siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs, Sidirect 1284   1518   1520   1523   1685   1687   1689  
Biltr, Ernai, Rnaxs, Sidirect 262   293  
Biltr, Sidirect 266  
Biltr, Rnaxs 116   117   119   120   121   122   252   253   254   255   256   258   259   260   261   265   270   271   272   274  
280   281   283   284   285   286   289   290   291   292   294   295   296   342   343   354   355   362   364   369  
370   376   378   387   388   435   436   437   503   504   505   506   514   515   516   520   521   522   555   556  
557   558   559   560   565   566   589   598   617   618   644   712   713   725   726   727   728   736   745   746  
747   755   756   760   761   765   766   773   774   775   776   780   781   782   784   785   786   787   788   886  
987   988   989   1000   1001   1002   1003   1009   1015   1016   1021   1022   1026   1030   1031   1032   1033   1053   1054   1055  
1059   1060   1120   1123   1124   1125   1126   1127   1128   1129   1130   1131   1144   1145   1154   1155   1156   1157   1158   1159  
1160   1161   1162   1194   1195   1196   1202   1203   1215   1216   1217   1242   1243   1244   1248   1256   1257   1258   1283   1285  
1286   1287   1351   1352   1353   1354   1355   1356   1357   1358   1370   1373   1374   1376   1378   1492   1493   1494   1509   1510  
1511   1512   1513   1514   1515   1516   1517   1519   1521   1522   1524   1525   1526   1583   1584   1585   1586   1587   1588   1589  
1590   1591   1592   1593   1594   1595   1658   1659   1660   1661   1662   1663   1664   1682   1683   1684   1686   1688   1690   1691  
1692   1693   1694   1695   1696   1697  
Biltr, Ernai 251   724   1268   1269   1282   1350  
Biltr, Ernai, Rnaxs 1375   1377  


Target Position: 117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
117GCAGCGCGGAGCAGAAAGC59.24821061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
206135GCAGCGCGGAGCAGAAAGCGCTTTCTGCTCCGCGCTGC0.140600.002000.500000.500000.945700.75000


Target Position: 1060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1060GCUAUCCCCAUCUCCCUGC52.20911367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2101078GCTATCCCCATCTCCCTGCGCAGGGAGATGGGGATAGC0.028000.023200.500000.500001.000001.00000


Target Position: 1194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1194GGGGCCUAGCGAUCUCUCC61.8054954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2291212GGGGCCTAGCGATCTCTCCGGAGAGATCGCTAGGCCCC0.085600.019600.620700.500001.000001.00000


Target Position: 1157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1157CCUCUUGCCCAUCCUGACU69.7969567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1321175CCTCTTGCCCATCCTGACTAGTCAGGATGGGCAAGAGG0.130600.015900.637900.750000.918500.62500


Target Position: 1126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1126CCAGGCCUGCCUCCCACUU64.1932827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1641144CCAGGCCTGCCTCCCACTTAAGTGGGAGGCAGGCCTGG0.207300.005800.706901.000000.913000.75000


Target Position: 745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
745AUCGCCCUGAGGUCACCUA71.2453501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188763ATCGCCCTGAGGTCACCTATAGGTGACCTCAGGGCGAT0.060200.006700.508600.500000.951100.75000


Target Position: 1694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1694AAAAAAAAAAAAAAAAAAA83.5835122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2021712AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT1.000000.999800.500000.500001.000001.00000


Target Position: 274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
274CCAAAUACUUUCUCUUCCU80.9496189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
200292CCAAATACTTTCTCTTCCTAGGAAGAGAAAGTATTTGG0.804400.467600.500000.750001.000001.00000


Target Position: 1689, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1689CAAAAAAAAAAAAAAAAAA86.775964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1041707CAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTG0.999900.983900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1687-1709CTCAAAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUUUGAGCAAAAAAAAAAAAAAAAAAAAU-11.3-11.300


Target Position: 1015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1015UCCAUUCCGAAGACUACAG56.5531191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2021033TCCATTCCGAAGACTACAGCTGTAGTCTTCGGAATGGA0.034400.019200.586200.500000.989100.62500


Target Position: 1376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1376GGGCAACUGUAUGAAAAAU87.397751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1171394GGGCAACTGTATGAAAAATATTTTTCATACAGTTGCCC0.248700.013700.982801.000001.000001.00000


Target Position: 521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
521CCUGCUCCUGAUCCUCAUU76.735313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
59539CCTGCTCCTGATCCTCATTAATGAGGATCAGGAGCAGG0.454600.055100.836201.000001.000001.00000


Target Position: 1686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1686UCUCAAAAAAAAAAAAAAA77.1807301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1121704TCTCAAAAAAAAAAAAAAATTTTTTTTTTTTTTTGAGA0.999900.015800.724100.750001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781UCAAGGGGGAAGAGGACAA73.1591420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
186799TCAAGGGGGAAGAGGACAATTGTCCTCTTCCCCCTTGA0.053300.003700.577600.750001.000001.00000


Target Position: 1156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1156CCCUCUUGCCCAUCCUGAC66.2877715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1211174CCCTCTTGCCCATCCTGACGTCAGGATGGGCAAGAGGG0.148000.017500.672400.750000.907600.62500


Target Position: 618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
618CUCAUUCGAGACUACAACA87.524946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
184636CTCATTCGAGACTACAACATGTTGTAGTCTCGAATGAG0.196000.007100.603400.500000.972800.62500


Target Position: 1493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1493CCUGGCUAACAUGGUGAAA79.3368231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1821511CCTGGCTAACATGGTGAAATTTCACCATGTTAGCCAGG0.055200.004200.844801.000001.000001.00000


Target Position: 987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
987GUCCUGUCCAUCUGCUUGU70.3024545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2301005GTCCTGTCCATCTGCTTGTACAAGCAGATGGACAGGAC0.014400.001300.612100.500001.000001.00000


Target Position: 1003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1003UGUGCCGGCACGUCCAUUC53.96591288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2281021TGTGCCGGCACGTCCATTCGAATGGACGTGCCGGCACA0.234200.003700.534500.500000.929300.62500


Target Position: 1032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1032AGCAAGGUCCCCAAGUACU71.2357502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1301050AGCAAGGTCCCCAAGTACTAGTACTTGGGGACCTTGCT0.316600.012500.646600.500001.000001.00000


Target Position: 1203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1203CGAUCUCUCCUGGCCUAUC70.6023522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2251221CGATCTCTCCTGGCCTATCGATAGGCCAGGAGAGATCG0.018000.017800.612100.750001.000001.00000


Target Position: 785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
785GGGGGAAGAGGACAACAGC68.7903605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
200803GGGGGAAGAGGACAACAGCGCTGTTGTCCTCTTCCCCC0.134800.002200.637900.500001.000001.00000


Target Position: 1125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1125UCCAGGCCUGCCUCCCACU56.3811200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1931143TCCAGGCCTGCCTCCCACTAGTGGGAGGCAGGCCTGGA0.134400.006000.663800.500000.913000.87500


