAUCCU75.2081655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
503617CCAACGTGCCCATCATCCTAGGATGATGGGCACGTTGG0.551500.022300.500000.750000.929300.75000


Target Position: 1263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1263ACUCCGUAACAGAUUUUGU74.3152701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5091281ACTCCGTAACAGATTTTGTACAAAATCTGTTACGGAGT0.068700.007700.500000.500001.000001.00000


Target Position: 997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
997UUAGAAGCCAACUAUGAUU72.0064826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691015TTAGAAGCCAACTATGATTAATCATAGTTGGCTTCTAA0.273500.114900.525900.500001.000001.00000


Target Position: 711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
711AGAUAUGGCAAACAGGAUU77.3629548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
291729AGATATGGCAAACAGGATTAATCCTGTTTGCCATATCT0.195100.024100.715500.750001.000001.00000


Target Position: 1012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1012GAUUAUUAACGAUGUCCAA97.96176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4261030GATTATTAACGATGTCCAATTGGACATCGTTAATAATC0.234800.107700.534500.750001.000001.00000


Target Position: 1455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1455ACUAGAUGUAGUAUUUUUU81.5706344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4621473ACTAGATGTAGTATTTTTTAAAAAATACTACATCTAGT0.136100.006300.706900.750001.000001.00000


Target Position: 940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
940UCAUUUAUCUAUAAUUUAC72.6052793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
584958TCATTTATCTATAATTTACGTAAATTATAGATAAATGA0.630700.432700.543100.500001.000001.00000


Target Position: 777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777GAGAGAGGUUUUUGAAAUG80.3327399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
575795GAGAGAGGTTTTTGAAATGCATTTCAAAAACCTCTCTC0.031500.001300.655200.500001.000001.00000


Target Position: 1904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1904AUAAAGGCAGUUUUCUAAA79.6287431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4061922ATAAAGGCAGTTTTCTAAATTTAGAAAACTGCCTTTAT0.237600.198900.543100.500001.000001.00000


Target Position: 875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
875CAGCCCUUAUGCGGUUAAU75.4006644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
534893CAGCCCTTATGCGGTTAATATTAACCGCATAAGGGCTG0.108100.002800.775900.750000.902201.00000


Target Position: 919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
919GUGUAUGAUUACUGGCCUU85.4581212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
439937GTGTATGATTACTGGCCTTAAGGCCAGTAATCATACAC0.180500.007600.655200.750001.000001.00000


Target Position: 971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
971AUCAGAAGUCAUCUUGCUA86.4645179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
554989ATCAGAAGTCATCTTGCTATAGCAAGATGACTTCTGAT0.025600.007100.508600.500000.967400.87500


Target Position: 1123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1123CUUAACUUCUUGCUUCUUU75.0646665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5591141CTTAACTTCTTGCTTCTTTAAAGAAGCAAGAAGTTAAG0.023800.009300.637900.750001.000001.00000


Target Position: 1520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1520GGUUUUUUAAAAAAGAAAG71.5381855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1641538GGTTTTTTAAAAAAGAAAGCTTTCTTTTTTAAAAAACC0.246600.111600.715500.750001.000001.00000


Target Position: 422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
422AUGGAAAGCAGGUAGAGUU76.9424569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
476440ATGGAAAGCAGGTAGAGTTAACTCTACCTGCTTTCCAT0.206700.040000.508600.500001.000001.00000


Target Position: 947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
947UCUAUAAUUUACCUAAGAU83.8187262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
404965TCTATAATTTACCTAAGATATCTTAGGTAAATTATAGA0.139500.105200.543100.750001.000001.00000


Target Position: 1258, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258GCUUUACUCCGUAACAGAU88.8998116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4281276GCTTTACTCCGTAACAGATATCTGTTACGGAGTAAAGC0.070500.017600.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1256-1278GGGCTTTACTCCGTAACAGATTTAUCUGUUACGGAGUAAAGCCCGCUUUACUCCGUAACAGAUUUU20.39.803


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773GAGUGAGAGAGGUUUUUGA94.190232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
581791GAGTGAGAGAGGTTTTTGATCAAAAACCTCTCTCACTC0.033200.001200.586200.500001.000001.00000


Target Position: 1604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1604AUAAAAGAUGGCCAUAUUA85.3307216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841622ATAAAAGATGGCCATATTATAATATGGCCATCTTTTAT0.259200.007700.508600.500001.000001.00000


Target Position: 297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
297ACUGGUGAUUGUUGGUGAU79.7705422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
546315ACTGGTGATTGTTGGTGATATCACCAACAATCACCAGT0.028900.007900.525900.750001.000001.00000


