siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs, Sidirect 212   235   237   418   503   504   510   621   826   958   981   990   1031   1172   1175  
Biltr, Ernai, Sidirect 98   1001  
Biltr, Rnaxs 1   2   3   6   7   8   25   26   27   28   35   36   37   38   59   64   65   66   67   68  
69   70   72   73   74   75   77   79   80   83   84   88   89   120   124   125   126   127   128   129  
131   132   133   134   135   136   137   139   140   148   156   157   158   159   160   187   198   199   200   204  
205   206   207   208   209   210   211   213   217   218   219   220   221   222   223   224   225   226   227   228  
229   230   231   232   233   234   236   283   284   287   288   289   290   293   294   295   296   346   347   348  
349   361   362   363   371   372   373   374   384   385   389   390   391   392   395   396   397   401   402   403  
404   405   406   408   409   410   413   414   419   420   428   429   430   447   454   455   458   459   460   461  
464   465   489   490   491   493   494   496   497   498   500   501   502   505   506   508   509   511   512   610  
611   612   613   616   617   619   620   638   639   640   641   644   648   667   669   670   672   673   674   675  
676   677   698   699   713   717   718   719   720   721   722   726   729   734   736   737   738   767   771   772  
773   776   777   778   779   791   792   793   794   797   798   799   800   802   803   804   805   806   811   812  
813   814   815   816   817   818   821   824   825   827   835   836   843   844   845   855   856   857   860   861  
869   870   871   872   894   922   923   924   929   930   931   935   936   941   942   943   944   946   947   948  
949   950   951   952   953   954   955   956   957   959   960   961   966   970   977   978   979   980   982   989  
991   1013   1018   1019   1020   1021   1022   1027   1037   1038   1039   1040   1045   1046   1047   1048   1049   1050   1051   1052  
1053   1054   1055   1060   1067   1069   1074   1075   1076   1078   1079   1110   1111   1112   1116   1148   1149   1152   1153   1154  
1170   1171   1174   1176   1178   1179   1182  
Biltr, Sidirect 383   1014   1180  
Biltr, Ernai 1131  
Biltr, Ernai, Rnaxs, Sidirect 1011   1012   1177  
Biltr, Ernai, Rnaxs 76   78   499   807  


Target Position: 75, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
75AGACGUGAAGCACUGAAUA89.647187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
16193AGACGTGAAGCACTGAATATATTCAGTGCTTCACGTCT0.163600.033500.681000.750000.983701.00000


Target Position: 672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
672GAGUGGAACCUGUCGAUUA99.67674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
164690GAGTGGAACCTGTCGATTATAATCGACAGGTTCCACTC0.257000.024000.775900.750000.972800.62500


Target Position: 929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
929AGGGCCAGAUCUUCCACGU68.1168633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
233947AGGGCCAGATCTTCCACGTACGTGGAAGATCTGGCCCT0.636900.013000.569000.500001.000001.00000


Target Position: 489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
489ACCUACAGGACUGGGGUGA60.6076908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342507ACCTACAGGACTGGGGTGATCACCCCAGTCCTGTAGGT0.029800.001400.629300.500001.000001.00000


Target Position: 1037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1037CAGGUCUUUGACUCAGGUU78.9373321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3351055CAGGTCTTTGACTCAGGTTAACCTGAGTCAAAGACCTG0.023200.001700.637900.750000.989100.87500


Target Position: 120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
120CCAGAGCCACAUGUGGAGG57.1895992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
331138CCAGAGCCACATGTGGAGGCCTCCACATGTGGCTCTGG0.041200.002000.500000.500000.978300.87500


Target Position: 229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
229AUGAGAGUCUAAUUAAGUA94.729328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
332247ATGAGAGTCTAATTAAGTATACTTAATTAGACTCTCAT0.397100.030900.474100.500001.000001.00000


Target Position: 804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
804CCUCUUCAACACUGCCACA87.3672123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
149822CCTCTTCAACACTGCCACATGTGGCAGTGTTGAAGAGG0.222200.221700.637900.750001.000001.00000


Target Position: 464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
464GUCAGGCCUGAAAUACGUU78.3263335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
329482GTCAGGCCTGAAATACGTTAACGTATTTCAGGCCTGAC0.133400.002000.672400.750001.000001.00000


Target Position: 776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
776GUCCCUCCUCCCUGUCCAC63.9749788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
258794GTCCCTCCTCCCTGTCCACGTGGACAGGGAGGAGGGAC0.142200.078300.525900.500001.000001.00000


Target Position: 611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
611AGGCACGUACCACAACAAG65.9168706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
306629AGGCACGTACCACAACAAGCTTGTTGTGGTACGTGCCT0.038600.007100.706900.500000.907600.62500


Target Position: 803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
803CCCUCUUCAACACUGCCAC63.3621813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
149821CCCTCTTCAACACTGCCACGTGGCAGTGTTGAAGAGGG0.234700.236600.698300.750001.000001.00000


Target Position: 38, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
38AGAAGUCAGAGUUGAGAGA82.9957205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
29456AGAAGTCAGAGTTGAGAGATCTCTCAACTCTGACTTCT0.198500.045500.500000.500001.000001.00000


Target Position: 799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
799GGGUCCCUCUUCAACACUG75.249425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
71817GGGTCCCTCTTCAACACTGCAGTGTTGAAGAGGGACCC0.409400.377900.706900.750001.000001.00000


Target Position: 283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
283CAGAUCCGAAAGCCCCCAA75.795409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
153301CAGATCCGAAAGCCCCCAATTGGGGGCTTTCGGATCTG0.534600.031200.637900.750001.000001.00000


Target Position: 391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
391AGGAAACCAUUGUGUUAAA90.222976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
178409AGGAAACCATTGTGTTAAATTTAACACAATGGTTTCCT0.141700.020800.844800.750001.000001.00000


Target Position: 221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
221CAAAGAUGAUGAGAGUCUA99.29087

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340239CAAAGATGATGAGAGTCTATAGACTCTCATCATCTTTG0.077800.022700.474100.750001.000001.00000


Target Position: 460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
460UUGUGUCAGGCCUGAAAUA78.199342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
343478TTGTGTCAGGCCTGAAATATATTTCAGGCCTGACACAA0.034400.006700.603400.500001.000001.00000


Target Position: 1153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1153AGAGACACUGUAAACGACA83.4174196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3211171AGAGACACTGTAAACGACATGTCGTTTACAGTGTCTCT0.092100.002600.517200.500001.000001.00000


Target Position: 644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
644CGAUGACAAGCAAGACCAC79.21310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
299662CGATGACAAGCAAGACCACGTGGTCTTGCTTGTCATCG0.097400.040300.500000.750001.000001.00000


Target Position: 771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771ACCCUGUCCCUCCUCCCUG53.12111072

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
324789ACCCTGTCCCTCCTCCCTGCAGGGAGGAGGGACAGGGT0.168400.010600.569000.500001.000001.00000


Target Position: 225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
225GAUGAUGAGAGUCUAAUUA96.829616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
201243GATGATGAGAGTCTAATTATAATTAGACTCTCATCATC0.112900.035900.646600.750001.000001.00000


Target Position: 505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
505UGAAAGUGGAUAAAGCAAC61.0959888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
239523TGAAAGTGGATAAAGCAACGTTGCTTTATCCACTTTCA0.370500.100100.577600.500001.000001.00000


Target Position: 667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667GCUGGGAGUGGAACCUGUC70.375560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
344685GCTGGGAGTGGAACCTGTCGACAGGTTCCACTCCCAGC0.140500.001200.534500.750000.983700.87500


Target Position: 836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
836GCAUCUUUUCCCACCCUGU76.9609379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
183854GCATCTTTTCCCACCCTGTACAGGGTGGGAAAAGATGC0.136900.144900.646600.750001.000001.00000


Target Position: 825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
825UCCUUAUUGAUGCAUCUUU69.4247594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
202843TCCTTATTGATGCATCTTTAAAGATGCATCAATAAGGA0.111900.064300.870700.750001.000001.00000


Target Position: 924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
924CCAUCAGGGCCAGAUCUUC68.1948626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340942CCATCAGGGCCAGATCTTCGAAGATCTGGCCCTGATGG0.075600.001500.672400.750000.983700.75000


Target Position: 1047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1047ACUCAGGUUCCAGUAGUUC60.8197900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3001065ACTCAGGTTCCAGTAGTTCGAACTACTGGAACCTGAGT0.068900.006700.534500.500001.000001.00000


Target Position: 405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
405UUAAAGGAAGGUUCUGAAU66.2919690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
312423TTAAAGGAAGGTTCTGAATATTCAGAACCTTCCTTTAA0.030800.007400.525900.500001.000001.00000


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778CCCUCCUCCCUGUCCACAG62.8326831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
219796CCCTCCTCCCTGTCCACAGCTGTGGACAGGGAGGAGGG0.098900.048300.706900.750000.945700.62500


Target Position: 1176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1176AGAACAAGAAUAAAACAAU86.169141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1181194AGAACAAGAATAAAACAATATTGTTTTATTCTTGTTCT0.423000.142800.715500.750001.000001.00000


Target Position: 465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
465UCAGGCCUGAAAUACGUUC52.67341081

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
332483TCAGGCCTGAAATACGTTCGAACGTATTTCAGGCCTGA0.111800.001800.551700.500001.000001.00000


Target Position: 503, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
503GGUGAAAGUGGAUAAAGCA97.100815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
305521GGTGAAAGTGGATAAAGCATGCTTTATCCACTTTCACC0.369400.027700.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
501-523GGGGTGAAAGTGGATAAAGCAACUGCUUUAUCCACUUUCACCCCGGUGAAAGUGGAUAAAGCAACU13.619.232


Target Position: 954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
954CUCAGUACACAAUCAUUUA93.663334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
78972CTCAGTACACAATCATTTATAAATGATTGTGTACTGAG0.878900.648300.775900.750001.000001.00000


Target Position: 284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
284AGAUCCGAAAGCCCCCAAU68.0996636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
171302AGATCCGAAAGCCCCCAATATTGGGGGCTTTCGGATCT0.282200.030400.715500.750001.000001.00000


Target Position: 1040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1040GUCUUUGACUCAGGUUCCA79.6484296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3381058GTCTTTGACTCAGGTTCCATGGAACCTGAGTCAAAGAC0.047900.001600.474100.500001.000001.00000


Target Position: 222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
222AAAGAUGAUGAGAGUCUAA93.902633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
347240AAAGATGATGAGAGTCTAATTAGACTCTCATCATCTTT0.085600.025300.465500.500001.000001.00000