Target Position: 376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
376CUGUCCUGCAAACCUCCUC58.27861107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
226394CTGTCCTGCAAACCTCCTCGAGGAGGTTTGCAGGACAG0.247500.001700.474100.500001.000001.00000


Target Position: 555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
555GGGGCCCUCUUCUACUUCA86.851361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
222573GGGGCCCTCTTCTACTTCATGAAGTAGAAGAGGGCCCC0.288000.001400.767200.750001.000001.00000


Target Position: 1358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1358GGUGUGUAUAUUGUAUAGG68.487618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2231376GGTGTGTATATTGTATAGGCCTATACAATATACACACC0.019200.013500.508600.500001.000001.00000


Target Position: 251, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
251GGGCUCAGCCUGUAUCAAA95.08525

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_625119GGGCTCAGCCTGTATCAAA1/1/0/084.80CD82NM_002231.3+NM_001024844.11+1NANANA11:44616215..44616233(+)00CD82(0.002)


Target Position: 786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
786GGGGAAGAGGACAACAGCC68.8495604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
216804GGGGAAGAGGACAACAGCCGGCTGTTGTCCTCTTCCCC0.109200.002700.491400.500000.929300.62500


Target Position: 1009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1009GGCACGUCCAUUCCGAAGA75.4781351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1151027GGCACGTCCATTCCGAAGATCTTCGGAATGGACGTGCC0.164200.039300.775900.750001.000001.00000


Target Position: 1016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1016CCAUUCCGAAGACUACAGC58.56451096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2311034CCATTCCGAAGACTACAGCGCTGTAGTCTTCGGAATGG0.029600.016000.491400.500000.978300.62500


Target Position: 1287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1287AGCAACUCAGAGAAAAAUG66.2762716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2081305AGCAACTCAGAGAAAAATGCATTTTTCTCTGAGTTGCT0.030500.008300.698300.500001.000001.00000


Target Position: 725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
725AGACAACGCUGAGCUCAUG72.736441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
232743AGACAACGCTGAGCTCATGCATGAGCTCAGCGTTGTCT0.013800.001600.569000.500001.000001.00000


Target Position: 1373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1373UAGGGGCAACUGUAUGAAA84.3563101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1831391TAGGGGCAACTGTATGAAATTTCATACAGTTGCCCCTA0.103500.005500.672400.500001.000001.00000


Target Position: 1127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1127CAGGCCUGCCUCCCACUUC61.5552964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2181145CAGGCCTGCCTCCCACTTCGAAGTGGGAGGCAGGCCTG0.224600.054200.612100.500000.913000.62500


Target Position: 1155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1155ACCCUCUUGCCCAUCCUGA67.711647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1631173ACCCTCTTGCCCATCCTGATCAGGATGGGCAAGAGGGT0.156200.019300.629300.500001.000001.00000


Target Position: 1131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1131CCUGCCUCCCACUUCACUG66.6534701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1651149CCTGCCTCCCACTTCACTGCAGTGAAGTGGGAGGCAGG0.084000.022300.560300.750001.000001.00000


Target Position: 1030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1030ACAGCAAGGUCCCCAAGUA87.369353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1821048ACAGCAAGGTCCCCAAGTATACTTGGGGACCTTGCTGT0.325600.010700.525900.750001.000001.00000


Target Position: 119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
119AGCGCGGAGCAGAAAGCAG65.5485750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
198137AGCGCGGAGCAGAAAGCAGCTGCTTTCTGCTCCGCGCT0.185900.004600.569000.500000.945700.75000


Target Position: 1128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1128AGGCCUGCCUCCCACUUCA79.2286234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1941146AGGCCTGCCTCCCACTTCATGAAGTGGGAGGCAGGCCT0.240100.094500.620700.500000.934800.75000


Target Position: 1590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1590CUGAGGCAGGAGAAUGGUG67.5459653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2131608CTGAGGCAGGAGAATGGTGCACCATTCTCCTGCCTCAG0.216600.019900.491400.500001.000001.00000


Target Position: 1519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1519UCUACUAAAAAUACAAAAA81.2041184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
671537TCTACTAAAAATACAAAAATTTTTGTATTTTTAGTAGA0.918800.466300.724100.750001.000001.00000


Target Position: 761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
761CUACCCCUGUUCCUGCGAA80.643195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
229779CTACCCCTGTTCCTGCGAATTCGCAGGAACAGGGGTAG0.016900.004400.500000.750000.994600.62500


Target Position: 1130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1130GCCUGCCUCCCACUUCACU70.8034516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1101148GCCTGCCTCCCACTTCACTAGTGAAGTGGGAGGCAGGC0.190400.042700.793100.750001.000001.00000


Target Position: 437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
437GGCAGUCACUAUGCUCAUG76.4721321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
235455GGCAGTCACTATGCTCATGCATGAGCATAGTGACTGCC0.012700.002000.844800.750000.956500.62500


Target Position: 1283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1283UCUUAGCAACUCAGAGAAA83.0572141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1331301TCTTAGCAACTCAGAGAAATTTCTCTGAGTTGCTAAGA0.130100.032000.724100.750001.000001.00000


Target Position: 1002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1002UUGUGCCGGCACGUCCAUU58.56271097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1931020TTGTGCCGGCACGTCCATTAATGGACGTGCCGGCACAA0.313600.002900.637900.500000.929300.75000


Target Position: 343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
343UGUGGAUCCUGGCCGACAA83.1923137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
234361TGTGGATCCTGGCCGACAATTGTCGGCCAGGATCCACA0.025100.001100.560300.750000.956500.75000


Target Position: 560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
560CCUCUUCUACUUCAACAUG72.266458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
172578CCTCTTCTACTTCAACATGCATGTTGAAGTAGAAGAGG0.066700.022700.689700.750001.000001.00000


Target Position: 1354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1354CAAGGGUGUGUAUAUUGUA97.84533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2311372CAAGGGTGTGTATATTGTATACAATATACACACCCTTG0.051500.006800.465500.750001.000001.00000


Target Position: 1688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1688UCAAAAAAAAAAAAAAAAA74.8393368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471706TCAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTGA0.999900.984800.724100.750001.000001.00000


Target Position: 122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
122GCGGAGCAGAAAGCAGAAC60.62371001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
144140GCGGAGCAGAAAGCAGAACGTTCTGCTTTCTGCTCCGC0.114200.016600.775900.750000.945701.00000


Target Position: 1059, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1059UGCUAUCCCCAUCUCCCUG58.30261106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1741077TGCTATCCCCATCTCCCTGCAGGGAGATGGGGATAGCA0.065500.021500.569000.500001.000001.00000


Target Position: 1685, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1685GUCUCAAAAAAAAAAAAAA88.641137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1231703GTCTCAAAAAAAAAAAAAATTTTTTTTTTTTTTGAGAC0.999900.012500.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1683-1705CCGTCTCAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUGAGACGGGUCUCAAAAAAAAAAAAAAAAU-11.320.400


