Input target sequence

Length: 3366
GCATGCGTAGGCGCGCGGCCGCGGCGGCGGCTGGGGAGGGTTCTTCCGGAAGGTTCGGGAGGCTTCTGGAAAAAGCGCCGCGCGCTGGGCGGGCCCGTCGCTATATAAGGCAGGCGCGGGGGTGGCGCGTCAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAGATGCCTGAGGAAACCCAGACCCAAGACCAACCGATGGAGGAGGAGGAGGTTGAGACGTTCGCCTTTCAGGCAGAAATTGCCCAGTTGATGTCATTGATCATCAATACTTTCTACTCGAACAAAGAGATCTTTCTGAGAGAGCTCATTTCAAATTCATCAGATGCATTGGACAAAATCCGGTATGAAAGCTTGACAGATCCCAGTAAATTAGACTCTGGGAAAGAGCTGCATATTAACCTTATACCGAACAAACAAGATCGAACTCTCACTATTGTGGATACTGGAATTGGAATGACCAAGGCTGACTTGATCAATAACCTTGGTACTATCGCCAAGTCTGGGACCAAAGCGTTCATGGAAGCTTTGCAGGCTGGTGCAGATATCTCTATGATTGGCCAGTTCGGTGTTGGTTTTTATTCTGCTTATTTGGTTGCTGAGAAAGTAACTGTGATCACCAAACATAACGATGATGAGCAGTACGCTTGGGAGTCCTCAGCAGGGGGATCATTCACAGTGAGGACAGACACAGGTGAACCTATGGGTCGTGGAACAAAAGTTATCCTACACCTGAAAGAAGACCAAACTGAGTACTTGGAGGAACGAAGAATAAAGGAGATTGTGAAGAAACATTCTCAGTTTATTGGATATCCCATTACTCTTTTTGTGGAGAAGGAACGTGATAAAGAAGTAAGCGATGATGAGGCTGAAGAAAAGGAAGACAAAGAAGAAGAAAAAGAAAAAGAAGAGAAAGAGTCGGAAGACAAACCTGAAATTGAAGATGTTGGTTCTGATGAGGAAGAAGAAAAGAAGGATGGTGACAAGAAGAAGAAGAAGAAGATTAAGGAAAAGTACATCGATCAAGAAGAGCTCAACAAAACAAAGCCCATCTGGACCAGAAATCCCGACGATATTACTAATGAGGAGTACGGAGAATTCTATAAGAGCTTGACCAATGACTGGGAAGATCACTTGGCAGTGAAGCATTTTTCAGTTGAAGGACAGTTGGAATTCAGAGCCCTTCTATTTGTCCCACGACGTGCTCCTTTTGATCTGTTTGAAAACAGAAAGAAAAAGAACAACATCAAATTGTATGTACGCAGAGTTTTCATCATGGATAACTGTGAGGAGCTAATCCCTGAATATCTGAACTTCATTAGAGGGGTGGTAGACTCGGAGGATCTCCCTCTAAACATATCCCGTGAGATGTTGCAACAAAGCAAAATTTTGAAAGTTATCAGGAAGAATTTGGTCAAAAAATGCTTAGAACTCTTTACTGAACTGGCGGAAGATAAAGAGAACTACAAGAAATTCTATGAGCAGTTCTCTAAAAACATAAAGCTTGGAATACACGAAGACTCTCAAAATCGGAAGAAGCTTTCAGAGCTGTTAAGGTACTACACATCTGCCTCTGGTGATGAGATGGTTTCTCTCAAGGACTACTGCACCAGAATGAAGGAGAACCAGAAACATATCTATTATATCACAGGTGAGACCAAGGACCAGGTAGCTAACTCAGCCTTTGTGGAACGTCTTCGGAAACATGGCTTAGAAGTGATCTATATGATTGAGCCCATTGATGAGTACTGTGTCCAACAGCTGAAGGAATTTGAGGGGAAGACTTTAGTGTCAGTCACCAAAGAAGGCCTGGAACTTCCAGAGGATGAAGAAGAGAAAAAGAAGCAGGAAGAGAAAAAAACAAAGTTTGAGAACCTCTGCAAAATCATGAAAGACATATTGGAGAAAAAAGTTGAAAAGGTGGTTGTGTCAAACCGATTGGTGACATCTCCATGCTGTATTGTCACAAGCACATATGGCTGGACAGCAAACATGGAGAGAATCATGAAAGCTCAAGCCCTAAGAGACAACTCAACAATGGGTTACATGGCAGCAAAGAAACACCTGGAGATAAACCCTGACCATTCCATTATTGAGACCTTAAGGCAAAAGGCAGAGGCTGATAAGAACGACAAGTCTGTGAAGGATCTGGTCATCTTGCTTTATGAAACTGCGCTCCTGTCTTCTGGCTTCAGTCTGGAAGATCCCCAGACACATGCTAACAGGATCTACAGGATGATCAAACTTGGTCTGGGTATTGATGAAGATGACCCTACTGCTGATGATACCAGTGCTGCTGTAACTGAAGAAATGCCACCCCTTGAAGGAGATGACGACACATCACGCATGGAAGAAGTAGACTAATCTCTGGCTGAGGGATGACTTACCTGTTCAGTACTCTACAATTCCTCTGATAATATATTTTCAAGGATGTTTTTCTTTATTTTTGTTAATATTAAAAAGTCTGTATGGCATGACAACTACTTTAAGGGGAAGATAAGATTTCTGTCTACTAAGTGATGCTGTGATACCTTAGGCACTAAAGCAGAGCTAGTAATGCTTTTTGAGTTTCATGTTGGTTTATTTTCACAGATTGGGGTAACGTGCACTGTAAGACGTATGTAACATGATGTTAACTTTGTGGTCTAAAGTGTTTAGCTGTCAAGCCGGATGCCTAAGTAGACCAAATCTTGTTATTGAAGTGTTCTGAGCTGTATCTTGATGTTTAGAAAAGTATTCGTTACATCTTGTAGGATCTACTTTTTGAACTTTTCATTCCCTGTAGTTGACAATTCTGCATGTACTAGTCCTCTAGAAATAGGTTAAACTGAAGCAACTTGATGGAAGGATCTCTCCACAGGGCTTGTTTTCCAAAGAAAAGTATTGTTTGGAGGAGCAAAGTTAAAAGCCTACCTAAGCATATCGTAAAGCTGTTCAAAAATAACTCAGACCCAGTCTTGTGGATGGAAATGTAGTGCTCGAGTCACATTCTGCTTAAAGTTGTAACAAATACAGATGAGTTAAAAGATATTGTGTGACAGTGTCTTATTTAGGGGGAAAGGGGAGTATCTGGATGACAGTTAGTGCCAAAATGTAAAACATGAGGCGCTAGCAGGAGATGGTTAAACACTAGCTGCTCCAAGGGTTGACATGGTCTTCCCAGCATGTACTCAGCAGGTGTGGGGTGGAGCACACGTAGGCACAGAAAACAGGAATGCAGACAACATGCATCCCCTGCGTCCATGAGTTACATGTGTTCTCTTAGTGTCCACGTTGTTTTGATGTTATTCATGGAATACCTTCTGTGTTAAATACAGTCACTTAATTCCTTGGCCTTAAAA