Target Position: 835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
835UGCAUCUUUUCCCACCCUG54.04481058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
220853TGCATCTTTTCCCACCCTGCAGGGTGGGAAAAGATGCA0.153000.070600.569000.500000.983700.62500


Target Position: 1172, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1172CAAGAGAACAAGAAUAAAA97.936213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2281190CAAGAGAACAAGAATAAAATTTTATTCTTGTTCTCTTG0.516300.011700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1170-1192CACAAGAGAACAAGAATAAAACAUUUUAUUCUUGUUCUCUUGUGCAAGAGAACAAGAAUAAAACAU2.119.112


Target Position: 401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
401UGUGUUAAAGGAAGGUUCU68.2732623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340419TGTGTTAAAGGAAGGTTCTAGAACCTTCCTTTAACACA0.018500.002200.482800.500001.000001.00000


Target Position: 1018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1018AUGGGCAAAUUAUCACUAA84.2592178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2111036ATGGGCAAATTATCACTAATTAGTGATAATTTGCCCAT0.293600.016900.620700.500000.994600.87500


Target Position: 395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
395AACCAUUGUGUUAAAGGAA83.5579192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
333413AACCATTGTGTTAAAGGAATTCCTTTAACACAATGGTT0.125100.016300.474100.500001.000001.00000


Target Position: 951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951CAUCUCAGUACACAAUCAU85.1585161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
300969CATCTCAGTACACAATCATATGATTGTGTACTGAGATG0.810700.613500.500000.750001.000001.00000


Target Position: 677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
677GAACCUGUCGAUUAAGAAG80.1568281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
341695GAACCTGTCGATTAAGAAGCTTCTTAATCGACAGGTTC0.040300.001400.534500.500000.972800.62500


Target Position: 217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
217UGGACAAAGAUGAUGAGAG70.5185556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
261235TGGACAAAGATGATGAGAGCTCTCATCATCTTTGTCCA0.079500.017900.534500.500001.000001.00000


Target Position: 991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
991CCUAUUCAAGCAACUAGAG71.4058537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2511009CCTATTCAAGCAACTAGAGCTCTAGTTGCTTGAATAGG0.562000.018100.534500.750001.000001.00000


Target Position: 870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
870CUAGAACAAGAGGCUUAAA87.5572113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
278888CTAGAACAAGAGGCTTAAATTTAAGCCTCTTGTTCTAG0.056800.016900.672400.750001.000001.00000


Target Position: 204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
204GAGCUGCAGGAAAUGGACA86.0754146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
283222GAGCTGCAGGAAATGGACATGTCCATTTCCTGCAGCTC0.085500.005900.603400.500001.000001.00000


Target Position: 1013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1013AGAAAAUGGGCAAAUUAUC67.1579668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2451031AGAAAATGGGCAAATTATCGATAATTTGCCCATTTTCT0.463900.014700.543100.500001.000001.00000


Target Position: 135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
135GAGGAGGAUGAUGAUGAUG73.659474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
300153GAGGAGGATGATGATGATGCATCATCATCATCCTCCTC0.124700.004700.655200.500001.000001.00000


Target Position: 461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
461UGUGUCAGGCCUGAAAUAC58.3388973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
292479TGTGTCAGGCCTGAAATACGTATTTCAGGCCTGACACA0.045900.007700.525900.500001.000001.00000


Target Position: 641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
641CGACGAUGACAAGCAAGAC78.0365348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
336659CGACGATGACAAGCAAGACGTCTTGCTTGTCATCGTCG0.131800.053100.474100.750001.000001.00000


Target Position: 670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
670GGGAGUGGAACCUGUCGAU84.8219169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
268688GGGAGTGGAACCTGTCGATATCGACAGGTTCCACTCCC0.177500.007300.810301.000001.000001.00000


Target Position: 942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
942CCACGUCUCCAUCUCAGUA93.302740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
128960CCACGTCTCCATCTCAGTATACTGAGATGGAGACGTGG0.669900.497700.663801.000000.978300.75000


Target Position: 1038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1038AGGUCUUUGACUCAGGUUC62.2932846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3371056AGGTCTTTGACTCAGGTTCGAACCTGAGTCAAAGACCT0.020200.001600.672400.500000.989100.75000


Target Position: 454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
454GGGAUAUUGUGUCAGGCCU79.5271303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340472GGGATATTGTGTCAGGCCTAGGCCTGACACAATATCCC0.017300.002400.646600.750001.000001.00000


Target Position: 1182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1182AGAAUAAAACAAUAACUGU82.9615206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2711200AGAATAAAACAATAACTGTACAGTTATTGTTTTATTCT0.193200.153200.517200.500001.000001.00000


Target Position: 402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
402GUGUUAAAGGAAGGUUCUG65.7924713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
333420GTGTTAAAGGAAGGTTCTGCAGAACCTTCCTTTAACAC0.019500.002300.508600.500001.000001.00000


Target Position: 1149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1149UGUGAGAGACACUGUAAAC73.1414491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2881167TGTGAGAGACACTGTAAACGTTTACAGTGTCTCTCACA0.416500.005400.560300.500000.907600.62500


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949UCCAUCUCAGUACACAAUC53.10091073

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
260967TCCATCTCAGTACACAATCGATTGTGTACTGAGATGGA0.765300.617200.689700.500001.000001.00000


Target Position: 948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
948CUCCAUCUCAGUACACAAU81.0018258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
107966CTCCATCTCAGTACACAATATTGTGTACTGAGATGGAG0.750300.568400.801700.750001.000001.00000


Target Position: 827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
827CUUAUUGAUGCAUCUUUUC65.3985732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
348845CTTATTGATGCATCTTTTCGAAAAGATGCATCAATAAG0.329300.071800.465500.500001.000001.00000


Target Position: 1178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1178AACAAGAAUAAAACAAUAA86.0865145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3021196AACAAGAATAAAACAATAATTATTGTTTTATTCTTGTT0.363900.326600.612100.500001.000001.00000


Target Position: 389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
389AAAGGAAACCAUUGUGUUA89.721885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
343407AAAGGAAACCATTGTGTTATAACACAATGGTTTCCTTT0.115800.014300.465500.500001.000001.00000


Target Position: 224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
224AGAUGAUGAGAGUCUAAUU93.524838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
216242AGATGATGAGAGTCTAATTAATTAGACTCTCATCATCT0.100300.031800.715500.750001.000001.00000


Target Position: 978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
978UCCCUGUCUUACCCCUAUU66.7655674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
140996TCCCTGTCTTACCCCTATTAATAGGGGTAAGACAGGGA0.297000.163400.862100.750001.000001.00000


Target Position: 227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
227UGAUGAGAGUCUAAUUAAG79.1718311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
329245TGATGAGAGTCTAATTAAGCTTAATTAGACTCTCATCA0.100400.023500.586200.500001.000001.00000


Target Position: 961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
961CACAAUCAUUUAAUAUUUC75.2819423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
200979CACAATCATTTAATATTTCGAAATATTAAATGATTGTG0.883400.791200.620700.500001.000001.00000


Target Position: 362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
362CCUUACUGGAGAUCUGGAA84.5653173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327380CCTTACTGGAGATCTGGAATTCCAGATCTCCAGTAAGG0.059900.002100.672401.000001.000001.00000


Target Position: 206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
206GCUGCAGGAAAUGGACAAA85.9261148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
282224GCTGCAGGAAATGGACAAATTTGTCCATTTCCTGCAGC0.054900.012500.853401.000001.000001.00000


Target Position: 455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
455GGAUAUUGUGUCAGGCCUG77.2194371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342473GGATATTGTGTCAGGCCTGCAGGCCTGACACAATATCC0.016700.002900.586200.750001.000001.00000


Target Position: 228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
228GAUGAGAGUCUAAUUAAGU88.1417107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
339246GATGAGAGTCTAATTAAGTACTTAATTAGACTCTCATC0.230200.026400.474100.500001.000001.00000


Target Position: 430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
430UCAAAAUUCACUUCAAAGU64.5737763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
347448TCAAAATTCACTTCAAAGTACTTTGAAGTGAATTTTGA0.013400.002400.517200.500001.000001.00000


Target Position: 1045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1045UGACUCAGGUUCCAGUAGU69.8854577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2941063TGACTCAGGTTCCAGTAGTACTACTGGAACCTGAGTCA0.061800.005000.517200.500000.983700.62500


Target Position: 396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
396ACCAUUGUGUUAAAGGAAG62.3129844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
304414ACCATTGTGTTAAAGGAAGCTTCCTTTAACACAATGGT0.039200.012200.715500.500001.000001.00000


Target Position: 397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
397CCAUUGUGUUAAAGGAAGG66.1728697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
318415CCATTGTGTTAAAGGAAGGCCTTCCTTTAACACAATGG0.027700.008400.500000.500001.000001.00000


Target Position: 721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
721CCCUUUCCCCACCCUUGCC48.64881138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
317739CCCTTTCCCCACCCTTGCCGGCAAGGGTGGGGAAAGGG0.382600.077000.491400.500001.000001.00000


Target Position: 1111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1111UCCCUAGUCACAUCCCCUG54.56241047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2601129TCCCTAGTCACATCCCCTGCAGGGGATGTGACTAGGGA0.067100.048800.586200.500001.000001.00000


Target Position: 290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
290GAAAGCCCCCAAUGUCGUU75.5708416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
261308GAAAGCCCCCAATGTCGTTAACGACATTGGGGGCTTTC0.203600.060300.525900.750001.000001.00000


Target Position: 956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
956CAGUACACAAUCAUUUAAU86.241137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
155974CAGTACACAATCATTTAATATTAAATGATTGTGTACTG0.882300.697200.775900.750001.000001.00000


Target Position: 348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
348CCAAUCACCAUGGACCUUA79.0598318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
253366CCAATCACCATGGACCTTATAAGGTCCATGGTGATTGG0.108500.008700.810301.000000.962000.62500


Target Position: 198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
198CUGAAAGAGCUGCAGGAAA85.3094156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182216CTGAAAGAGCTGCAGGAAATTTCCTGCAGCTCTTTCAG0.139500.025400.784500.750001.000001.00000


Target Position: 1075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1075CCUAGAUUCUUUUGUGGUU81.9964230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3201093CCTAGATTCTTTTGTGGTTAACCACAAAAGAATCTAGG0.027300.010700.698301.000001.000001.00000


Target Position: 619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
619ACCACAACAAGUCCUUCUU70.3442564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
339637ACCACAACAAGTCCTTCTTAAGAAGGACTTGTTGTGGT0.017900.012600.715500.750001.000001.00000


Target Position: 7, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7GACUUCCUUCCUGUUCUAA86.1386142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
15125GACTTCCTTCCTGTTCTAATTAGAACAGGAAGGAAGTC0.410700.309900.784500.750001.000001.00000