Target Position: 1592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1592GAGGCAGGAGAAUGGUGUG75.8246342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1851610GAGGCAGGAGAATGGTGTGCACACCATTCTCCTGCCTC0.191300.025000.517200.500001.000001.00000


Target Position: 271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
271UCACCAAAUACUUUCUCUU74.6814375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
147289TCACCAAATACTTTCTCTTAAGAGAAAGTATTTGGTGA0.578900.455500.586200.750001.000001.00000


Target Position: 787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
787GGGAAGAGGACAACAGCCU75.513349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190805GGGAAGAGGACAACAGCCTAGGCTGTTGTCCTCTTCCC0.097600.003500.646600.750000.918500.62500


Target Position: 516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
516GCUUUCCUGCUCCUGAUCC59.07371071

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
223534GCTTTCCTGCTCCTGATCCGGATCAGGAGCAGGAAAGC0.199400.038600.482800.500001.000001.00000


Target Position: 644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
644CGAGGACAGCCUGCAGGAU80.1298208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
233662CGAGGACAGCCTGCAGGATATCCTGCAGGCTGTCCTCG0.013400.004400.612101.000000.978300.75000


Target Position: 254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
254CUCAGCCUGUAUCAAAGUC65.0624771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
215272CTCAGCCTGTATCAAAGTCGACTTTGATACAGGCTGAG0.094500.008100.491400.500001.000001.00000


Target Position: 1516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1516GUCUCUACUAAAAAUACAA94.28948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801534GTCTCTACTAAAAATACAATTGTATTTTTAGTAGAGAC0.731800.271900.672400.750001.000001.00000


Target Position: 1161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1161UUGCCCAUCCUGACUGAAA72.9649429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2121179TTGCCCATCCTGACTGAAATTTCAGTCAGGATGGGCAA0.067500.013700.646600.500000.918500.75000


Target Position: 1215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1215GCCUAUCCGCUGCCAGCCU66.9336679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2011233GCCTATCCGCTGCCAGCCTAGGCTGGCAGCGGATAGGC0.035700.003600.655200.750000.923900.87500


Target Position: 1053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053GGCAGCUGCUAUCCCCAUC66.8071685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
721071GGCAGCTGCTATCCCCATCGATGGGGATAGCAGCTGCC0.813800.034900.819000.750000.983700.75000


Target Position: 1494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1494CUGGCUAACAUGGUGAAAC63.7877850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1841512CTGGCTAACATGGTGAAACGTTTCACCATGTTAGCCAG0.053600.008200.637900.500001.000001.00000


Target Position: 291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
291CUCUUCAACUUGAUCUUCU78.5221253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
221309CTCTTCAACTTGATCTTCTAGAAGATCAAGTTGAAGAG0.324300.277900.586200.500001.000001.00000


Target Position: 1374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1374AGGGGCAACUGUAUGAAAA87.369154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1461392AGGGGCAACTGTATGAAAATTTTCATACAGTTGCCCCT0.119300.007800.844800.750001.000001.00000


Target Position: 1589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1589GCUGAGGCAGGAGAAUGGU69.5229581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921607GCTGAGGCAGGAGAATGGTACCATTCTCCTGCCTCAGC0.247900.017200.500000.750001.000001.00000


Target Position: 780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
780GUCAAGGGGGAAGAGGACA71.6244485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
191798GTCAAGGGGGAAGAGGACATGTCCTCTTCCCCCTTGAC0.051200.003200.612100.500001.000001.00000


Target Position: 1123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1123CCUCCAGGCCUGCCUCCCA75.5506347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1971141CCTCCAGGCCTGCCTCCCATGGGAGGCAGGCCTGGAGG0.318900.022800.500000.750000.913001.00000


Target Position: 1492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1492UCCUGGCUAACAUGGUGAA74.9537362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1861510TCCTGGCTAACATGGTGAATTCACCATGTTAGCCAGGA0.053200.003800.698300.750000.994600.62500


Target Position: 265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
265UCAAAGUCACCAAAUACUU71.6884480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
149283TCAAAGTCACCAAATACTTAAGTATTTGGTGACTTTGA0.535200.110400.586200.750001.000001.00000


Target Position: 556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
556GGGCCCUCUUCUACUUCAA89.020934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192574GGGCCCTCTTCTACTTCAATTGAAGTAGAAGAGGGCCC0.281200.003100.844801.000001.000001.00000


Target Position: 1055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055CAGCUGCUAUCCCCAUCUC70.857512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2321073CAGCTGCTATCCCCATCTCGAGATGGGGATAGCAGCTG0.539900.430200.474100.500001.000001.00000


Target Position: 370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
370UCAUCUCUGUCCUGCAAAC67.1684672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181388TCATCTCTGTCCTGCAAACGTTTGCAGGACAGAGATGA0.197200.004100.577600.500001.000001.00000


Target Position: 252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
252GGCUCAGCCUGUAUCAAAG83.2118136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
174270GGCTCAGCCTGTATCAAAGCTTTGATACAGGCTGAGCC0.092100.004600.862100.750000.918500.62500


Target Position: 788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
788GGAAGAGGACAACAGCCUU87.43348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
235806GGAAGAGGACAACAGCCTTAAGGCTGTTGTCCTCTTCC0.067600.001000.732801.000000.907600.62500


Target Position: 558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
558GCCCUCUUCUACUUCAACA87.421349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
87576GCCCTCTTCTACTTCAACATGTTGAAGTAGAAGAGGGC0.270600.051700.793100.750001.000001.00000


Target Position: 728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
728CAACGCUGAGCUCAUGAAU81.7445172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
220746CAACGCTGAGCTCATGAATATTCATGAGCTCAGCGTTG0.046200.001500.637900.750001.000001.00000


Target Position: 270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
270GUCACCAAAUACUUUCUCU81.4659181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
160288GTCACCAAATACTTTCTCTAGAGAAAGTATTTGGTGAC0.565500.365800.594800.500001.000001.00000


Target Position: 1584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1584GGGAGGCUGAGGCAGGAGA78.1024271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1841602GGGAGGCTGAGGCAGGAGATCTCCTGCCTCAGCCTCCC0.094000.003800.767200.750001.000001.00000


Target Position: 1268, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1268CGCCCAUCAGGGUUCUCUU81.6747175

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10126819CGCCCATCAGGGTTCTCTT1/1/0/083.18CD82NM_001024844.1+NM_002231.31+1NANANA11:44640892..44640910(+)00CD82(0.002)


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773CUGCGAAGUCAAGGGGGAA80.126209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192791CTGCGAAGTCAAGGGGGAATTCCCCCTTGACTTCGCAG0.046700.008500.612100.750001.000001.00000


Target Position: 1521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1521UACUAAAAAUACAAAAAAA92.007915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2331539TACTAAAAATACAAAAAAATTTTTTTGTATTTTTAGTA0.941700.540800.681000.500001.000001.00000


Target Position: 1026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1026GACUACAGCAAGGUCCCCA81.0636186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2251044GACTACAGCAAGGTCCCCATGGGGACCTTGCTGTAGTC0.058500.014900.474100.500001.000001.00000