Target Position: 954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
954UUUACCUAAGAUUACAAAU68.29521016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
554972TTTACCTAAGATTACAAATATTTGTAATCTTAGGTAAA0.153700.103000.491400.500001.000001.00000


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783GGUUUUUGAAAUGGCUACG61.39611355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
557801GGTTTTTGAAATGGCTACGCGTAGCCATTTCAAAAACC0.061400.001800.577600.500001.000001.00000


Target Position: 1080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1080CUGCACUCCCACCUGACAC63.59691260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5571098CTGCACTCCCACCTGACACGTGTCAGGTGGGAGTGCAG0.054800.038200.491400.500001.000001.00000


Target Position: 1459, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1459GAUGUAGUAUUUUUUGUAU93.531838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2761477GATGTAGTATTTTTTGTATATACAAAAAATACTACATC0.247600.024900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1457-1479TAGATGTAGTATTTTTTGTATAAAUACAAAAAAUACUACAUCUAGAUGUAGUAUUUUUUGUAUAAU7.219.002


Target Position: 1726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1726ACCUGUCUCACCUGGACUU72.4219801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5401744ACCTGTCTCACCTGGACTTAAGTCCAGGTGAGACAGGT0.102700.002600.715500.750000.918500.75000


Target Position: 697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
697CCUGAAGAAGGCAGAGAUA91.572867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487715CCTGAAGAAGGCAGAGATATATCTCTGCCTTCTTCAGG0.269200.005200.801701.000000.989100.62500


Target Position: 534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
534CGACAGCCCUGAUAGUUUA96.870714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
392552CGACAGCCCTGATAGTTTATAAACTATCAGGGCTGTCG0.082500.053700.758601.000001.000001.00000


Target Position: 1695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1695GAGGCAAUUAGACACUUUG77.5192540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201713GAGGCAATTAGACACTTTGCAAAGTGTCTAATTGCCTC0.213800.008500.663800.500001.000001.00000


Target Position: 1603, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1603GAUAAAAGAUGGCCAUAUU92.681350

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3160319GATAAAAGATGGCCATATT1/1/0/097.21RHOANM_001664.21NANANA3:49396879..49396897(-)00RHOA(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4661621GATAAAAGATGGCCATATTAATATGGCCATCTTTTATC0.066700.006100.672400.750001.000001.00000


Target Position: 506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
506CCGAUGUUAUACUGAUGUG77.4714544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
591524CCGATGTTATACTGATGTGCACATCAGTATAACATCGG0.013600.007900.620700.750001.000001.00000


Target Position: 823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
823CGUGGGAAGAAAAAAUCUG72.2705813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
541841CGTGGGAAGAAAAAATCTGCAGATTTTTTCTTCCCACG0.100300.015400.491400.750000.994600.62500


Target Position: 1736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1736CCUGGACUUAAGCAUCUGG66.16161137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5941754CCTGGACTTAAGCATCTGGCCAGATGCTTAAGTCCAGG0.012700.002900.500000.500000.983700.87500


Target Position: 1452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1452CAGACUAGAUGUAGUAUUU94.219531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241470CAGACTAGATGTAGTATTTAAATACTACATCTAGTCTG0.040400.003000.784500.750000.989100.87500


Target Position: 1706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1706ACACUUUGGAAGAUGGCAU74.2087706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5191724ACACTTTGGAAGATGGCATATGCCATCTTCCAAAGTGT0.036800.021900.551700.750001.000001.00000


Target Position: 1364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1364AGUUCUGUGGUUUCAUGUU78.9593458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901382AGTTCTGTGGTTTCATGTTAACATGAAACCACAGAACT0.190300.005100.560300.750001.000001.00000


Target Position: 1150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1150AGAAACAGUUGGUAACUUU84.7284233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3591168AGAAACAGTTGGTAACTTTAAAGTTACCAACTGTTTCT0.104200.014400.724100.750001.000001.00000


Target Position: 1074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1074CCUCCUCUGCACUCCCACC63.39761274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5811092CCTCCTCTGCACTCCCACCGGTGGGAGTGCAGAGGAGG0.220400.076100.491400.500001.000001.00000


Target Position: 827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
827GGAAGAAAAAAUCUGGGUG72.8986774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
548845GGAAGAAAAAATCTGGGTGCACCCAGATTTTTTCTTCC0.028000.030000.577600.750000.994600.87500


Target Position: 928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
928UACUGGCCUUUUUCAUUUA81.2006359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
417946TACTGGCCTTTTTCATTTATAAATGAAAAAGGCCAGTA0.605300.107300.646600.500001.000001.00000