Target Position: 27, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
27UGCCAGUACUCAGAAGUCA79.0048319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
31845TGCCAGTACTCAGAAGTCATGACTTCTGAGTACTGGCA0.281000.013300.629300.500001.000001.00000


Target Position: 1148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1148UUGUGAGAGACACUGUAAA80.4285276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3361166TTGTGAGAGACACTGTAAATTTACAGTGTCTCTCACAA0.594700.001700.646600.500000.907600.75000


Target Position: 1177, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1177GAACAAGAAUAAAACAAUA102.9632

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7117719GAACAAGAATAAAACAATA1/1/0/093.44ARHGDIBNM_001175.41NANANA12:15094971..15094989(-)00ARHGDIB(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1711195GAACAAGAATAAAACAATATATTGTTTTATTCTTGTTC0.402400.363200.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1175-1197GAGAACAAGAATAAAACAATAACUAUUGUUUUAUUCUUGUUCUCGAACAAGAAUAAAACAAUAACU5.319.221


Target Position: 806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
806UCUUCAACACUGCCACAUU76.5072397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
128824TCTTCAACACTGCCACATTAATGTGGCAGTGTTGAAGA0.201200.199300.715500.750001.000001.00000


Target Position: 208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
208UGCAGGAAAUGGACAAAGA80.8881262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
276226TGCAGGAAATGGACAAAGATCTTTGTCCATTTCCTGCA0.057000.013600.629300.500001.000001.00000


Target Position: 613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
613GCACGUACCACAACAAGUC73.7347470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
297631GCACGTACCACAACAAGTCGACTTGTTGTGGTACGTGC0.043200.011800.534500.750000.978300.62500


Target Position: 791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791CCACAGCUGGGUCCCUCUU70.4567557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
303809CCACAGCTGGGTCCCTCTTAAGAGGGACCCAGCTGTGG0.756900.004500.706901.000000.934800.62500


Target Position: 610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
610GAGGCACGUACCACAACAA96.763617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
199628GAGGCACGTACCACAACAATTGTTGTGGTACGTGCCTC0.179000.014200.663800.750000.907600.75000


Target Position: 428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
428AGUCAAAAUUCACUUCAAA94.125432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327446AGTCAAAATTCACTTCAAATTTGAAGTGAATTTTGACT0.021000.005000.706900.750000.994600.62500


Target Position: 187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
187CACAGAAGUCCCUGAAAGA92.211151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
334205CACAGAAGTCCCTGAAAGATCTTTCAGGGACTTCTGTG0.044200.004500.569000.500000.929300.75000


Target Position: 1112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1112CCCUAGUCACAUCCCCUGC57.0466993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2781130CCCTAGTCACATCCCCTGCGCAGGGGATGTGACTAGGG0.057800.038300.637900.500000.983700.62500


Target Position: 953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
953UCUCAGUACACAAUCAUUU73.197489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
52971TCTCAGTACACAATCATTTAAATGATTGTGTACTGAGA0.845200.635400.724100.750001.000001.00000


Target Position: 814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
814ACUGCCACAUUUCCUUAUU70.1924567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
78832ACTGCCACATTTCCTTATTAATAAGGAAATGTGGCAGT0.499900.087900.698300.750001.000001.00000


Target Position: 1154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1154GAGACACUGUAAACGACAC80.8211267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2931172GAGACACTGTAAACGACACGTGTCGTTTACAGTGTCTC0.075200.005000.517200.500000.989100.62500


Target Position: 979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
979CCCUGUCUUACCCCUAUUC63.9224791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
96997CCCTGTCTTACCCCTATTCGAATAGGGGTAAGACAGGG0.298500.153800.819000.750001.000001.00000


Target Position: 772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
772CCCUGUCCCUCCUCCCUGU70.4229559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
177790CCCTGTCCCTCCTCCCTGTACAGGGAGGAGGGACAGGG0.154400.019600.784500.750001.000001.00000


Target Position: 36, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
36UCAGAAGUCAGAGUUGAGA72.7955501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
29054TCAGAAGTCAGAGTTGAGATCTCAACTCTGACTTCTGA0.178200.031200.500000.500001.000001.00000


Target Position: 74, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
74GAGACGUGAAGCACUGAAU87.9401108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
19492GAGACGTGAAGCACTGAATATTCAGTGCTTCACGTCTC0.120300.030800.801700.750000.983701.00000


Target Position: 935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
935AGAUCUUCCACGUCUCCAU82.556214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
222953AGATCTTCCACGTCTCCATATGGAGACGTGGAAGATCT0.652800.487400.569000.750001.000001.00000


Target Position: 1053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053GUUCCAGUAGUUCAUUCUA90.961465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3371071GTTCCAGTAGTTCATTCTATAGAATGAACTACTGGAAC0.160200.045500.474100.750001.000001.00000


Target Position: 970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
970UUAAUAUUUCCCUGUCUUA80.7662270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
292988TTAATATTTCCCTGTCTTATAAGACAGGGAAATATTAA0.540100.516200.500000.500001.000001.00000


Target Position: 80, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
80UGAAGCACUGAAUAAAUAG70.1863568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
29598TGAAGCACTGAATAAATAGCTATTTATTCAGTGCTTCA0.839800.098300.551700.500001.000001.00000


Target Position: 620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
620CCACAACAAGUCCUUCUUC71.2983540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
330638CCACAACAAGTCCTTCTTCGAAGAAGGACTTGTTGTGG0.020500.013200.672400.750001.000001.00000


Target Position: 237, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
237CUAAUUAAGUACAAGAAAA95.731324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
107255CTAATTAAGTACAAGAAAATTTTCTTGTACTTAATTAG0.597200.319100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
235-257GTCTAATTAAGTACAAGAAAACGUUUUCUUGUACUUAAUUAGACCUAAUUAAGUACAAGAAAACGU12.2-7.522


Target Position: 777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777UCCCUCCUCCCUGUCCACA58.7665959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
180795TCCCTCCTCCCTGTCCACATGTGGACAGGGAGGAGGGA0.142500.068500.663800.500001.000001.00000


Target Position: 955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
955UCAGUACACAAUCAUUUAA83.1171204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
87973TCAGTACACAATCATTTAATTAAATGATTGTGTACTGA0.875500.641100.689700.750001.000001.00000


Target Position: 736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736UGCCACCUGGAAGAAUUCU58.0554982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
229754TGCCACCTGGAAGAATTCTAGAATTCTTCCAGGTGGCA0.143300.011600.629300.500001.000001.00000


Target Position: 493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
493ACAGGACUGGGGUGAAAGU71.5574528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313511ACAGGACTGGGGTGAAAGTACTTTCACCCCAGTCCTGT0.030800.004400.500000.500001.000001.00000


Target Position: 26, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
26CUGCCAGUACUCAGAAGUC73.2942487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
34544CTGCCAGTACTCAGAAGTCGACTTCTGAGTACTGGCAG0.030400.012900.465500.500000.994600.62500


Target Position: 512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512GGAUAAAGCAACAUUUAUG85.1603160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
321530GGATAAAGCAACATTTATGCATAAATGTTGCTTTATCC0.027200.006800.715500.750001.000001.00000


Target Position: 722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
722CCUUUCCCCACCCUUGCCA64.4236772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
291740CCTTTCCCCACCCTTGCCATGGCAAGGGTGGGGAAAGG0.373700.090300.500000.750001.000001.00000


Target Position: 989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
989CCCCUAUUCAAGCAACUAG71.5275529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2321007CCCCTATTCAAGCAACTAGCTAGTTGCTTGAATAGGGG0.090000.058400.819000.750001.000001.00000


Target Position: 1, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1CUCAUUGACUUCCUUCCUG67.2301665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
28819CTCATTGACTTCCTTCCTGCAGGAAGGAAGTCAATGAG0.410900.227800.525900.500001.000001.00000


Target Position: 79, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
79GUGAAGCACUGAAUAAAUA95.289626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8797GTGAAGCACTGAATAAATATATTTATTCAGTGCTTCAC0.703700.094400.750000.750001.000001.00000


Target Position: 1180, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1180CAAGAAUAAAACAAUAACU86.1012144

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1178-1200AACAAGAATAAAACAATAACTGTAGUUAUUGUUUUAUUCUUGUUCAAGAAUAAAACAAUAACUGUU6.96.922


Target Position: 1079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1079GAUUCUUUUGUGGUUGUUG71.3565538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3481097GATTCTTTTGTGGTTGTTGCAACAACCACAAAAGAATC0.012700.007300.534500.500001.000001.00000


Target Position: 419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
419UGAAUAUAGAGUCAAAAUU76.7105389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
280437TGAATATAGAGTCAAAATTAATTTTGACTCTATATTCA0.055400.012100.715500.750001.000001.00000


Target Position: 494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
494CAGGACUGGGGUGAAAGUG62.2428849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
316512CAGGACTGGGGTGAAAGTGCACTTTCACCCCAGTCCTG0.034700.005300.491400.500001.000001.00000


Target Position: 797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
797CUGGGUCCCUCUUCAACAC67.8988646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
321815CTGGGTCCCTCTTCAACACGTGTTGAAGAGGGACCCAG0.808200.032300.491400.500001.000001.00000


Target Position: 717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
717CCACCCCUUUCCCCACCCU61.2285885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
302735CCACCCCTTTCCCCACCCTAGGGTGGGGAAAGGGGTGG0.482200.097100.500000.750001.000001.00000


Target Position: 960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
960ACACAAUCAUUUAAUAUUU83.2925199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86978ACACAATCATTTAATATTTAAATATTAAATGATTGTGT0.881200.777900.706900.750001.000001.00000


Target Position: 499, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
499CUGGGGUGAAAGUGGAUAA86.3149135

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1049919CTGGGGTGAAAGTGGATAA1/1/0/091.46ARHGDIBNM_001175.41NANANA12:15095649,15097710..15095655,15097721(-)00ARHGDIB(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
225517CTGGGGTGAAAGTGGATAATTATCCACTTTCACCCCAG0.185300.012100.750000.750001.000001.00000


Target Position: 1039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1039GGUCUUUGACUCAGGUUCC69.8725578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3341057GGTCTTTGACTCAGGTTCCGGAACCTGAGTCAAAGACC0.035300.001700.482800.500000.989100.62500


Target Position: 288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
288CCGAAAGCCCCCAAUGUCG59.3793940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
312306CCGAAAGCCCCCAATGTCGCGACATTGGGGGCTTTCGG0.176000.059700.620700.500001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051AGGUUCCAGUAGUUCAUUC70.0671571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3421069AGGTTCCAGTAGTTCATTCGAATGAACTACTGGAACCT0.111600.023500.672400.500001.000001.00000