Target Position: 1377, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1377GGCAACUGUAUGAAAAAUU80.4851201

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4137719GGCAACTGTATGAAAAATT1/1/0/088.67CD82NM_001024844.1+NM_002231.31+1NANANA11:44641001..44641019(+)00CD82(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
871395GGCAACTGTATGAAAAATTAATTTTTCATACAGTTGCC0.308500.021600.991401.000001.000001.00000


Target Position: 121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
121CGCGGAGCAGAAAGCAGAA89.119533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95139CGCGGAGCAGAAAGCAGAATTCTGCTTTCTGCTCCGCG0.218900.030200.750001.000000.945701.00000


Target Position: 782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
782CAAGGGGGAAGAGGACAAC63.7829851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
205800CAAGGGGGAAGAGGACAACGTTGTCCTCTTCCCCCTTG0.049000.004200.500000.500001.000001.00000


Target Position: 1588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1588GGCUGAGGCAGGAGAAUGG69.8519563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2021606GGCTGAGGCAGGAGAATGGCCATTCTCCTGCCTCAGCC0.134500.014100.655200.500001.000001.00000


Target Position: 1692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1692AAAAAAAAAAAAAAAAAAA83.5835120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1961710AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT1.000000.999600.500000.500001.000001.00000


Target Position: 1591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1591UGAGGCAGGAGAAUGGUGU64.0778834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2111609TGAGGCAGGAGAATGGTGTACACCATTCTCCTGCCTCA0.204900.020600.517200.500001.000001.00000


Target Position: 1511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1511ACCCCGUCUCUACUAAAAA81.2697183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1001529ACCCCGTCTCTACTAAAAATTTTTAGTAGAGACGGGGT0.489400.074700.853400.750001.000001.00000


Target Position: 557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
557GGCCCUCUUCUACUUCAAC72.6784446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
77575GGCCCTCTTCTACTTCAACGTTGAAGTAGAAGAGGGCC0.274900.066000.853400.750001.000001.00000


Target Position: 1202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1202GCGAUCUCUCCUGGCCUAU69.7299571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1711220GCGATCTCTCCTGGCCTATATAGGCCAGGAGAGATCGC0.067000.023800.879301.000001.000001.00000


Target Position: 388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
388CCUCCUCCAGCUCGCUUAG63.5899862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
205406CCTCCTCCAGCTCGCTTAGCTAAGCGAGCTGGAGGAGG0.032800.017200.672400.750001.000001.00000


Target Position: 258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
258GCCUGUAUCAAAGUCACCA84.760794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
128276GCCTGTATCAAAGTCACCATGGTGACTTTGATACAGGC0.135600.018900.655200.750001.000001.00000


Target Position: 1154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1154GACCCUCUUGCCCAUCCUG68.0353633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1801172GACCCTCTTGCCCATCCTGCAGGATGGGCAAGAGGGTC0.125100.021200.534500.500001.000001.00000


Target Position: 726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
726GACAACGCUGAGCUCAUGA83.3967130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
216744GACAACGCTGAGCTCATGATCATGAGCTCAGCGTTGTC0.025300.001800.594800.500001.000001.00000


Target Position: 1248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1248UCUGUGGUUCCUCUGCUCA72.864436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2271266TCTGTGGTTCCTCTGCTCATGAGCAGAGGAACCACAGA0.204500.002400.500000.500001.000001.00000


Target Position: 436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
436GGGCAGUCACUAUGCUCAU87.363255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
165454GGGCAGTCACTATGCTCATATGAGCATAGTGACTGCCC0.073500.006800.836201.000000.956500.75000


Target Position: 514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
514UUGCUUUCCUGCUCCUGAU69.554578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
236532TTGCTTTCCTGCTCCTGATATCAGGAGCAGGAAAGCAA0.066100.032200.465500.500000.945700.75000


Target Position: 1256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1256UCCUCUGCUCACCGCCCAU65.0077777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2131274TCCTCTGCTCACCGCCCATATGGGCGGTGAGCAGAGGA0.026600.021100.715500.750000.923901.00000


Target Position: 1526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1526AAAAUACAAAAAAAAUUUA83.9308109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2321544AAAATACAAAAAAAATTTATAAATTTTTTTTGTATTTT0.507100.447100.465500.500001.000001.00000


Target Position: 1659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1659CAGCCUGGGGGACAGAAAG66.8809681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2131677CAGCCTGGGGGACAGAAAGCTTTCTGTCCCCCAGGCTG0.110000.001800.646600.500000.934800.75000


Target Position: 617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
617GCUCAUUCGAGACUACAAC72.3115455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
150635GCTCATTCGAGACTACAACGTTGTAGTCTCGAATGAGC0.185600.007000.706900.750000.951100.62500


Target Position: 1696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1696AAAAAAAAAAAAAAAAAAA83.5835124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1951714AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT1.000000.999900.500000.500001.000001.00000


Target Position: 289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
289UCCUCUUCAACUUGAUCUU67.7276646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
92307TCCTCTTCAACTTGATCTTAAGATCAAGTTGAAGAGGA0.480500.423500.732800.750001.000001.00000


Target Position: 989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
989CCUGUCCAUCUGCUUGUGC56.8741173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2311007CCTGTCCATCTGCTTGTGCGCACAAGCAGATGGACAGG0.013800.001200.491400.500000.945700.75000


Target Position: 1587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1587AGGCUGAGGCAGGAGAAUG65.193764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2031605AGGCTGAGGCAGGAGAATGCATTCTCCTGCCTCAGCCT0.144300.004700.689700.500001.000001.00000


Target Position: 1162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1162UGCCCAUCCUGACUGAAAG66.1837721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1961180TGCCCATCCTGACTGAAAGCTTTCAGTCAGGATGGGCA0.201000.021900.715500.500000.918500.62500


Target Position: 515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
515UGCUUUCCUGCUCCUGAUC53.83611299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
216533TGCTTTCCTGCTCCTGATCGATCAGGAGCAGGAAAGCA0.197000.035100.672400.500000.945700.75000


Target Position: 712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
712UCUACAACUGGACAGACAA83.8357110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
154730TCTACAACTGGACAGACAATTGTCTGTCCAGTTGTAGA0.309800.106600.577600.750001.000001.00000


Target Position: 1357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1357GGGUGUGUAUAUUGUAUAG88.674936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2121375GGGTGTGTATATTGTATAGCTATACAATATACACACCC0.027000.016600.819000.750001.000001.00000


Target Position: 765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
765CCCUGUUCCUGCGAAGUCA83.145139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197783CCCTGTTCCTGCGAAGTCATGACTTCGCAGGAACAGGG0.039100.004200.767200.750000.983701.00000


Target Position: 1524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1524UAAAAAUACAAAAAAAAUU72.1215461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1781542TAAAAATACAAAAAAAATTAATTTTTTTTGTATTTTTA0.665600.618800.525900.500001.000001.00000


Target Position: 1509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1509AAACCCCGUCUCUACUAAA86.485469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2071527AAACCCCGTCTCTACTAAATTTAGTAGAGACGGGGTTT0.363300.061500.500000.500001.000001.00000