Target Position: 1728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1728CUGUCUCACCUGGACUUAA89.0923111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5911746CTGTCTCACCTGGACTTAATTAAGTCCAGGTGAGACAG0.046100.001100.750000.750000.918500.75000


Target Position: 542, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
542CUGAUAGUUUAGAAAACAU89.684795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
291560CTGATAGTTTAGAAAACATATGTTTTCTAAACTATCAG0.148200.055000.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
540-562CCCTGATAGTTTAGAAAACATCCAUGUUUUCUAAACUAUCAGGGCUGAUAGUUUAGAAAACAUCCU14.920.322


Target Position: 147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
147CGGUCCUCCGUCGGUUCUC56.78451523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
595165CGGTCCTCCGTCGGTTCTCGAGAACCGACGGAGGACCG0.012600.001000.603400.750000.907600.62500


Target Position: 1255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1255AGGGCUUUACUCCGUAACA79.6854425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5081273AGGGCTTTACTCCGTAACATGTTACGGAGTAAAGCCCT0.040700.008600.637900.500000.956500.62500


Target Position: 1076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1076UCCUCUGCACUCCCACCUG56.57951532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3971094TCCTCTGCACTCCCACCTGCAGGTGGGAGTGCAGAGGA0.098000.061000.586200.500001.000001.00000


Target Position: 1505, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1505CAAAGAAAGUGUAUUGGUU89.955991

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431523CAAAGAAAGTGTATTGGTTAACCAATACACTTTCTTTG0.029800.013800.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1503-1525CTCAAAGAAAGTGTATTGGTTTTAACCAAUACACUUUCUUUGAGCAAAGAAAGUGUAUUGGUUUUU20.05.502


Target Position: 1298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1298UGGGCAGUUUUUUGAAAAU74.0247718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861316TGGGCAGTTTTTTGAAAATATTTTCAAAAAACTGCCCA0.049000.031000.836200.750001.000001.00000


Target Position: 1849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1849UCCAGCUGACUAAACUUUU66.52431117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3091867TCCAGCTGACTAAACTTTTAAAAGTTTAGTCAGCTGGA0.687800.059000.870700.750000.989100.75000


Target Position: 106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
106CCGCCCGCCCUCGCUCUCU55.98861557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
368124CCGCCCGCCCTCGCTCTCTAGAGAGCGAGGGCGGGCGG0.094100.024300.689700.750000.907600.75000


Target Position: 891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
891AAUUUUGAAGUGCUGUUUA83.1173284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
567909AATTTTGAAGTGCTGTTTATAAACAGCACTTCAAAATT0.042600.014300.474100.500001.000001.00000


Target Position: 921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
921GUAUGAUUACUGGCCUUUU82.0659325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
383939GTATGATTACTGGCCTTTTAAAAGGCCAGTAATCATAC0.224800.012400.681000.750001.000001.00000


Target Position: 1374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1374UUUCAUGUUAGUUACCUUA77.5221539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5901392TTTCATGTTAGTTACCTTATAAGGTAACTAACATGAAA0.084900.052700.465500.500001.000001.00000


Target Position: 1415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1415ACUUAAUGUAUGUUACCAA92.40155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3951433ACTTAATGTATGTTACCAATTGGTAACATACATTAAGT0.119100.030200.560300.750001.000001.00000


Target Position: 1526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1526UUAAAAAAGAAAGUGUAUU63.46391269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5731544TTAAAAAAGAAAGTGTATTAATACACTTTCTTTTTTAA0.207600.106500.525900.500001.000001.00000


Target Position: 617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
617UGGUUGGGAAUAAGAAGGA70.6265909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
591635TGGTTGGGAATAAGAAGGATCCTTCTTATTCCCAACCA0.193000.019500.474100.500001.000001.00000


Target Position: 845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
845GCCUUGUCUUGUGAAACCU74.7686678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
531863GCCTTGTCTTGTGAAACCTAGGTTTCACAAGACAAGGC0.170600.002900.655200.750000.994600.75000


Target Position: 1377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1377CAUGUUAGUUACCUUAUAG85.8182204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5611395CATGTTAGTTACCTTATAGCTATAAGGTAACTAACATG0.063100.025700.482800.500001.000001.00000


Target Position: 1586, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1586GUUUUGUCACUUUUUCUGA83.2094280

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1584-1606CCGTTTTGTCACTTTTTCTGATAUCAGAAAAAGUGACAAAACGGGUUUUGUCACUUUUUCUGAUAU12.214.922