Target Position: 234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
234AGUCUAAUUAAGUACAAGA90.835570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
328252AGTCTAATTAAGTACAAGATCTTGTACTTAATTAGACT0.424800.053200.482800.500001.000001.00000


Target Position: 502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
502GGGUGAAAGUGGAUAAAGC78.7053328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
232520GGGTGAAAGTGGATAAAGCGCTTTATCCACTTTCACCC0.346100.019200.637900.500001.000001.00000


Target Position: 729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
729CCACCCUUGCCACCUGGAA75.0979430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
338747CCACCCTTGCCACCTGGAATTCCAGGTGGCAAGGGTGG0.017900.010400.672401.000001.000001.00000


Target Position: 65, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
65CCCCGGACAGAGACGUGAA86.6837131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
25383CCCCGGACAGAGACGTGAATTCACGTCTCTGTCCGGGG0.071400.029600.819001.000000.956500.62500


Target Position: 73, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
73AGAGACGUGAAGCACUGAA84.8689167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
24191AGAGACGTGAAGCACTGAATTCAGTGCTTCACGTCTCT0.113400.027300.551700.750000.983701.00000


Target Position: 959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
959UACACAAUCAUUUAAUAUU77.7786354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
311977TACACAATCATTTAATATTAATATTAAATGATTGTGTA0.882100.753200.672400.500001.000001.00000


Target Position: 349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
349CAAUCACCAUGGACCUUAC82.4132217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
344367CAATCACCATGGACCTTACGTAAGGTCCATGGTGATTG0.106100.005500.465500.500001.000001.00000


Target Position: 403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
403UGUUAAAGGAAGGUUCUGA76.8857382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
334421TGTTAAAGGAAGGTTCTGATCAGAACCTTCCTTTAACA0.019300.003700.482800.500001.000001.00000


Target Position: 418, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
418CUGAAUAUAGAGUCAAAAU87.8743110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
200436CTGAATATAGAGTCAAAATATTTTGACTCTATATTCAG0.113100.024200.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
416-438TTCTGAATATAGAGTCAAAATTCAUUUUGACUCUAUAUUCAGAACUGAAUAUAGAGUCAAAAUUCU14.98.722


Target Position: 409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409AGGAAGGUUCUGAAUAUAG75.0069431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
338427AGGAAGGTTCTGAATATAGCTATATTCAGAACCTTCCT0.155400.008500.672400.500001.000001.00000


Target Position: 231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
231GAGAGUCUAAUUAAGUACA92.643248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197249GAGAGTCTAATTAAGTACATGTACTTAATTAGACTCTC0.389400.040200.603400.500001.000001.00000


Target Position: 390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
390AAGGAAACCAUUGUGUUAA80.145282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
206408AAGGAAACCATTGTGTTAATTAACACAATGGTTTCCTT0.110600.014200.603400.500001.000001.00000


Target Position: 947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
947UCUCCAUCUCAGUACACAA91.063964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
219965TCTCCATCTCAGTACACAATTGTGTACTGAGATGGAGA0.682600.566900.577600.750001.000001.00000


Target Position: 78, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
78CGUGAAGCACUGAAUAAAU91.132861

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_27819CGTGAAGCACTGAATAAAT1/1/0/094.96ARHGDIBNM_001175.41NANANA8:120819263..120819281(+)00ARHGDIB(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9196CGTGAAGCACTGAATAAATATTTATTCAGTGCTTCACG0.327000.064400.767201.000000.983700.62500


Target Position: 67, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
67CCGGACAGAGACGUGAAGC55.94771014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
31585CCGGACAGAGACGTGAAGCGCTTCACGTCTCTGTCCGG0.072600.029100.560300.500001.000001.00000


Target Position: 295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
295CCCCCAAUGUCGUUGUCAC72.7422502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
346313CCCCCAATGTCGTTGTCACGTGACAACGACATTGGGGG0.014300.007800.698300.750001.000001.00000


Target Position: 843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
843UUCCCACCCUGUCACUCAA76.5192396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
314861TTCCCACCCTGTCACTCAATTGAGTGACAGGGTGGGAA0.108000.042000.525900.500001.000001.00000


Target Position: 6, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6UGACUUCCUUCCUGUUCUA85.2662158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
23924TGACTTCCTTCCTGTTCTATAGAACAGGAAGGAAGTCA0.400100.294800.551700.750001.000001.00000


Target Position: 209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
209GCAGGAAAUGGACAAAGAU88.91196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
249227GCAGGAAATGGACAAAGATATCTTTGTCCATTTCCTGC0.073200.013500.672401.000001.000001.00000


Target Position: 219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
219GACAAAGAUGAUGAGAGUC72.8073499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313237GACAAAGATGATGAGAGTCGACTCTCATCATCTTTGTC0.058400.025600.500000.500001.000001.00000


Target Position: 1011, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1011CCAGAAAAUGGGCAAAUUA90.943366

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4101119CCAGAAAATGGGCAAATTA1/1/0/094.96ARHGDIBNM_001175.41NANANA12:15095137..15095155(-)00ARHGDIB(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2431029CCAGAAAATGGGCAAATTATAATTTGCCCATTTTCTGG0.279200.010000.810301.000000.983700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1009-1031GGCCAGAAAATGGGCAAATTATCUAAUUUGCCCAUUUUCUGGCCCCAGAAAAUGGGCAAAUUAUCU14.012.222


Target Position: 639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
639ACCGACGAUGACAAGCAAG61.7369866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
251657ACCGACGATGACAAGCAAGCTTGCTTGTCATCGTCGGT0.324200.154500.715500.500001.000001.00000


Target Position: 718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
718CACCCCUUUCCCCACCCUU65.655719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
130736CACCCCTTTCCCCACCCTTAAGGGTGGGGAAAGGGGTG0.513400.079400.655200.750001.000001.00000


Target Position: 857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
857CUCAACGUGGUCCCUAGAA76.2225404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
271875CTCAACGTGGTCCCTAGAATTCTAGGGACCACGTTGAG0.295500.006900.637900.750001.000001.00000


Target Position: 1152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1152GAGAGACACUGUAAACGAC85.9518147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3191170GAGAGACACTGTAAACGACGTCGTTTACAGTGTCTCTC0.100300.004600.491400.500001.000001.00000


Target Position: 374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
374UCUGGAAGCCCUCAAAAAG63.0437823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
314392TCTGGAAGCCCTCAAAAAGCTTTTTGAGGGCTTCCAGA0.177400.003500.586200.500000.962000.87500


Target Position: 491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
491CUACAGGACUGGGGUGAAA84.5835172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
317509CTACAGGACTGGGGTGAAATTTCACCCCAGTCCTGTAG0.030600.003200.672400.750001.000001.00000


Target Position: 501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
501GGGGUGAAAGUGGAUAAAG72.295513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
191519GGGGTGAAAGTGGATAAAGCTTTATCCACTTTCACCCC0.195300.016500.853400.750001.000001.00000


Target Position: 1179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1179ACAAGAAUAAAACAAUAAC69.7004586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2311197ACAAGAATAAAACAATAACGTTATTGTTTTATTCTTGT0.304700.294600.560300.500001.000001.00000


Target Position: 807, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
807CUUCAACACUGCCACAUUU84.132180

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_180719CTTCAACACTGCCACATTT1/1/0/097.21ARHGDIBNM_001175.41NANANA12:15095341..15095359(-)00ARHGDIB(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
164825CTTCAACACTGCCACATTTAAATGTGGCAGTGTTGAAG0.209200.184500.637900.750001.000001.00000


Target Position: 296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
296CCCCAAUGUCGUUGUCACC64.2893778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
330314CCCCAATGTCGTTGTCACCGGTGACAACGACATTGGGG0.113400.002000.637900.500001.000001.00000


Target Position: 640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
640CCGACGAUGACAAGCAAGA79.1309315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86658CCGACGATGACAAGCAAGATCTTGCTTGTCATCGTCGG0.486900.154600.689700.750001.000001.00000


Target Position: 211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
211AGGAAAUGGACAAAGAUGA80.4298275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
221229AGGAAATGGACAAAGATGATCATCTTTGTCCATTTCCT0.682600.031200.620700.500001.000001.00000


Target Position: 1012, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1012CAGAAAAUGGGCAAAUUAU87.4063119

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5101219CAGAAAATGGGCAAATTAT1/1/0/094.96ARHGDIBNM_001175.41NANANA12:15095136..15095154(-)00ARHGDIB(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2101030CAGAAAATGGGCAAATTATATAATTTGCCCATTTTCTG0.390900.013100.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1010-1032GCCAGAAAATGGGCAAATTATCAAUAAUUUGCCCAUUUUCUGGCCAGAAAAUGGGCAAAUUAUCAU-1.45.322


Target Position: 944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
944ACGUCUCCAUCUCAGUACA84.8225168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
301962ACGTCTCCATCTCAGTACATGTACTGAGATGGAGACGT0.659800.494500.569000.500001.000001.00000


Target Position: 385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
385UCAAAAAGGAAACCAUUGU61.8575861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
311403TCAAAAAGGAAACCATTGTACAATGGTTTCCTTTTTGA0.033000.019000.517200.500001.000001.00000


Target Position: 89, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
89GAAUAAAUAGAUCAGAAUG84.5436174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
331107GAATAAATAGATCAGAATGCATTCTGATCTATTTATTC0.044600.042600.517200.500001.000001.00000


Target Position: 128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
128ACAUGUGGAGGAGGAUGAU76.7687387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
268146ACATGTGGAGGAGGATGATATCATCCTCCTCCACATGT0.520900.024600.525900.750001.000001.00000


Target Position: 25, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
25ACUGCCAGUACUCAGAAGU66.0534704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
32643ACTGCCAGTACTCAGAAGTACTTCTGAGTACTGGCAGT0.021800.013300.500000.500000.962000.62500


Target Position: 805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
805CUCUUCAACACUGCCACAU68.7589605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
132823CTCTTCAACACTGCCACATATGTGGCAGTGTTGAAGAG0.211100.211400.655200.750001.000001.00000


Target Position: 35, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
35CUCAGAAGUCAGAGUUGAG79.2876309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
32353CTCAGAAGTCAGAGTTGAGCTCAACTCTGACTTCTGAG0.172200.025800.500000.500000.913000.62500


Target Position: 148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
148AUGAUGAGCUGGACAGCAA87.628112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
347166ATGATGAGCTGGACAGCAATTGCTGTCCAGCTCATCAT0.027700.001100.508600.500000.923900.75000


Target Position: 923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
923UCCAUCAGGGCCAGAUCUU60.7144905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
345941TCCATCAGGGCCAGATCTTAAGATCTGGCCCTGATGGA0.071700.001200.732800.750000.929300.75000