Target Position: 294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
294UUCAACUUGAUCUUCUUUA69.7709568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
204312TTCAACTTGATCTTCTTTATAAAGAAGATCAAGTTGAA0.382100.185400.637900.500001.000001.00000


Target Position: 1664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1664UGGGGGACAGAAAGAGACU68.5989614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2231682TGGGGGACAGAAAGAGACTAGTCTCTTTCTGTCCCCCA0.068200.001300.637900.500001.000001.00000


Target Position: 1355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1355AAGGGUGUGUAUAUUGUAU85.61782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1881373AAGGGTGTGTATATTGTATATACAATATACACACCCTT0.051300.006400.594800.500001.000001.00000


Target Position: 504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
504GGGCUGUACUUUGCUUUCC62.4214924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
194522GGGCTGTACTTTGCTTTCCGGAAAGCAAAGTACAGCCC0.241600.002800.620700.500000.978300.75000


Target Position: 747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
747CGCCCUGAGGUCACCUACC61.8381952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
224765CGCCCTGAGGTCACCTACCGGTAGGTGACCTCAGGGCG0.186500.010200.569000.500000.918500.62500


Target Position: 1513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1513CCCGUCUCUACUAAAAAUA81.5733177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471531CCCGTCTCTACTAAAAATATATTTTTAGTAGAGACGGG0.559000.108000.948301.000001.000001.00000


Target Position: 746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
746UCGCCCUGAGGUCACCUAC53.23441317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
213764TCGCCCTGAGGTCACCTACGTAGGTGACCTCAGGGCGA0.117700.008300.612100.500000.951100.62500


Target Position: 1159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159UCUUGCCCAUCCUGACUGA73.7375396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2091177TCTTGCCCATCCTGACTGATCAGTCAGGATGGGCAAGA0.093800.017300.500000.500000.918500.87500


Target Position: 435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
435GGGGCAGUCACUAUGCUCA90.658222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
226453GGGGCAGTCACTATGCTCATGAGCATAGTGACTGCCCC0.080700.001300.767200.750000.956500.75000


Target Position: 285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
285CUCUUCCUCUUCAACUUGA80.3936203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
173303CTCTTCCTCTTCAACTTGATCAAGTTGAAGAGGAAGAG0.465200.413900.586200.500001.000001.00000


Target Position: 1351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1351CCUCAAGGGUGUGUAUAUU83.3867131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1221369CCTCAAGGGTGTGTATATTAATATACACACCCTTGAGG0.145000.018700.836201.000001.000001.00000


Target Position: 776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
776CGAAGUCAAGGGGGAAGAG68.4721619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
224794CGAAGTCAAGGGGGAAGAGCTCTTCCCCCTTGACTTCG0.023100.002000.482800.750001.000001.00000


Target Position: 260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
260CUGUAUCAAAGUCACCAAA87.770144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
114278CTGTATCAAAGTCACCAAATTTGGTGACTTTGATACAG0.177500.057700.784500.750001.000001.00000


Target Position: 283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
283UUCUCUUCCUCUUCAACUU69.9239562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
173301TTCTCTTCCTCTTCAACTTAAGTTGAAGAGGAAGAGAA0.680600.459000.534500.500001.000001.00000


Target Position: 262, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
262GUAUCAAAGUCACCAAAUA98.18952

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_326219GTATCAAAGTCACCAAATA1/1/0/097.21CD82NM_002231.3+NM_001024844.11+1NANANA11:44616226..44616244(+)00CD82(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
110280GTATCAAAGTCACCAAATATATTTGGTGACTTTGATAC0.381700.082100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
260-282CTGTATCAAAGTCACCAAATACTUAUUUGGUGACUUUGAUACAGGUAUCAAAGUCACCAAAUACUU18.88.922


Target Position: 1378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1378GCAACUGUAUGAAAAAUUG79.1627237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
771396GCAACTGTATGAAAAATTGCAATTTTTCATACAGTTGC0.360800.027000.706900.750001.000001.00000


Target Position: 1520, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1520CUACUAAAAAUACAAAAAA89.780527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1201538CTACTAAAAATACAAAAAATTTTTTGTATTTTTAGTAG0.949400.526700.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1518-1540CTCTACTAAAAATACAAAAAAAAUUUUUUGUAUUUUUAGUAGAGCUACUAAAAAUACAAAAAAAAU5.66.600


Target Position: 1691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1691AAAAAAAAAAAAAAAAAAA83.5835119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2041709AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999900.999000.500000.500001.000001.00000


Target Position: 1124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1124CUCCAGGCCUGCCUCCCAC59.30941058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2011142CTCCAGGCCTGCCTCCCACGTGGGAGGCAGGCCTGGAG0.118000.006200.517200.500000.913001.00000


Target Position: 296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
296CAACUUGAUCUUCUUUAUC73.2448417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
234314CAACTTGATCTTCTTTATCGATAAAGAAGATCAAGTTG0.282000.136600.465500.500001.000001.00000


Target Position: 1697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1697AAAAAAAAAAAAAAAAAAA83.5835125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2361715AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT1.000000.999900.500000.500001.000001.00000


Target Position: 1684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1684CGUCUCAAAAAAAAAAAAA84.926392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1351702CGTCTCAAAAAAAAAAAAATTTTTTTTTTTTTGAGACG0.999800.009500.775901.000001.000001.00000


Target Position: 272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
272CACCAAAUACUUUCUCUUC75.0277361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
209290CACCAAATACTTTCTCTTCGAAGAGAAAGTATTTGGTG0.601100.466500.620700.500001.000001.00000


Target Position: 1031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1031CAGCAAGGUCCCCAAGUAC73.6173404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1911049CAGCAAGGTCCCCAAGTACGTACTTGGGGACCTTGCTG0.313000.009700.603400.500001.000001.00000


Target Position: 261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
261UGUAUCAAAGUCACCAAAU73.1477421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
101279TGTATCAAAGTCACCAAATATTTGGTGACTTTGATACA0.657000.079500.698300.750001.000001.00000


Target Position: 1512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1512CCCCGUCUCUACUAAAAAU87.510147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501530CCCCGTCTCTACTAAAAATATTTTTAGTAGAGACGGGG0.545700.084800.982801.000001.000001.00000


Target Position: 1144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1144UCACUGCGAAGACCCUCUU64.2948822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1491162TCACTGCGAAGACCCTCTTAAGAGGGTCTTCGCAGTGA0.215100.007000.586200.750001.000001.00000


Target Position: 1129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1129GGCCUGCCUCCCACUUCAC67.1403673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1091147GGCCTGCCTCCCACTTCACGTGAAGTGGGAGGCAGGCC0.191100.043600.706900.750001.000001.00000


Target Position: 1217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1217CUAUCCGCUGCCAGCCUUG60.61071002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2041235CTATCCGCTGCCAGCCTTGCAAGGCTGGCAGCGGATAG0.033400.005200.525900.500000.923901.00000