Target Position: 1563, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1563GAAAAUUCAUUUUUUAAAU86.5864176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2061581GAAAATTCATTTTTTAAATATTTAAAAAATGAATTTTC0.268500.093800.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1561-1583TGGAAAATTCATTTTTTAAATTCAUUUAAAAAAUGAAUUUUCCAGAAAAUUCAUUUUUUAAAUUCU-9.10.401


Target Position: 1770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1770CUCUUUUCUCCUCACUGUA85.7775206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3311788CTCTTTTCTCCTCACTGTATACAGTGAGGAGAAAAGAG0.111300.074700.629300.750001.000001.00000


Target Position: 151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
151CCUCCGUCGGUUCUCUCGU65.75381162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
578169CCTCCGTCGGTTCTCTCGTACGAGAGAACCGACGGAGG0.465400.001200.569000.750000.962000.75000


Target Position: 1835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1835CAGUCUCUCUUCUCUCCAG82.8223296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981853CAGTCTCTCTTCTCTCCAGCTGGAGAGAAGAGAGACTG0.308900.073400.500000.500001.000001.00000


Target Position: 886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
886CGGUUAAUUUUGAAGUGCU85.3216217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
496904CGGTTAATTTTGAAGTGCTAGCACTTCAAAATTAACCG0.064500.004800.560300.750001.000001.00000


Target Position: 498, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
498CCCAGAUACCGAUGUUAUA92.764949

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_149819CCCAGATACCGATGTTATA1/1/0/097.75RHOANM_001664.21NANANA3:49405898..49405916(-)00RHOA(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
332516CCCAGATACCGATGTTATATATAACATCGGTATCTGGG0.110200.090700.948301.000001.000001.00000


Target Position: 1159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159UGGUAACUUUUGUGAAUUA89.642497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5501177TGGTAACTTTTGTGAATTATAATTCACAAAAGTTACCA0.027400.022500.810300.750001.000001.00000


Target Position: 1141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1141UCUAGAAAGAGAAACAGUU75.4044642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5421159TCTAGAAAGAGAAACAGTTAACTGTTTCTCTTTCTAGA0.046600.002400.577600.750001.000001.00000


Target Position: 1493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1493UACUGUCAUCCUCAAAGAA86.189191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831511TACTGTCATCCTCAAAGAATTCTTTGAGGATGACAGTA0.280100.176700.508600.500001.000001.00000


Target Position: 104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
104CGCCGCCCGCCCUCGCUCU59.85141413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
348122CGCCGCCCGCCCTCGCTCTAGAGCGAGGGCGGGCGGCG0.101600.020500.698300.750000.907600.87500


Target Position: 540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
540CCCUGAUAGUUUAGAAAAC75.0172668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
301558CCCTGATAGTTTAGAAAACGTTTTCTAAACTATCAGGG0.127300.038700.844800.750001.000001.00000


Target Position: 1489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1489CUAAUACUGUCAUCCUCAA94.390729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581507CTAATACTGTCATCCTCAATTGAGGATGACAGTATTAG0.602200.006900.525900.750001.000001.00000


Target Position: 820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820AGACGUGGGAAGAAAAAAU81.4787348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
255838AGACGTGGGAAGAAAAAATATTTTTTCTTCCCACGTCT0.257600.047800.715500.750001.000001.00000


Target Position: 925, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
925GAUUACUGGCCUUUUUCAU82.6077304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
462943GATTACTGGCCTTTTTCATATGAAAAAGGCCAGTAATC0.503000.050900.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
923-945ATGATTACTGGCCTTTTTCATTTAUGAAAAAGGCCAGUAAUCAUGAUUACUGGCCUUUUUCAUUUU7.711.602


Target Position: 877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
877GCCCUUAUGCGGUUAAUUU80.4657391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
442895GCCCTTATGCGGTTAATTTAAATTAACCGCATAAGGGC0.133400.007301.000001.000000.902200.75000


Target Position: 404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
404UGGCAGAUAUCGAGGUGGA78.576481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
593422TGGCAGATATCGAGGTGGATCCACCTCGATATCTGCCA0.160500.001100.474100.500001.000001.00000


Target Position: 1497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1497GUCAUCCUCAAAGAAAGUG59.12051436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4491515GTCATCCTCAAAGAAAGTGCACTTTCTTTGAGGATGAC0.066300.029900.525900.500000.989100.75000


Target Position: 1195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1195AACUAACAUGUCCUGCCUA86.2501187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5681213AACTAACATGTCCTGCCTATAGGCAGGACATGTTAGTT0.119300.076500.474100.500000.940200.75000


Target Position: 1210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210CCUAUUAUCUGUCAGCUGC66.8561094

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5491228CCTATTATCTGTCAGCTGCGCAGCTGACAGATAATAGG0.187900.052600.491400.500001.000001.00000