Target Position: 77, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
77ACGUGAAGCACUGAAUAAA86.5169134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
12695ACGTGAAGCACTGAATAAATTTATTCAGTGCTTCACGT0.243200.058300.775900.750000.983700.75000


Target Position: 990, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
990CCCUAUUCAAGCAACUAGA83.5309193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2501008CCCTATTCAAGCAACTAGATCTAGTTGCTTGAATAGGG0.072700.047400.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
988-1010ACCCCTATTCAAGCAACTAGAGGUCUAGUUGCUUGAAUAGGGGUCCCUAUUCAAGCAACUAGAGGU16.419.933


Target Position: 136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
136AGGAGGAUGAUGAUGAUGA85.3011157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
241154AGGAGGATGATGATGATGATCATCATCATCATCCTCCT0.102100.101700.620700.500001.000001.00000


Target Position: 157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
157UGGACAGCAAGCUCAAUUA84.909166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
298175TGGACAGCAAGCTCAATTATAATTGAGCTTGCTGTCCA0.053600.004900.810300.750001.000001.00000


Target Position: 210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
210CAGGAAAUGGACAAAGAUG78.0406347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
281228CAGGAAATGGACAAAGATGCATCTTTGTCCATTTCCTG0.093200.010800.629300.500001.000001.00000


Target Position: 410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410GGAAGGUUCUGAAUAUAGA97.976212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
248428GGAAGGTTCTGAATATAGATCTATATTCAGAACCTTCC0.157800.009400.646600.750001.000001.00000


Target Position: 957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
957AGUACACAAUCAUUUAAUA97.837814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
122975AGTACACAATCATTTAATATATTAAATGATTGTGTACT0.889500.714300.663800.750001.000001.00000


Target Position: 698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
698GUGGACAGAAUGAAUGCAU79.8162290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
282716GTGGACAGAATGAATGCATATGCATTCATTCTGTCCAC0.132100.005900.637900.750001.000001.00000


Target Position: 392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
392GGAAACCAUUGUGUUAAAG71.4728532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181410GGAAACCATTGTGTTAAAGCTTTAACACAATGGTTTCC0.139500.022100.732800.750001.000001.00000


Target Position: 294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
294GCCCCCAAUGUCGUUGUCA74.7175439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
134312GCCCCCAATGTCGTTGTCATGACAACGACATTGGGGGC0.189700.088200.775900.750001.000001.00000


Target Position: 207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
207CUGCAGGAAAUGGACAAAG62.7957832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327225CTGCAGGAAATGGACAAAGCTTTGTCCATTTCCTGCAG0.055000.011500.646600.500001.000001.00000


Target Position: 800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
800GGUCCCUCUUCAACACUGC66.5483681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
322818GGTCCCTCTTCAACACTGCGCAGTGTTGAAGAGGGACC0.387000.357700.500000.500001.000001.00000


Target Position: 1060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1060UAGUUCAUUCUAAUGCCUA81.3073249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2951078TAGTTCATTCTAATGCCTATAGGCATTAGAATGAACTA0.150700.054400.500000.500001.000001.00000


Target Position: 160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
160ACAGCAAGCUCAAUUAUAA96.47819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
240178ACAGCAAGCTCAATTATAATTATAATTGAGCTTGCTGT0.119800.010400.672400.750001.000001.00000


Target Position: 669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
669UGGGAGUGGAACCUGUCGA69.9103575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
310687TGGGAGTGGAACCTGTCGATCGACAGGTTCCACTCCCA0.164500.005000.551700.500000.983700.75000


Target Position: 943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
943CACGUCUCCAUCUCAGUAC68.2875621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
320961CACGTCTCCATCTCAGTACGTACTGAGATGGAGACGTG0.668300.495200.612100.500000.978300.62500


Target Position: 1031, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1031CACUAACAGGUCUUUGACU83.4656194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2841049CACTAACAGGTCTTTGACTAGTCAAAGACCTGTTAGTG0.053200.010000.586200.500000.989100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1029-1051ATCACTAACAGGTCTTTGACTCAAGUCAAAGACCUGUUAGUGAUCACUAACAGGUCUUUGACUCAU19.219.033


Target Position: 88, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
88UGAAUAAAUAGAUCAGAAU82.2265220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
291106TGAATAAATAGATCAGAATATTCTGATCTATTTATTCA0.046500.044500.715500.750001.000001.00000


Target Position: 699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
699UGGACAGAAUGAAUGCAUC70.2112566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
225717TGGACAGAATGAATGCATCGATGCATTCATTCTGTCCA0.125000.012100.663800.500001.000001.00000


Target Position: 213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
213GAAAUGGACAAAGAUGAUG69.9438573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
297231GAAATGGACAAAGATGATGCATCATCTTTGTCCATTTC0.656000.026600.517200.500001.000001.00000


Target Position: 500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
500UGGGGUGAAAGUGGAUAAA74.1842459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196518TGGGGTGAAAGTGGATAAATTTATCCACTTTCACCCCA0.190200.014700.844800.750001.000001.00000


Target Position: 226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
226AUGAUGAGAGUCUAAUUAA91.130862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
258244ATGATGAGAGTCTAATTAATTAATTAGACTCTCATCAT0.068800.024700.620700.500001.000001.00000


Target Position: 404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
404GUUAAAGGAAGGUUCUGAA91.234860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
338422GTTAAAGGAAGGTTCTGAATTCAGAACCTTCCTTTAAC0.024100.005600.474100.750001.000001.00000


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737GCCACCUGGAAGAAUUCUC62.9881825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
216755GCCACCTGGAAGAATTCTCGAGAATTCTTCCAGGTGGC0.167800.012700.689700.750001.000001.00000


Target Position: 872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
872AGAACAAGAGGCUUAAAAC77.0194375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
335890AGAACAAGAGGCTTAAAACGTTTTAAGCCTCTTGTTCT0.452500.034700.577600.500001.000001.00000


Target Position: 1171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1171ACAAGAGAACAAGAAUAAA88.6855101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2311189ACAAGAGAACAAGAATAAATTTATTCTTGTTCTCTTGT0.625900.011500.706900.750001.000001.00000


Target Position: 127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
127CACAUGUGGAGGAGGAUGA82.1622222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
250145CACATGTGGAGGAGGATGATCATCCTCCTCCACATGTG0.140100.016900.569000.500001.000001.00000


Target Position: 802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
802UCCCUCUUCAACACUGCCA64.2509781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
259820TCCCTCTTCAACACTGCCATGGCAGTGTTGAAGAGGGA0.387700.362100.525900.500001.000001.00000


Target Position: 458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
458UAUUGUGUCAGGCCUGAAA80.8373266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
335476TATTGTGTCAGGCCTGAAATTTCAGGCCTGACACAATA0.019000.005500.543100.500001.000001.00000


Target Position: 70, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
70GACAGAGACGUGAAGCACU86.9466127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
29888GACAGAGACGTGAAGCACTAGTGCTTCACGTCTCTGTC0.068600.019000.612100.500000.983700.62500


Target Position: 497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
497GACUGGGGUGAAAGUGGAU83.6251190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
261515GACTGGGGTGAAAGTGGATATCCACTTTCACCCCAGTC0.173600.007500.637900.750001.000001.00000


Target Position: 293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
293AGCCCCCAAUGUCGUUGUC55.97441013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
248311AGCCCCCAATGTCGTTGTCGACAACGACATTGGGGGCT0.187700.079300.534500.500001.000001.00000


Target Position: 346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
346GACCAAUCACCAUGGACCU79.5517302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
331364GACCAATCACCATGGACCTAGGTCCATGGTGATTGGTC0.028400.013000.474100.500000.929300.75000


Target Position: 621, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
621CACAACAAGUCCUUCUUCA88.845498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
294639CACAACAAGTCCTTCTTCATGAAGAAGGACTTGTTGTG0.073300.014000.569000.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
619-641ACCACAACAAGTCCTTCTTCACCUGAAGAAGGACUUGUUGUGGUCACAACAAGUCCUUCUUCACCU19.119.322


Target Position: 64, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
64ACCCCGGACAGAGACGUGA66.1604698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
24082ACCCCGGACAGAGACGTGATCACGTCTCTGTCCGGGGT0.077100.030800.629300.500000.940200.62500


Target Position: 616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
616CGUACCACAACAAGUCCUU76.5563395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
329634CGTACCACAACAAGTCCTTAAGGACTTGTTGTGGTACG0.020600.011400.637901.000000.978300.87500


Target Position: 1019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1019UGGGCAAAUUAUCACUAAC69.8606580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2931037TGGGCAAATTATCACTAACGTTAGTGATAATTTGCCCA0.280200.026100.698300.500000.994600.87500


Target Position: 156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
156CUGGACAGCAAGCUCAAUU74.6558441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
322174CTGGACAGCAAGCTCAATTAATTGAGCTTGCTGTCCAG0.039200.002500.775900.750000.983700.62500


Target Position: 966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
966UCAUUUAAUAUUUCCCUGU65.1413742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
277984TCATTTAATATTTCCCTGTACAGGGAAATATTAAATGA0.613500.578200.517200.500001.000001.00000


Target Position: 1074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1074GCCUAGAUUCUUUUGUGGU76.3303401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3091092GCCTAGATTCTTTTGTGGTACCACAAAAGAATCTAGGC0.035400.004200.646600.750001.000001.00000


Target Position: 894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
894GCUUUCACCCAACCUGCUC60.9546897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
246912GCTTTCACCCAACCTGCTCGAGCAGGTTGGGTGAAAGC0.423400.013000.543100.750001.000001.00000


Target Position: 674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
674GUGGAACCUGUCGAUUAAG68.8306604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
330692GTGGAACCTGTCGATTAAGCTTAATCGACAGGTTCCAC0.066000.007400.655200.500000.972800.87500


Target Position: 8, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8ACUUCCUUCCUGUUCUAAC65.4636727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
24226ACTTCCTTCCTGTTCTAACGTTAGAACAGGAAGGAAGT0.325900.275500.560300.500001.000001.00000


Target Position: 792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792CACAGCUGGGUCCCUCUUC61.0296894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
347810CACAGCTGGGTCCCTCTTCGAAGAGGGACCCAGCTGTG0.754100.006400.620700.500000.994600.62500


Target Position: 131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
131UGUGGAGGAGGAUGAUGAU81.171253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
276149TGTGGAGGAGGATGATGATATCATCATCCTCCTCCACA0.273900.006400.525900.750001.000001.00000


Target Position: 981, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
981CUGUCUUACCCCUAUUCAA93.023845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
158999CTGTCTTACCCCTATTCAATTGAATAGGGGTAAGACAG0.256500.150100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
979-1001CCCTGTCTTACCCCTATTCAAGCUUGAAUAGGGGUAAGACAGGGCUGUCUUACCCCUAUUCAAGCU13.420.332