Target Position: 292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
292UCUUCAACUUGAUCUUCUU79.5744224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
146310TCTTCAACTTGATCTTCTTAAGAAGATCAAGTTGAAGA0.356200.281000.586200.750001.000001.00000


Target Position: 1683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1683CCGUCUCAAAAAAAAAAAA85.508784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1361701CCGTCTCAAAAAAAAAAAATTTTTTTTTTTTGAGACGG0.999400.009400.913801.000001.000001.00000


Target Position: 1515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1515CGUCUCUACUAAAAAUACA93.26510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1581533CGTCTCTACTAAAAATACATGTATTTTTAGTAGAGACG0.686000.257200.569000.750001.000001.00000


Target Position: 116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
116UGCAGCGCGGAGCAGAAAG53.26831316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
217134TGCAGCGCGGAGCAGAAAGCTTTCTGCTCCGCGCTGCA0.127500.001700.715500.500000.907600.62500


Target Position: 362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
362GAGCAGUUUCAUCUCUGUC76.3066328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
236380GAGCAGTTTCATCTCTGTCGACAGAGATGAAACTGCTC0.046900.001000.491400.500000.951100.62500


Target Position: 505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
505GGCUGUACUUUGCUUUCCU84.1769104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95523GGCTGTACTTTGCTTTCCTAGGAAAGCAAAGTACAGCC0.243200.215800.655200.750000.978300.75000


Target Position: 724, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
724CAGACAACGCUGAGCUCAU88.338540

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_872419CAGACAACGCTGAGCTCAT1/1/0/084.17CD82NM_002231.3+NM_001024844.11+1NANANA11:44639749..44639767(+)00CD82(0.002)


Target Position: 1352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1352CUCAAGGGUGUGUAUAUUG71.4178493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1671370CTCAAGGGTGTGTATATTGCAATATACACACCCTTGAG0.079400.009800.663800.500001.000001.00000


Target Position: 1695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1695AAAAAAAAAAAAAAAAAAA83.5835123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1991713AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT1.000000.999900.500000.500001.000001.00000


Target Position: 387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
387ACCUCCUCCAGCUCGCUUA74.3928382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
79405ACCTCCTCCAGCTCGCTTATAAGCGAGCTGGAGGAGGT0.407100.025100.819000.750001.000001.00000


Target Position: 342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
342GUGUGGAUCCUGGCCGACA80.7723191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
215360GTGTGGATCCTGGCCGACATGTCGGCCAGGATCCACAC0.027000.001700.586200.500000.956500.62500


Target Position: 520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
520UCCUGCUCCUGAUCCUCAU70.2481548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
103538TCCTGCTCCTGATCCTCATATGAGGATCAGGAGCAGGA0.442400.051300.715500.750001.000001.00000


Target Position: 1145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1145CACUGCGAAGACCCUCUUG68.0418631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2281163CACTGCGAAGACCCTCTTGCAAGAGGGTCTTCGCAGTG0.054000.001200.646600.500001.000001.00000


Target Position: 559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
559CCCUCUUCUACUUCAACAU80.75192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
80577CCCTCTTCTACTTCAACATATGTTGAAGTAGAAGAGGG0.265900.253000.836201.000001.000001.00000


Target Position: 354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
354GCCGACAAGAGCAGUUUCA79.6403220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
221372GCCGACAAGAGCAGTTTCATGAAACTGCTCTTGTCGGC0.253700.001400.775900.750000.962000.62500


Target Position: 1585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1585GGAGGCUGAGGCAGGAGAA89.597429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1621603GGAGGCTGAGGCAGGAGAATTCTCCTGCCTCAGCCTCC0.140000.006000.698301.000001.000001.00000


Target Position: 1054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1054GCAGCUGCUAUCCCCAUCU74.3474384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1181072GCAGCTGCTATCCCCATCTAGATGGGGATAGCAGCTGC0.681200.035200.629300.750001.000001.00000


Target Position: 1370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1370GUAUAGGGGCAACUGUAUG72.9734428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2271388GTATAGGGGCAACTGTATGCATACAGTTGCCCCTATAC0.030200.001300.525900.500001.000001.00000


Target Position: 760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
760CCUACCCCUGUUCCUGCGA64.8568792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
228778CCTACCCCTGTTCCTGCGATCGCAGGAACAGGGGTAGG0.017400.005000.551700.750001.000001.00000


Target Position: 775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
775GCGAAGUCAAGGGGGAAGA70.0366556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
227793GCGAAGTCAAGGGGGAAGATCTTCCCCCTTGACTTCGC0.017800.002400.698300.750001.000001.00000


Target Position: 1661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1661GCCUGGGGGACAGAAAGAG62.9269899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2031679GCCTGGGGGACAGAAAGAGCTCTTTCTGTCCCCCAGGC0.119500.002200.689700.750000.934800.62500


Target Position: 1021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1021CCGAAGACUACAGCAAGGU66.4578709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2141039CCGAAGACTACAGCAAGGTACCTTGCTGTAGTCTTCGG0.026300.009200.560300.750001.000001.00000


Target Position: 284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
284UCUCUUCCUCUUCAACUUG59.7451035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
225302TCTCTTCCTCTTCAACTTGCAAGTTGAAGAGGAAGAGA0.464900.416800.577600.500001.000001.00000


Target Position: 1586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1586GAGGCUGAGGCAGGAGAAU76.3735326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1541604GAGGCTGAGGCAGGAGAATATTCTCCTGCCTCAGCCTC0.268200.006800.801700.750001.000001.00000


Target Position: 1517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1517UCUCUACUAAAAAUACAAA84.71795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
481535TCTCTACTAAAAATACAAATTTGTATTTTTAGTAGAGA0.915200.332500.724100.750001.000001.00000


Target Position: 286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
286UCUUCCUCUUCAACUUGAU71.7698475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
169304TCTTCCTCTTCAACTTGATATCAAGTTGAAGAGGAAGA0.470300.414700.543100.750001.000001.00000


Target Position: 290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
290CCUCUUCAACUUGAUCUUC65.7252740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
81308CCTCTTCAACTTGATCTTCGAAGATCAAGTTGAAGAGG0.323400.275600.672400.750001.000001.00000


Target Position: 506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
506GCUGUACUUUGCUUUCCUG78.1546268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
167524GCTGTACTTTGCTTTCCTGCAGGAAAGCAAAGTACAGC0.069700.012500.569000.750001.000001.00000


Target Position: 1242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1242GGCUGUUCUGUGGUUCCUC69.1831596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2361260GGCTGTTCTGTGGTTCCTCGAGGAACCACAGAACAGCC0.011600.002200.689700.750001.000001.00000


Target Position: 522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
522CUGCUCCUGAUCCUCAUUG60.8032997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
222540CTGCTCCTGATCCTCATTGCAATGAGGATCAGGAGCAG0.148100.005200.637900.500001.000001.00000


Target Position: 259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
259CCUGUAUCAAAGUCACCAA92.758111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
124277CCTGTATCAAAGTCACCAATTGGTGACTTTGATACAGG0.144200.026300.698301.000001.000001.00000