Target Position: 1460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1460AUGUAGUAUUUUUUGUAUA88.2169135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5331478ATGTAGTATTTTTTGTATATATACAAAAAATACTACAT0.278100.035000.612100.500001.000001.00000


Target Position: 1172, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1172GAAUUAGGCUGUAACUACU93.087246

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1170-1192GTGAATTAGGCTGTAACTACTTTAGUAGUUACAGCCUAAUUCACGAAUUAGGCUGUAACUACUUUU14.310.903


Target Position: 1380, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1380GUUAGUUACCUUAUAGUUA94.505127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3281398GTTAGTTACCTTATAGTTATAACTATAAGGTAACTAAC0.216500.018000.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1378-1400ATGTTAGTTACCTTATAGTTACTUAACUAUAAGGUAACUAACAUGUUAGUUACCUUAUAGUUACUU6.36.603


Target Position: 107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
107CGCCCGCCCUCGCUCUCUC62.21771321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
385125CGCCCGCCCTCGCTCTCTCGAGAGAGCGAGGGCGGGCG0.085300.037300.612100.750000.907600.75000


Target Position: 499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
499CCAGAUACCGAUGUUAUAC71.722841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
344517CCAGATACCGATGTTATACGTATAACATCGGTATCTGG0.103400.077900.663800.750001.000001.00000


Target Position: 511, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
511GUUAUACUGAUGUGUUUUU80.1167408

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_851119GTTATACTGATGTGTTTTT1/1/0/093.97RHOANM_001664.21NANANA3:49405885..49405903(-)00RHOA(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
509-531ATGTTATACTGATGTGTTTTTCCAAAAACACAUCAGUAUAACAUGUUAUACUGAUGUGUUUUUCCU13.36.322


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623CCCCUUUUCGGCCCCAUGU57.67011495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5961641CCCCTTTTCGGCCCCATGTACATGGGGCCGAAAAGGGG0.012200.001400.784500.750000.907600.75000


Target Position: 1412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1412GCCACUUAAUGUAUGUUAC76.5865589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2071430GCCACTTAATGTATGTTACGTAACATACATTAAGTGGC0.210100.095000.819000.750001.000001.00000


Target Position: 922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
922UAUGAUUACUGGCCUUUUU73.8162731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
409940TATGATTACTGGCCTTTTTAAAAAGGCCAGTAATCATA0.351300.015400.543100.500001.000001.00000


Target Position: 1419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1419AAUGUAUGUUACCAAAAAU86.894167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941437AATGTATGTTACCAAAAATATTTTTGGTAACATACATT0.164300.021700.500000.500001.000001.00000


Target Position: 927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
927UUACUGGCCUUUUUCAUUU66.291131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
583945TTACTGGCCTTTTTCATTTAAATGAAAAAGGCCAGTAA0.641900.096400.534500.500001.000001.00000


Target Position: 890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
890UAAUUUUGAAGUGCUGUUU65.25621185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
589908TAATTTTGAAGTGCTGTTTAAACAGCACTTCAAAATTA0.073700.014000.534500.500001.000001.00000


Target Position: 1660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1660GCUGGGCUAAGUAAAUAGG65.57931173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791678GCTGGGCTAAGTAAATAGGCCTATTTACTTAGCCCAGC0.468100.006600.508600.500001.000001.00000


Target Position: 1481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1481UGGAUUUCCUAAUACUGUC66.62151107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5271499TGGATTTCCTAATACTGTCGACAGTATTAGGAAATCCA0.032900.004600.525900.500000.962000.75000


Target Position: 347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
347UCUUCAGCAAGGACCAGUU71.6425846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
558365TCTTCAGCAAGGACCAGTTAACTGGTCCTTGCTGAAGA0.023900.003100.577600.750000.978300.62500


Target Position: 288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
288CCGGAAGAAACUGGUGAUU68.56871003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
261306CCGGAAGAAACTGGTGATTAATCACCAGTTTCTTCCGG0.269000.026900.905201.000001.000001.00000


Target Position: 1379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1379UGUUAGUUACCUUAUAGUU80.5149388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3781397TGTTAGTTACCTTATAGTTAACTATAAGGTAACTAACA0.218500.020000.560300.750001.000001.00000


Target Position: 1705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1705GACACUUUGGAAGAUGGCA81.5167346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5811723GACACTTTGGAAGATGGCATGCCATCTTCCAAAGTGTC0.050800.025300.465500.500001.000001.00000


Target Position: 1425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1425UGUUACCAAAAAUAAAUAU74.5282689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3331443TGTTACCAAAAATAAATATATATTTATTTTTGGTAACA0.109600.030500.663800.750001.000001.00000