Target Position: 977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
977UUCCCUGUCUUACCCCUAU65.1929740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
255995TTCCCTGTCTTACCCCTATATAGGGGTAAGACAGGGAA0.308100.175700.629300.500001.000001.00000


Target Position: 1069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1069CUAAUGCCUAGAUUCUUUU77.3751366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3181087CTAATGCCTAGATTCTTTTAAAAGAATCTAGGCATTAG0.065700.003200.672400.750001.000001.00000


Target Position: 950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
950CCAUCUCAGUACACAAUCA98.01411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
187968CCATCTCAGTACACAATCATGATTGTGTACTGAGATGG0.763800.613400.620700.750001.000001.00000


Target Position: 76, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
76GACGUGAAGCACUGAAUAA98.73059

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_87619GACGTGAAGCACTGAATAA1/1/0/091.46ARHGDIBNM_001175.41NANANANA00ARHGDIB(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
15294GACGTGAAGCACTGAATAATTATTCAGTGCTTCACGTC0.169300.037800.784500.750000.983700.87500


Target Position: 498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
498ACUGGGGUGAAAGUGGAUA73.6852472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
247516ACTGGGGTGAAAGTGGATATATCCACTTTCACCCCAGT0.179600.009400.663800.750001.000001.00000


Target Position: 289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
289CGAAAGCCCCCAAUGUCGU69.3098596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
281307CGAAAGCCCCCAATGTCGTACGACATTGGGGGCTTTCG0.182400.056500.517200.750001.000001.00000


Target Position: 793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
793ACAGCUGGGUCCCUCUUCA80.584273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
322811ACAGCTGGGTCCCTCTTCATGAAGAGGGACCCAGCTGT0.809000.008300.482800.500001.000001.00000


Target Position: 447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
447GUGAACAGGGAUAUUGUGU72.2825514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
346465GTGAACAGGGATATTGTGTACACAATATCCCTGTTCAC0.146200.001100.586200.500001.000001.00000


Target Position: 218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
218GGACAAAGAUGAUGAGAGU92.235550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
261236GGACAAAGATGATGAGAGTACTCTCATCATCTTTGTCC0.066600.020000.663800.750001.000001.00000


Target Position: 504, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
504GUGAAAGUGGAUAAAGCAA89.229191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
139522GTGAAAGTGGATAAAGCAATTGCTTTATCCACTTTCAC0.373500.100700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
502-524GGGTGAAAGTGGATAAAGCAACAUUGCUUUAUCCACUUUCACCCGUGAAAGUGGAUAAAGCAACAU19.719.222


Target Position: 767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767CAGCACCCUGUCCCUCCUC58.6886962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
334785CAGCACCCTGTCCCTCCTCGAGGAGGGACAGGGTGCTG0.246000.007200.474100.500000.929300.62500


Target Position: 205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
205AGCUGCAGGAAAUGGACAA81.1168254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
252223AGCTGCAGGAAATGGACAATTGTCCATTTCCTGCAGCT0.084200.008800.706900.750001.000001.00000


Target Position: 922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
922CUCCAUCAGGGCCAGAUCU69.8145584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
348940CTCCATCAGGGCCAGATCTAGATCTGGCCCTGATGGAG0.069500.001000.586200.500000.929300.75000


Target Position: 1078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1078AGAUUCUUUUGUGGUUGUU71.2547543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3441096AGATTCTTTTGTGGTTGTTAACAACCACAAAAGAATCT0.016300.009400.577600.750001.000001.00000


Target Position: 413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
413AGGUUCUGAAUAUAGAGUC66.5363683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
296431AGGTTCTGAATATAGAGTCGACTCTATATTCAGAACCT0.075200.005200.525900.500001.000001.00000


Target Position: 612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
612GGCACGUACCACAACAAGU82.7286210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
294630GGCACGTACCACAACAAGTACTTGTTGTGGTACGTGCC0.044200.009800.793100.750000.972800.62500


Target Position: 139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
139AGGAUGAUGAUGAUGAGCU77.0123376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
324157AGGATGATGATGATGAGCTAGCTCATCATCATCATCCT0.024000.025000.491400.500001.000001.00000


Target Position: 363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
363CUUACUGGAGAUCUGGAAG68.6705610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
339381CTTACTGGAGATCTGGAAGCTTCCAGATCTCCAGTAAG0.062100.002900.500000.500001.000001.00000


Target Position: 1131, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1131CAGAGGGAGUUCUUCUUUU86.2302138

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6113119CAGAGGGAGTTCTTCTTTT1/1/0/093.71ARHGDIBNM_001175.41NANANANA00ARHGDIB(0.002)


Target Position: 98, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
98GAUCAGAAUGACUGAAAAA101.1093

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_99819GATCAGAATGACTGAAAAA1/1/0/091.46ARHGDIBNM_001175.41NANANA12:15103635..15103653(-)00ARHGDIB(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
96-118TAGATCAGAATGACTGAAAAAGCUUUUUCAGUCAUUCUGAUCUAGAUCAGAAUGACUGAAAAAGCU12.220.423


Target Position: 794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
794CAGCUGGGUCCCUCUUCAA89.7983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
212812CAGCTGGGTCCCTCTTCAATTGAAGAGGGACCCAGCTG0.807500.013000.637900.750001.000001.00000


Target Position: 459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
459AUUGUGUCAGGCCUGAAAU70.999549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
344477ATTGTGTCAGGCCTGAAATATTTCAGGCCTGACACAAT0.020000.006100.500000.500001.000001.00000


Target Position: 68, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
68CGGACAGAGACGUGAAGCA90.01678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
23786CGGACAGAGACGTGAAGCATGCTTCACGTCTCTGTCCG0.080300.033300.560300.750001.000001.00000


Target Position: 2, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2UCAUUGACUUCCUUCCUGU72.8506498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
27820TCATTGACTTCCTTCCTGTACAGGAAGGAAGTCAATGA0.419200.228300.517200.500001.000001.00000


Target Position: 134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
134GGAGGAGGAUGAUGAUGAU98.73678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
286152GGAGGAGGATGATGATGATATCATCATCATCCTCCTCC0.166100.005500.689701.000001.000001.00000


Target Position: 1021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1021GGCAAAUUAUCACUAACAG80.9708259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1621039GGCAAATTATCACTAACAGCTGTTAGTGATAATTTGCC0.161300.099900.715500.750000.994600.62500


Target Position: 200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
200GAAAGAGCUGCAGGAAAUG71.2836541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
310218GAAAGAGCTGCAGGAAATGCATTTCCTGCAGCTCTTTC0.039200.004000.517200.500001.000001.00000


Target Position: 287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
287UCCGAAAGCCCCCAAUGUC54.26411053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
237305TCCGAAAGCCCCCAATGTCGACATTGGGGGCTTTCGGA0.201200.049700.551700.500001.000001.00000


Target Position: 199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
199UGAAAGAGCUGCAGGAAAU79.5842298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
273217TGAAAGAGCTGCAGGAAATATTTCCTGCAGCTCTTTCA0.058700.013400.715500.750001.000001.00000


Target Position: 1110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1110GUCCCUAGUCACAUCCCCU79.7661291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3421128GTCCCTAGTCACATCCCCTAGGGGATGTGACTAGGGAC0.107600.059600.474100.500001.000001.00000


Target Position: 235, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
235GUCUAAUUAAGUACAAGAA93.642435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141253GTCTAATTAAGTACAAGAATTCTTGTACTTAATTAGAC0.429100.087400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
233-255GAGTCTAATTAAGTACAAGAAAAUUCUUGUACUUAAUUAGACUCGUCUAAUUAAGUACAAGAAAAU20.36.922


Target Position: 720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
720CCCCUUUCCCCACCCUUGC43.29971169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
240738CCCCTTTCCCCACCCTTGCGCAAGGGTGGGGAAAGGGG0.382200.069100.637900.500001.000001.00000


Target Position: 236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
236UCUAAUUAAGUACAAGAAA79.5719299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
152254TCTAATTAAGTACAAGAAATTTCTTGTACTTAATTAGA0.528500.183100.724100.750001.000001.00000


Target Position: 738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
738CCACCUGGAAGAAUUCUCU78.485331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
203756CCACCTGGAAGAATTCTCTAGAGAATTCTTCCAGGTGG0.512800.013600.620700.750001.000001.00000


Target Position: 220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
220ACAAAGAUGAUGAGAGUCU74.3763452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
329238ACAAAGATGATGAGAGTCTAGACTCTCATCATCTTTGT0.069000.022600.482800.500001.000001.00000


Target Position: 212, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
212GGAAAUGGACAAAGAUGAU90.060277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
147230GGAAATGGACAAAGATGATATCATCTTTGTCCATTTCC0.668900.029000.689701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
210-232CAGGAAATGGACAAAGATGATGAAUCAUCUUUGUCCAUUUCCUGGGAAAUGGACAAAGAUGAUGAU20.420.112


Target Position: 824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
824UUCCUUAUUGAUGCAUCUU61.8366862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
284842TTCCTTATTGATGCATCTTAAGATGCATCAATAAGGAA0.107900.061100.534500.500001.000001.00000


Target Position: 869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
869CCUAGAACAAGAGGCUUAA86.1089143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
279887CCTAGAACAAGAGGCTTAATTAAGCCTCTTGTTCTAGG0.056100.017500.810301.000000.994600.62500


Target Position: 361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
361ACCUUACUGGAGAUCUGGA80.0988283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
343379ACCTTACTGGAGATCTGGATCCAGATCTCCAGTAAGGT0.017200.001300.482800.500001.000001.00000


Target Position: 140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
140GGAUGAUGAUGAUGAGCUG89.429788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
345158GGATGATGATGATGAGCTGCAGCTCATCATCATCATCC0.015700.016100.586200.750001.000001.00000


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779CCUCCUCCCUGUCCACAGC59.3609943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
314797CCTCCTCCCTGTCCACAGCGCTGTGGACAGGGAGGAGG0.099500.043100.491400.500000.940200.62500


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773CCUGUCCCUCCUCCCUGUC53.84221063

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
269791CCTGTCCCTCCTCCCTGTCGACAGGGAGGAGGGACAGG0.150000.020000.525900.750001.000001.00000


Target Position: 734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
734CUUGCCACCUGGAAGAAUU76.8383385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
322752CTTGCCACCTGGAAGAATTAATTCTTCCAGGTGGCAAG0.025100.008700.629300.750000.951100.62500