Target Position: 566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
566CUACUUCAACAUGGGCAAG63.9478839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
224584CTACTTCAACATGGGCAAGCTTGCCCATGTTGAAGTAG0.105900.001300.534500.500001.000001.00000


Target Position: 1022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1022CGAAGACUACAGCAAGGUC78.6847248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2291040CGAAGACTACAGCAAGGTCGACCTTGCTGTAGTCTTCG0.025200.008800.474100.750000.978300.62500


Target Position: 1160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1160CUUGCCCAUCCUGACUGAA77.8336282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2331178CTTGCCCATCCTGACTGAATTCAGTCAGGATGGGCAAG0.070000.016000.465500.750000.918500.87500


Target Position: 1522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1522ACUAAAAAUACAAAAAAAA84.642897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
601540ACTAAAAATACAAAAAAAATTTTTTTTGTATTTTTAGT0.918900.561000.706900.750001.000001.00000


Target Position: 1001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1001CUUGUGCCGGCACGUCCAU66.7903686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2211019CTTGTGCCGGCACGTCCATATGGACGTGCCGGCACAAG0.283500.002200.482800.750000.929300.87500


Target Position: 280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
280ACUUUCUCUUCCUCUUCAA83.8032112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
164298ACTTTCTCTTCCTCTTCAATTGAAGAGGAAGAGAAAGT0.586900.359700.560300.750001.000001.00000


Target Position: 1350, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1350CCCUCAAGGGUGUGUAUAU86.673666

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1135019CCCTCAAGGGTGTGTATAT1/1/0/097.75CD82NM_002231.3+NM_001024844.11+1NANANA11:44640974..44640992(+)00CD82(0.002)


Target Position: 369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
369UUCAUCUCUGUCCUGCAAA68.8764602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
178387TTCATCTCTGTCCTGCAAATTTGCAGGACAGAGATGAA0.119300.021500.672400.500001.000001.00000


Target Position: 784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784AGGGGGAAGAGGACAACAG67.0495677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181802AGGGGGAAGAGGACAACAGCTGTTGTCCTCTTCCCCCT0.062200.009700.560300.500001.000001.00000


Target Position: 1658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1658CCAGCCUGGGGGACAGAAA79.6161222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1651676CCAGCCTGGGGGACAGAAATTTCTGTCCCCCAGGCTGG0.261100.005700.844801.000000.934800.75000


Target Position: 756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756GUCACCUACCCCUGUUCCU68.5409615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
227774GTCACCTACCCCTGTTCCTAGGAACAGGGGTAGGTGAC0.044800.010900.474100.500001.000001.00000


Target Position: 1356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1356AGGGUGUGUAUAUUGUAUA89.613928

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1961374AGGGTGTGTATATTGTATATATACAATATACACACCCT0.039100.006800.801700.750001.000001.00000


Target Position: 1593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593AGGCAGGAGAAUGGUGUGA70.0452555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1471611AGGCAGGAGAATGGTGTGATCACACCATTCTCCTGCCT0.162400.029800.620700.500001.000001.00000


Target Position: 1690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1690AAAAAAAAAAAAAAAAAAA83.5835118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2031708AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.999900.998000.500000.500001.000001.00000


Target Position: 1243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1243GCUGUUCUGUGGUUCCUCU83.4208129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2201261GCTGTTCTGTGGTTCCTCTAGAGGAACCACAGAACAGC0.024100.001900.629300.750001.000001.00000


Target Position: 1216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1216CCUAUCCGCUGCCAGCCUU69.8337564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2031234CCTATCCGCTGCCAGCCTTAAGGCTGGCAGCGGATAGG0.034400.006400.706901.000000.923901.00000


Target Position: 1258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258CUCUGCUCACCGCCCAUCA76.2539331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2261276CTCTGCTCACCGCCCATCATGATGGGCGGTGAGCAGAG0.017900.007900.586200.500000.923901.00000


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766CCUGUUCCUGCGAAGUCAA86.054575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
171784CCTGTTCCTGCGAAGTCAATTGACTTCGCAGGAACAGG0.810300.005200.698301.000000.983701.00000


Target Position: 253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
253GCUCAGCCUGUAUCAAAGU76.8313309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
159271GCTCAGCCTGTATCAAAGTACTTTGATACAGGCTGAGC0.102500.006300.646600.750001.000001.00000


Target Position: 1196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1196GGCCUAGCGAUCUCUCCUG70.4547531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1981214GGCCTAGCGATCTCTCCTGCAGGAGAGATCGCTAGGCC0.039000.004100.715500.750001.000001.00000


Target Position: 293, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
293CUUCAACUUGAUCUUCUUU79.9467214

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_529319CTTCAACTTGATCTTCTTT1/1/0/088.31CD82NM_002231.3+NM_001024844.11+1NANANANA00CD82(0.002)&DOCK11(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
112311CTTCAACTTGATCTTCTTTAAAGAAGATCAAGTTGAAG0.436200.240800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
291-313CTCTTCAACTTGATCTTCTTTATAAAGAAGAUCAAGUUGAAGAGCUUCAACUUGAUCUUCUUUAUU19.119.221


Target Position: 1525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1525AAAAAUACAAAAAAAAUUU73.9064392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1931543AAAAATACAAAAAAAATTTAAATTTTTTTTGTATTTTT0.568700.515100.500000.500001.000001.00000


Target Position: 1000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1000GCUUGUGCCGGCACGUCCA82.129162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2051018GCTTGTGCCGGCACGTCCATGGACGTGCCGGCACAAGC0.261900.002100.508600.750000.929301.00000


Target Position: 1158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1158CUCUUGCCCAUCCUGACUG60.6986999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1791176CTCTTGCCCATCCTGACTGCAGTCAGGATGGGCAAGAG0.104100.013900.525900.500000.918500.75000


Target Position: 256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
256CAGCCUGUAUCAAAGUCAC77.6616287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
217274CAGCCTGTATCAAAGTCACGTGACTTTGATACAGGCTG0.116400.011800.491400.500001.000001.00000


Target Position: 1660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1660AGCCUGGGGGACAGAAAGA73.4856412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2011678AGCCTGGGGGACAGAAAGATCTTTCTGTCCCCCAGGCT0.113500.002200.629300.500000.934800.75000


Target Position: 1285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1285UUAGCAACUCAGAGAAAAA85.595783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2071303TTAGCAACTCAGAGAAAAATTTTTCTCTGAGTTGCTAA0.058600.013600.534500.500001.000001.00000


Target Position: 1269, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1269GCCCAUCAGGGUUCUCUUA85.39985

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7126919GCCCATCAGGGTTCTCTTA1/1/0/084.80CD82NM_001024844.1+NM_002231.31+1NANANA11:44640893..44640911(+)00CD82(0.002)


Target Position: 355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
355CCGACAAGAGCAGUUUCAU80.3185205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
231373CCGACAAGAGCAGTTTCATATGAAACTGCTCTTGTCGG0.225800.001200.758601.000000.994600.62500