Target Position: 842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
842GGUGCCUUGUCUUGUGAAA90.148189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
584860GGTGCCTTGTCTTGTGAAATTTCACAAGACAAGGCACC0.076300.001100.853401.000001.000001.00000


Target Position: 1182, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1182GUAACUACUUUAUAACUAA102.3113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2441200GTAACTACTTTATAACTAATTAGTTATAAAGTAGTTAC0.477300.286200.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1180-1202CTGTAACTACTTTATAACTAACAUUAGUUAUAAAGUAGUUACAGGUAACUACUUUAUAACUAACAU6.314.303


Target Position: 1668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1668AAGUAAAUAGGAAUUGGUU81.2298358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5401686AAGTAAATAGGAATTGGTTAACCAATTCCTATTTACTT0.053500.030700.491400.500001.000001.00000


Target Position: 405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
405GGCAGAUAUCGAGGUGGAU82.809297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
563423GGCAGATATCGAGGTGGATATCCACCTCGATATCTGCC0.139900.001600.819001.000001.000001.00000


Target Position: 1513, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1513GUGUAUUGGUUUUUUAAAA91.545868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2721531GTGTATTGGTTTTTTAAAATTTTAAAAAACCAATACAC0.217700.025300.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1511-1533AAGTGTATTGGTTTTTTAAAAAAUUUUAAAAAACCAAUACACUUGUGUAUUGGUUUUUUAAAAAAU-9.113.502


Target Position: 640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
640CGGAAUGAUGAGCACACAA94.30530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188658CGGAATGATGAGCACACAATTGTGTGCTCATCATTCCG0.222500.068600.767201.000001.000001.00000


Target Position: 176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
176ACGGUCUGGUCUUCAGCUA78.5758482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
539194ACGGTCTGGTCTTCAGCTATAGCTGAAGACCAGACCGT0.118500.002600.603400.750000.929300.87500


Target Position: 1693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1693CUGAGGCAAUUAGACACUU77.2173554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4011711CTGAGGCAATTAGACACTTAAGTGTCTAATTGCCTCAG0.354100.010500.646600.750001.000001.00000


Target Position: 410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410AUAUCGAGGUGGAUGGAAA89.5326103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
555428ATATCGAGGTGGATGGAAATTTCCATCCACCTCGATAT0.109300.018300.543100.500001.000001.00000


Target Position: 641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
641GGAAUGAUGAGCACACAAG80.9247374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
488659GGAATGATGAGCACACAAGCTTGTGTGCTCATCATTCC0.048900.013500.732800.750001.000001.00000


Target Position: 1292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1292CUGGGGUGGGCAGUUUUUU65.02971195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2631310CTGGGGTGGGCAGTTTTTTAAAAAACTGCCCACCCCAG0.168700.084300.784500.750001.000001.00000


Target Position: 1852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1852AGCUGACUAAACUUUUUUU81.4348350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3771870AGCTGACTAAACTTTTTTTAAAAAAAGTTTAGTCAGCT0.448500.013000.853400.750001.000001.00000


Target Position: 1828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1828UGGCACUCAGUCUCUCUUC60.85451378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3811846TGGCACTCAGTCTCTCTTCGAAGAGAGACTGAGTGCCA0.438500.019000.672400.500001.000001.00000


Target Position: 280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
280GCUGCCAUCCGGAAGAAAC68.08851027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483298GCTGCCATCCGGAAGAAACGTTTCTTCCGGATGGCAGC0.067700.005400.706900.750000.967400.75000


Target Position: 1570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1570CAUUUUUUAAAUUCCCGUU75.0885663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831588CATTTTTTAAATTCCCGTTAACGGGAATTTAAAAAATG0.050200.026100.508600.750001.000001.00000


Target Position: 1102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1102AGGCGCUAAUUCAAGGAAU76.2635603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4011120AGGCGCTAATTCAAGGAATATTCCTTGAATTAGCGCCT0.078600.051100.836200.750001.000001.00000


Target Position: 1506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1506AAAGAAAGUGUAUUGGUUU80.0228410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991524AAAGAAAGTGTATTGGTTTAAACCAATACACTTTCTTT0.049100.012100.500000.500001.000001.00000


Target Position: 1871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1871CUGUACCAGUUAAUUUUUC65.81031159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471889CTGTACCAGTTAATTTTTCGAAAAATTAACTGGTACAG0.862300.037700.612100.500001.000001.00000


Target Position: 1638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1638AUGUAUCUCAGUACCCCAU74.5115692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5851656ATGTATCTCAGTACCCCATATGGGGTACTGAGATACAT0.014700.005900.500000.500001.000001.00000