Target Position: 936, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
936GAUCUUCCACGUCUCCAUC73.2948486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
301954GATCTTCCACGTCTCCATCGATGGAGACGTGGAAGATC0.665600.501300.500000.500000.978300.62500


Target Position: 1027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1027UUAUCACUAACAGGUCUUU66.7626675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3361045TTATCACTAACAGGTCTTTAAAGACCTGTTAGTGATAA0.073700.067700.534500.500001.000001.00000


Target Position: 490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
490CCUACAGGACUGGGGUGAA84.0053184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
328508CCTACAGGACTGGGGTGAATTCACCCCAGTCCTGTAGG0.060500.002100.672401.000001.000001.00000


Target Position: 726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
726UCCCCACCCUUGCCACCUG51.63181100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
308744TCCCCACCCTTGCCACCTGCAGGTGGCAAGGGTGGGGA0.040600.033600.586200.500001.000001.00000


Target Position: 233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
233GAGUCUAAUUAAGUACAAG85.8545150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
216251GAGTCTAATTAAGTACAAGCTTGTACTTAATTAGACTC0.428500.044700.672400.500001.000001.00000


Target Position: 818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
818CCACAUUUCCUUAUUGAUG71.952520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
171836CCACATTTCCTTATTGATGCATCAATAAGGAAATGTGG0.152400.057400.689700.750001.000001.00000


Target Position: 496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
496GGACUGGGGUGAAAGUGGA87.4657118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
303514GGACTGGGGTGAAAGTGGATCCACTTTCACCCCAGTCC0.172000.006200.500000.750001.000001.00000


Target Position: 673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
673AGUGGAACCUGUCGAUUAA93.205242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
128691AGTGGAACCTGTCGATTAATTAATCGACAGGTTCCACT0.266600.035800.672400.750000.972800.75000


Target Position: 845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
845CCCACCCUGUCACUCAACG58.6025965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
298863CCCACCCTGTCACTCAACGCGTTGAGTGACAGGGTGGG0.041900.020200.715500.500000.994600.62500


Target Position: 429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
429GUCAAAAUUCACUUCAAAG77.5486361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
343447GTCAAAATTCACTTCAAAGCTTTGAAGTGAATTTTGAC0.016500.004500.681000.500001.000001.00000


Target Position: 1052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1052GGUUCCAGUAGUUCAUUCU83.4313195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1961070GGTTCCAGTAGTTCATTCTAGAATGAACTACTGGAACC0.118100.040900.629300.750001.000001.00000


Target Position: 371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
371AGAUCUGGAAGCCCUCAAA87.2486124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313389AGATCTGGAAGCCCTCAAATTTGAGGGCTTCCAGATCT0.103600.003600.724100.750000.962001.00000


Target Position: 617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
617GUACCACAACAAGUCCUUC71.2821542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
337635GTACCACAACAAGTCCTTCGAAGGACTTGTTGTGGTAC0.018900.011100.508600.500000.978300.75000


Target Position: 855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
855CACUCAACGUGGUCCCUAG82.1252225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
345873CACTCAACGTGGTCCCTAGCTAGGGACCACGTTGAGTG0.050000.004300.620700.500000.934800.62500


Target Position: 158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
158GGACAGCAAGCUCAAUUAU88.256105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
258176GGACAGCAAGCTCAATTATATAATTGAGCTTGCTGTCC0.070400.007800.827601.000001.000001.00000


Target Position: 511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
511UGGAUAAAGCAACAUUUAU78.191343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
285529TGGATAAAGCAACATTTATATAAATGTTGCTTTATCCA0.051500.012600.801700.750001.000001.00000


Target Position: 648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
648GACAAGCAAGACCACCUCA88.764899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
316666GACAAGCAAGACCACCTCATGAGGTGGTCTTGCTTGTC0.047600.028400.594800.500000.956500.62500


Target Position: 713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
713GCAUCCACCCCUUUCCCCA77.5656359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
289731GCATCCACCCCTTTCCCCATGGGGAAAGGGGTGGATGC0.261100.115800.508600.750001.000001.00000


Target Position: 817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
817GCCACAUUUCCUUAUUGAU85.3813154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
153835GCCACATTTCCTTATTGATATCAATAAGGAAATGTGGC0.168900.080700.819001.000001.000001.00000


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049UCAGGUUCCAGUAGUUCAU71.3078539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2271067TCAGGTTCCAGTAGTTCATATGAACTACTGGAACCTGA0.161000.018600.569000.750001.000001.00000


Target Position: 3, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3CAUUGACUUCCUUCCUGUU86.7086130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
28621CATTGACTTCCTTCCTGTTAACAGGAAGGAAGTCAATG0.385300.195200.508600.750001.000001.00000


Target Position: 1046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1046GACUCAGGUUCCAGUAGUU93.001546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2921064GACTCAGGTTCCAGTAGTTAACTACTGGAACCTGAGTC0.063400.005100.672400.750000.983700.62500


Target Position: 84, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
84GCACUGAAUAAAUAGAUCA93.547136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
268102GCACTGAATAAATAGATCATGATCTATTTATTCAGTGC0.061900.011700.629300.750001.000001.00000


Target Position: 223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
223AAGAUGAUGAGAGUCUAAU77.7601356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
282241AAGATGATGAGAGTCTAATATTAGACTCTCATCATCTT0.090600.028500.629300.500001.000001.00000


Target Position: 66, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
66CCCGGACAGAGACGUGAAG64.5049767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
22484CCCGGACAGAGACGTGAAGCTTCACGTCTCTGTCCGGG0.094000.029900.853400.750001.000001.00000


Target Position: 941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
941UCCACGUCUCCAUCUCAGU64.6804756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
346959TCCACGTCTCCATCTCAGTACTGAGATGGAGACGTGGA0.682900.501200.663800.500000.978300.87500


Target Position: 373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
373AUCUGGAAGCCCUCAAAAA82.6778211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
301391ATCTGGAAGCCCTCAAAAATTTTTGAGGGCTTCCAGAT0.279100.004600.681000.500000.962001.00000


Target Position: 83, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
83AGCACUGAAUAAAUAGAUC73.6836473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
333101AGCACTGAATAAATAGATCGATCTATTTATTCAGTGCT0.074600.015600.672400.500001.000001.00000


Target Position: 508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
508AAGUGGAUAAAGCAACAUU81.4652246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
348526AAGTGGATAAAGCAACATTAATGTTGCTTTATCCACTT0.097300.021800.629300.500001.000001.00000


Target Position: 124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
124AGCCACAUGUGGAGGAGGA76.4276400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
326142AGCCACATGTGGAGGAGGATCCTCCTCCACATGTGGCT0.127300.005200.482800.500000.978300.75000


Target Position: 1054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1054UUCCAGUAGUUCAUUCUAA82.6245212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1771072TTCCAGTAGTTCATTCTAATTAGAATGAACTACTGGAA0.181000.045800.637900.500001.000001.00000


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050CAGGUUCCAGUAGUUCAUU77.2567370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1751068CAGGTTCCAGTAGTTCATTAATGAACTACTGGAACCTG0.160700.019900.775900.750001.000001.00000


Target Position: 826, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
826CCUUAUUGAUGCAUCUUUU88.2162106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
108844CCTTATTGATGCATCTTTTAAAAGATGCATCAATAAGG0.264900.068100.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
824-846TTCCTTATTGATGCATCTTTTCCAAAAGAUGCAUCAAUAAGGAACCUUAUUGAUGCAUCUUUUCCU12.03.533


Target Position: 1174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1174AGAGAACAAGAAUAAAACA91.104663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2701192AGAGAACAAGAATAAAACATGTTTTATTCTTGTTCTCT0.473000.019300.517200.500001.000001.00000


Target Position: 946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
946GUCUCCAUCUCAGUACACA87.5068116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
203964GTCTCCATCTCAGTACACATGTGTACTGAGATGGAGAC0.685900.501200.612100.500001.000001.00000


Target Position: 59, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
59GAGGCACCCCGGACAGAGA85.4499153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
27577GAGGCACCCCGGACAGAGATCTCTGTCCGGGGTGCCTC0.870600.006500.586200.500000.929300.75000


Target Position: 1067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1067UUCUAAUGCCUAGAUUCUU67.3994658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3151085TTCTAATGCCTAGATTCTTAAGAATCTAGGCATTAGAA0.057000.003500.534500.500000.951100.62500


Target Position: 930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
930GGGCCAGAUCUUCCACGUC71.4709533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
104948GGGCCAGATCTTCCACGTCGACGTGGAAGATCTGGCCC0.632200.050700.672400.750001.000001.00000


Target Position: 510, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
510GUGGAUAAAGCAACAUUUA89.759984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
271528GTGGATAAAGCAACATTTATAAATGTTGCTTTATCCAC0.059900.012300.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
508-530AAGTGGATAAAGCAACATTTATGUAAAUGUUGCUUUAUCCACUUGUGGAUAAAGCAACAUUUAUGU5.321.222


Target Position: 132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
132GUGGAGGAGGAUGAUGAUG65.3763734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
279150GTGGAGGAGGATGATGATGCATCATCATCCTCCTCCAC0.253100.006200.637900.500001.000001.00000


Target Position: 958, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958GUACACAAUCAUUUAAUAU89.165793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
163976GTACACAATCATTTAATATATATTAAATGATTGTGTAC0.895400.717100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
956-978CAGTACACAATCATTTAATATTTAUAUUAAAUGAUUGUGUACUGGUACACAAUCAUUUAAUAUUUU-7.520.432


Target Position: 980, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
980CCUGUCUUACCCCUAUUCA81.349247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181998CCTGTCTTACCCCTATTCATGAATAGGGGTAAGACAGG0.260900.149100.620700.750001.000001.00000


Target Position: 811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
811AACACUGCCACAUUUCCUU71.636526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
341829AACACTGCCACATTTCCTTAAGGAAATGTGGCAGTGTT0.210800.145100.508600.500001.000001.00000


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675UGGAACCUGUCGAUUAAGA74.953433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
303693TGGAACCTGTCGATTAAGATCTTAATCGACAGGTTCCA0.093200.007500.620700.500000.972800.87500


Target Position: 232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
232AGAGUCUAAUUAAGUACAA89.859382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
215250AGAGTCTAATTAAGTACAATTGTACTTAATTAGACTCT0.444800.041500.577600.750001.000001.00000


Target Position: 1048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048CUCAGGUUCCAGUAGUUCA87.4017120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2541066CTCAGGTTCCAGTAGTTCATGAACTACTGGAACCTGAG0.090100.009500.586200.500001.000001.00000


Target Position: 821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
821CAUUUCCUUAUUGAUGCAU72.3219512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
311839CATTTCCTTATTGATGCATATGCATCAATAAGGAAATG0.097900.059000.500000.750001.000001.00000


Target Position: 69, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
69GGACAGAGACGUGAAGCAC77.5012362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
26487GGACAGAGACGTGAAGCACGTGCTTCACGTCTCTGTCC0.064700.017500.577600.750000.967400.62500


Target Position: 414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
414GGUUCUGAAUAUAGAGUCA99.60875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
245432GGTTCTGAATATAGAGTCATGACTCTATATTCAGAACC0.075900.009600.629300.750001.000001.00000


Target Position: 72, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
72CAGAGACGUGAAGCACUGA87.8959109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
23390CAGAGACGTGAAGCACTGATCAGTGCTTCACGTCTCTG0.108200.024500.560300.500000.983700.87500


Target Position: 420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420GAAUAUAGAGUCAAAAUUC84.6708171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
298438GAATATAGAGTCAAAATTCGAATTTTGACTCTATATTC0.048600.007500.500000.500001.000001.00000


Target Position: 719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719ACCCCUUUCCCCACCCUUG52.95461074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
264737ACCCCTTTCCCCACCCTTGCAAGGGTGGGGAAAGGGGT0.425800.074400.706900.500001.000001.00000


Target Position: 230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
230UGAGAGUCUAAUUAAGUAC69.1285599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
244248TGAGAGTCTAATTAAGTACGTACTTAATTAGACTCTCA0.382900.034600.543100.500001.000001.00000


Target Position: 383, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
383CCUCAAAAAGGAAACCAUU81.0557255

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
381-403GCCCTCAAAAAGGAAACCATTGTAAUGGUUUCCUUUUUGAGGGCCCUCAAAAAGGAAACCAUUGUU18.812.222


Target Position: 798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
798UGGGUCCCUCUUCAACACU61.7366867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
236816TGGGTCCCTCTTCAACACTAGTGTTGAAGAGGGACCCA0.517600.072400.637900.500001.000001.00000


Target Position: 982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
982UGUCUUACCCCUAUUCAAG67.5339655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3071000TGTCTTACCCCTATTCAAGCTTGAATAGGGGTAAGACA0.238600.147100.569000.500001.000001.00000


Target Position: 1014, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1014GAAAAUGGGCAAAUUAUCA90.425674

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1012-1034CAGAAAATGGGCAAATTATCACTUGAUAAUUUGCCCAUUUUCUGGAAAAUGGGCAAAUUAUCACUU1.811.323


Target Position: 816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
816UGCCACAUUUCCUUAUUGA77.5487360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
223834TGCCACATTTCCTTATTGATCAATAAGGAAATGTGGCA0.163900.084800.629300.500001.000001.00000


Target Position: 813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
813CACUGCCACAUUUCCUUAU78.0838345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
59831CACTGCCACATTTCCTTATATAAGGAAATGTGGCAGTG0.517900.108200.750000.750001.000001.00000


Target Position: 28, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
28GCCAGUACUCAGAAGUCAG79.8487289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
22146GCCAGTACTCAGAAGTCAGCTGACTTCTGAGTACTGGC0.132900.012300.715500.750001.000001.00000


Target Position: 1022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1022GCAAAUUAUCACUAACAGG74.4951447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2831040GCAAATTATCACTAACAGGCCTGTTAGTGATAATTTGC0.121900.078700.508600.500001.000001.00000


Target Position: 125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
125GCCACAUGUGGAGGAGGAU76.8964381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
251143GCCACATGTGGAGGAGGATATCCTCCTCCACATGTGGC0.185700.008800.819001.000000.978300.62500


Target Position: 509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
509AGUGGAUAAAGCAACAUUU83.3169198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
265527AGTGGATAAAGCAACATTTAAATGTTGCTTTATCCACT0.063600.013800.706900.750001.000001.00000


Target Position: 1076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1076CUAGAUUCUUUUGUGGUUG64.723754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3281094CTAGATTCTTTTGTGGTTGCAACCACAAAAGAATCTAG0.020800.009400.525900.500001.000001.00000


Target Position: 1170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1170CACAAGAGAACAAGAAUAA93.140844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3331188CACAAGAGAACAAGAATAATTATTCTTGTTCTCTTGTG0.608200.001800.758600.750001.000001.00000


Target Position: 133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
133UGGAGGAGGAUGAUGAUGA79.4102308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
325151TGGAGGAGGATGATGATGATCATCATCATCCTCCTCCA0.244600.013600.620700.500001.000001.00000


Target Position: 676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676GGAACCUGUCGAUUAAGAA96.643718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
316694GGAACCTGTCGATTAAGAATTCTTAATCGACAGGTTCC0.084000.003400.698301.000000.972800.75000


Target Position: 506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
506GAAAGUGGAUAAAGCAACA94.669329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
346524GAAAGTGGATAAAGCAACATGTTGCTTTATCCACTTTC0.335800.105600.465500.500001.000001.00000


Target Position: 347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
347ACCAAUCACCAUGGACCUU65.3699735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
238365ACCAATCACCATGGACCTTAAGGTCCATGGTGATTGGT0.111000.010500.715500.750000.929300.62500


Target Position: 844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844UCCCACCCUGUCACUCAAC52.15821090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
328862TCCCACCCTGTCACTCAACGTTGAGTGACAGGGTGGGA0.092000.030400.724100.500001.000001.00000


Target Position: 861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
861ACGUGGUCCCUAGAACAAG64.2752779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
339879ACGTGGTCCCTAGAACAAGCTTGTTCTAGGGACCACGT0.159300.001600.637900.500000.978300.87500


Target Position: 952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
952AUCUCAGUACACAAUCAUU84.3968177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
299970ATCTCAGTACACAATCATTAATGATTGTGTACTGAGAT0.834900.618700.672400.500001.000001.00000


Target Position: 1175, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1175GAGAACAAGAAUAAAACAA90.86469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1271193GAGAACAAGAATAAAACAATTGTTTTATTCTTGTTCTC0.447300.042800.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1173-1195AAGAGAACAAGAATAAAACAATAUUGUUUUAUUCUUGUUCUCUUGAGAACAAGAAUAAAACAAUAU7.219.222


Target Position: 856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
856ACUCAACGUGGUCCCUAGA76.2474403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327874ACTCAACGTGGTCCCTAGATCTAGGGACCACGTTGAGT0.258000.005000.482800.500001.000001.00000


Target Position: 931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
931GGCCAGAUCUUCCACGUCU82.1837221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
100949GGCCAGATCTTCCACGTCTAGACGTGGAAGATCTGGCC0.630100.054700.775900.750001.000001.00000


Target Position: 129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
129CAUGUGGAGGAGGAUGAUG69.642588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
317147CATGTGGAGGAGGATGATGCATCATCCTCCTCCACATG0.506300.057900.500000.500001.000001.00000


Target Position: 1020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1020GGGCAAAUUAUCACUAACA93.528737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1011038GGGCAAATTATCACTAACATGTTAGTGATAATTTGCCC0.281600.142800.784500.750000.994600.75000


Target Position: 372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
372GAUCUGGAAGCCCUCAAAA90.511872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
306390GATCTGGAAGCCCTCAAAATTTTGAGGGCTTCCAGATC0.094300.004400.681000.750000.962001.00000


Target Position: 860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
860AACGUGGUCCCUAGAACAA81.296251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
296878AACGTGGTCCCTAGAACAATTGTTCTAGGGACCACGTT0.166100.006400.500000.500000.978300.75000


Target Position: 406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
406UAAAGGAAGGUUCUGAAUA80.2278279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
318424TAAAGGAAGGTTCTGAATATATTCAGAACCTTCCTTTA0.039700.004900.491400.500001.000001.00000


Target Position: 408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
408AAGGAAGGUUCUGAAUAUA88.881997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
264426AAGGAAGGTTCTGAATATATATATTCAGAACCTTCCTT0.124900.007400.594800.500001.000001.00000


Target Position: 815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
815CUGCCACAUUUCCUUAUUG72.8004500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
183833CTGCCACATTTCCTTATTGCAATAAGGAAATGTGGCAG0.165700.076200.637900.500001.000001.00000


Target Position: 137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
137GGAGGAUGAUGAUGAUGAG90.875768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
286155GGAGGATGATGATGATGAGCTCATCATCATCATCCTCC0.050400.048000.560300.750001.000001.00000


Target Position: 638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
638CACCGACGAUGACAAGCAA96.467120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
136656CACCGACGATGACAAGCAATTGCTTGTCATCGTCGGTG0.248500.153200.646600.750001.000001.00000


Target Position: 1116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1116AGUCACAUCCCCUGCCAGA77.8607350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3251134AGTCACATCCCCTGCCAGATCTGGCAGGGGATGTGACT0.091000.003800.482800.500000.945700.75000


Target Position: 812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
812ACACUGCCACAUUUCCUUA85.2527159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
108830ACACTGCCACATTTCCTTATAAGGAAATGTGGCAGTGT0.529500.132800.672400.750001.000001.00000


Target Position: 1001, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1001CAACUAGAGGCCAGAAAAU86.1983140

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3100119CAACTAGAGGCCAGAAAAT1/1/0/094.96ARHGDIBNM_001175.41NANANA11:47129726..47129744(+)00ARHGDIB(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
999-1021AGCAACTAGAGGCCAGAAAATGGAUUUUCUGGCCUCUAGUUGCUCAACUAGAGGCCAGAAAAUGGU12.218.922


Target Position: 159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
159GACAGCAAGCUCAAUUAUA94.627930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
241177GACAGCAAGCTCAATTATATATAATTGAGCTTGCTGTC0.205000.010200.775900.750001.000001.00000


Target Position: 37, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
37CAGAAGUCAGAGUUGAGAG79.6089297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
34155CAGAAGTCAGAGTTGAGAGCTCTCAACTCTGACTTCTG0.169800.038600.474100.500001.000001.00000


Target Position: 384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
384CUCAAAAAGGAAACCAUUG65.4879726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
296402CTCAAAAAGGAAACCATTGCAATGGTTTCCTTTTTGAG0.043900.019900.663800.500001.000001.00000


Target Position: 126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
126CCACAUGUGGAGGAGGAUG65.8892708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
230144CCACATGTGGAGGAGGATGCATCCTCCTCCACATGTGG0.186100.011600.689700.750001.000001.00000


Target Position: 871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
871UAGAACAAGAGGCUUAAAA76.8427383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
246889TAGAACAAGAGGCTTAAAATTTTAAGCCTCTTGTTCTA0.074300.019200.672400.500001.000001.00000


Target Position: 1055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055UCCAGUAGUUCAUUCUAAU80.6929271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1391073TCCAGTAGTTCATTCTAATATTAGAATGAACTACTGGA0.182400.050200.862100.750001.000001.00000