Target Position: 1001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1001AAGCCAACUAUGAUUAUUA92.502352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261019AAGCCAACTATGATTATTATAATAATCATAGTTGGCTT0.357100.175600.603400.500001.000001.00000


Target Position: 910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
910UUAAUCUUAGUGUAUGAUU68.57861002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
521928TTAATCTTAGTGTATGATTAATCATACACTAAGATTAA0.035200.009400.525900.500001.000001.00000


Target Position: 979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
979UCAUCUUGCUACCAGUAUU80.1424405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
360997TCATCTTGCTACCAGTATTAATACTGGTAGCAAGATGA0.523300.014300.715500.750001.000001.00000


Target Position: 887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
887GGUUAAUUUUGAAGUGCUG78.4244491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
458905GGTTAATTTTGAAGTGCTGCAGCACTTCAAAATTAACC0.062100.007500.569000.750001.000001.00000


Target Position: 1135, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1135CUUCUUUCUAGAAAGAGAA87.0477161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5821153CTTCTTTCTAGAAAGAGAATTCTCTTTCTAGAAAGAAG0.027700.001600.465500.750000.923900.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1133-1155TGCTTCTTTCTAGAAAGAGAAACUUCUCUUUCUAGAAAGAAGCACUUCUUUCUAGAAAGAGAAACU19.114.801


Target Position: 1856, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1856GACUAAACUUUUUUUCUGU84.9847226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161874GACTAAACTTTTTTTCTGTACAGAAAAAAAGTTTAGTC0.287400.180300.612100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1854-1876CTGACTAAACTTTTTTTCTGTACACAGAAAAAAAGUUUAGUCAGGACUAAACUUUUUUUCUGUACU12.212.922


Target Position: 1510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1510AAAGUGUAUUGGUUUUUUA90.734683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5841528AAAGTGTATTGGTTTTTTATAAAAAACCAATACACTTT0.067500.013800.465500.500001.000001.00000


Target Position: 118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
118GCUCUCUCGCGCUACCCUC64.98121199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
412136GCTCTCTCGCGCTACCCTCGAGGGTAGCGCGAGAGAGC0.618100.023200.543100.750000.967400.75000


Target Position: 878, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878CCCUUAUGCGGUUAAUUUU78.838467

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_287819CCCTTATGCGGTTAATTTT1/1/0/097.75RHOANM_001664.21NANANA3:49397604..49397622(-)00RHOA(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
339896CCCTTATGCGGTTAATTTTAAAATTAACCGCATAAGGG0.124700.016000.991401.000000.902200.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
876-898AGCCCTTATGCGGTTAATTTTGAAAAAUUAACCGCAUAAGGGCUCCCUUAUGCGGUUAAUUUUGAU-9.717.432


Target Position: 1409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1409AGUGCCACUUAAUGUAUGU76.2732602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921427AGTGCCACTTAATGTATGTACATACATTAAGTGGCACT0.172300.057700.500000.500001.000001.00000


Target Position: 1098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1098CACCAGGCGCUAAUUCAAG69.6431955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3881116CACCAGGCGCTAATTCAAGCTTGAATTAGCGCCTGGTG0.084200.015900.655200.500000.989100.62500


Target Position: 1004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1004CCAACUAUGAUUAUUAACG69.005981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011022CCAACTATGATTATTAACGCGTTAATAATCATAGTTGG0.280400.130600.569000.500001.000001.00000


Target Position: 1200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1200ACAUGUCCUGCCUAUUAUC71.0537885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521218ACATGTCCTGCCTATTATCGATAATAGGCAGGACATGT0.203200.068200.525900.500001.000001.00000


Target Position: 1881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1881UAAUUUUUCCAACUACUAA86.1926190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971899TAATTTTTCCAACTACTAATTAGTAGTTGGAAAAATTA0.289400.275700.500000.500001.000001.00000


Target Position: 1865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1865UUUUUUCUGUACCAGUUAA78.7331472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5911883TTTTTTCTGTACCAGTTAATTAACTGGTACAGAAAAAA0.080200.060600.465500.500001.000001.00000


Target Position: 977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
977AGUCAUCUUGCUACCAGUA88.3905127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
450995AGTCATCTTGCTACCAGTATACTGGTAGCAAGATGACT0.193900.007900.525900.750001.000001.00000


Target Position: 421, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
421GAUGGAAAGCAGGUAGAGU83.0968285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
569439GATGGAAAGCAGGTAGAGTACTCTACCTGCTTTCCATC0.237600.037900.474100.500001.000001.00000


Target Position: 1134, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1134GCUUCUUUCUAGAAAGAGA94.117734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5871152GCTTCTTTCTAGAAAGAGATCTCTTTCTAGAAAGAAGC0.022000.001100.629300.750000.923900.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1132-1154TTGCTTCTTTCTAGAAAGAGAAAUCUCUUUCUAGAAAGAAGCAAGCUUCUUUCUAGAAAGAGAAAU19.110.302


Target Position: 1476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1476AUAAUUGGAUUUCCUAAUA82.3219315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5441494ATAATTGGATTTCCTAATATATTAGGAAATCCAATTAT0.029300.006600.500000.500000.962001.00000


Target Position: 1203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1203UGUCCUGCCUAUUAUCUGU75.5702635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071221TGTCCTGCCTATTATCTGTACAGATAATAGGCAGGACA0.309400.052200.500000.500001.000001.00000


Target Position: 245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
245AAGAGGCUGGACUCGGAUU72.4298800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
589263AAGAGGCTGGACTCGGATTAATCCGAGTCCAGCCTCTT0.055600.001100.629300.500000.918500.75000


Target Position: 1421, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1421UGUAUGUUACCAAAAAUAA85.9719196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2461439TGTATGTTACCAAAAATAATTATTTTTGGTAACATACA0.203400.030600.672400.750001.000001.00000


Target Position: 1324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1324ACCAGAAAAGCCCAAGUUC61.05661371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281342ACCAGAAAAGCCCAAGTTCGAACTTGGGCTTTTCTGGT0.052300.010800.681000.500001.000001.00000


Target Position: 847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
847CUUGUCUUGUGAAACCUUG66.55761115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
541865CTTGTCTTGTGAAACCTTGCAAGGTTTCACAAGACAAG0.342800.002500.491400.500000.994600.87500


Target Position: 500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
500CAGAUACCGAUGUUAUACU84.452242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
461518CAGATACCGATGTTATACTAGTATAACATCGGTATCTG0.087400.064700.577600.500001.000001.00000


Target Position: 1107, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1107CUAAUUCAAGGAAUUUCUU77.1395559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411125CTAATTCAAGGAATTTCTTAAGAAATTCCTTGAATTAG0.280700.037300.534500.750000.978300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1105-1127CGCTAATTCAAGGAATTTCTTAAAAGAAAUUCCUUGAAUUAGCGCUAAUUCAAGGAAUUUCUUAAU5.38.902


Target Position: 414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
414CGAGGUGGAUGGAAAGCAG80.3769397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
480432CGAGGTGGATGGAAAGCAGCTGCTTTCCATCCACCTCG0.236600.051500.508600.750001.000001.00000


Target Position: 1410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1410GUGCCACUUAAUGUAUGUU79.1002450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2411428GTGCCACTTAATGTATGTTAACATACATTAAGTGGCAC0.180600.074300.646600.750001.000001.00000


Target Position: 1185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1185ACUACUUUAUAACUAACAU84.4908241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3961203ACTACTTTATAACTAACATATGTTAGTTATAAAGTAGT0.486300.381500.551700.750001.000001.00000


Target Position: 1692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1692CCUGAGGCAAUUAGACACU73.4539749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571710CCTGAGGCAATTAGACACTAGTGTCTAATTGCCTCAGG0.261700.006500.637900.750001.000001.00000


Target Position: 666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666GCUAGCCAAGAUGAAGCAG64.80981211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
365684GCTAGCCAAGATGAAGCAGCTGCTTCATCTTGGCTAGC0.150800.015400.569000.750000.913000.75000


Target Position: 416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
416AGGUGGAUGGAAAGCAGGU70.4876920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
534434AGGTGGATGGAAAGCAGGTACCTGCTTTCCATCCACCT0.247000.042800.491400.500001.000001.00000


Target Position: 739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
739GGGUACAUGGAGUGUUCAG77.0147565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
414757GGGTACATGGAGTGTTCAGCTGAACACTCCATGTACCC0.075300.010300.706900.750001.000001.00000


Target Position: 105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
105GCCGCCCGCCCUCGCUCUC47.56791768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
355123GCCGCCCGCCCTCGCTCTCGAGAGCGAGGGCGGGCGGC0.098100.020700.689700.750000.907600.87500


Target Position: 771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771UGGAGUGAGAGAGGUUUUU65.25271186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
587789TGGAGTGAGAGAGGTTTTTAAAAACCTCTCTCACTCCA0.014500.001400.844800.750001.000001.00000


Target Position: 374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
374UGUAUGUGCCCACAGUGUU72.7868782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
594392TGTATGTGCCCACAGTGTTAACACTGTGGGCACATACA0.053600.001100.560300.750000.913000.75000