Target Position: 1375, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1375GGGGCAACUGUAUGAAAAA95.51094

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2137519GGGGCAACTGTATGAAAAA1/1/0/097.75CD82NM_002231.3+NM_001024844.11+1NANANA11:44640999..44641017(+)00CD82(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1261393GGGGCAACTGTATGAAAAATTTTTCATACAGTTGCCCC0.154700.011200.991401.000001.000001.00000


Target Position: 1282, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1282CUCUUAGCAACUCAGAGAA86.342770

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9128219CTCTTAGCAACTCAGAGAA1/1/0/084.17CD82NM_002231.3+NM_001024844.11+1NANANA11:44640906..44640924(+)00CD82(0.002)


Target Position: 1353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1353UCAAGGGUGUGUAUAUUGU71.8775469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1841371TCAAGGGTGTGTATATTGTACAATATACACACCCTTGA0.057600.007300.517200.500001.000001.00000


Target Position: 1662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1662CCUGGGGGACAGAAAGAGA83.612117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1981680CCTGGGGGACAGAAAGAGATCTCTTTCTGTCCCCCAGG0.120100.002200.620700.750000.945700.62500


Target Position: 378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
378GUCCUGCAAACCUCCUCCA76.8061311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
228396GTCCTGCAAACCTCCTCCATGGAGGAGGTTTGCAGGAC0.223800.066000.474100.500001.000001.00000


Target Position: 281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
281CUUUCUCUUCCUCUUCAAC69.0497600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
235299CTTTCTCTTCCTCTTCAACGTTGAAGAGGAAGAGAAAG0.580400.384200.491400.500001.000001.00000


Target Position: 1120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1120CCUCCUCCAGGCCUGCCUC57.97631119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1701138CCTCCTCCAGGCCTGCCTCGAGGCAGGCCTGGAGGAGG0.253500.018100.534500.750000.913000.62500


Target Position: 1663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1663CUGGGGGACAGAAAGAGAC64.6411801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2351681CTGGGGGACAGAAAGAGACGTCTCTTTCTGTCCCCCAG0.100500.001700.465500.500001.000001.00000


Target Position: 1510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1510AACCCCGUCUCUACUAAAA81.6897174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1461528AACCCCGTCTCTACTAAAATTTTAGTAGAGACGGGGTT0.475700.061100.646600.500001.000001.00000


Target Position: 364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
364GCAGUUUCAUCUCUGUCCU79.7558216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
200382GCAGTTTCATCTCTGTCCTAGGACAGAGATGAAACTGC0.038300.006600.508600.750000.951100.62500


Target Position: 727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
727ACAACGCUGAGCUCAUGAA85.639880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
215745ACAACGCTGAGCTCATGAATTCATGAGCTCAGCGTTGT0.026200.001900.534500.750001.000001.00000


Target Position: 295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
295UCAACUUGAUCUUCUUUAU78.4687254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
107313TCAACTTGATCTTCTTTATATAAAGAAGATCAAGTTGA0.344400.168400.681000.750001.000001.00000


Target Position: 255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
255UCAGCCUGUAUCAAAGUCA75.4035353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
226273TCAGCCTGTATCAAAGTCATGACTTTGATACAGGCTGA0.101700.009900.500000.500001.000001.00000


Target Position: 598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
598UGGGCGGCAUCGUGACUGA76.6705315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192616TGGGCGGCATCGTGACTGATCAGTCACGATGCCGCCCA0.058300.003700.620700.500001.000001.00000


Target Position: 1033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1033GCAAGGUCCCCAAGUACUG69.3634591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1571051GCAAGGTCCCCAAGTACTGCAGTACTTGGGGACCTTGC0.318500.018700.569000.750001.000001.00000


Target Position: 1595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1595GCAGGAGAAUGGUGUGAAC80.5864198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1431613GCAGGAGAATGGTGTGAACGTTCACACCATTCTCCTGC0.115500.037700.706900.750001.000001.00000


Target Position: 266, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
266CAAAGUCACCAAAUACUUU88.379339

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
264-286ATCAAAGTCACCAAATACTTTCTAAAGUAUUUGGUGACUUUGAUCAAAGUCACCAAAUACUUUCUU4.619.222


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682UCCGUCUCAAAAAAAAAAA67.1341674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1661700TCCGTCTCAAAAAAAAAAATTTTTTTTTTTGAGACGGA0.998700.005600.870700.750001.000001.00000


Target Position: 755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
755GGUCACCUACCCCUGUUCC61.9452948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
232773GGTCACCTACCCCTGTTCCGGAACAGGGGTAGGTGACC0.056400.001100.482800.500000.983700.62500


Target Position: 713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
713CUACAACUGGACAGACAAC74.9399365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181731CTACAACTGGACAGACAACGTTGTCTGTCCAGTTGTAG0.435400.114400.525900.500001.000001.00000


Target Position: 988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
988UCCUGUCCAUCUGCUUGUG57.46831140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2341006TCCTGTCCATCTGCTTGTGCACAAGCAGATGGACAGGA0.013100.001200.577600.500001.000001.00000


Target Position: 1195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1195GGGCCUAGCGAUCUCUCCU78.9765242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1641213GGGCCTAGCGATCTCTCCTAGGAGAGATCGCTAGGCCC0.073500.012100.646600.750001.000001.00000


Target Position: 120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
120GCGCGGAGCAGAAAGCAGA82.3646155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
121138GCGCGGAGCAGAAAGCAGATCTGCTTTCTGCTCCGCGC0.213000.016800.698300.750000.945700.87500


Target Position: 1594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1594GGCAGGAGAAUGGUGUGAA89.445330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1191612GGCAGGAGAATGGTGTGAATTCACACCATTCTCCTGCC0.148500.051500.827601.000001.000001.00000


Target Position: 589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
589AGCAGGAGAUGGGCGGCAU70.8222514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
222607AGCAGGAGATGGGCGGCATATGCCGCCCATCTCCTGCT0.021700.003700.698300.750001.000001.00000


Target Position: 1518, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1518CUCUACUAAAAAUACAAAA86.072974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
861536CTCTACTAAAAATACAAAATTTTGTATTTTTAGTAGAG0.916900.452300.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1516-1538GTCTCTACTAAAAATACAAAAAAUUUUGUAUUUUUAGUAGAGACCUCUACUAAAAAUACAAAAAAU6.920.100


Target Position: 1693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1693AAAAAAAAAAAAAAAAAAA83.5835121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1981711AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT1.000000.999800.500000.500001.000001.00000


Target Position: 736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736AGCUCAUGAAUCGCCCUGA76.1978333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
199754AGCTCATGAATCGCCCTGATCAGGGCGATTCATGAGCT0.038800.006100.629300.500000.929300.62500


Target Position: 1257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257CCUCUGCUCACCGCCCAUC56.03981218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2241275CCTCTGCTCACCGCCCATCGATGGGCGGTGAGCAGAGG0.018600.014500.663800.750000.923901.00000


Target Position: 503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
503GGGGCUGUACUUUGCUUUC69.4334588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
233521GGGGCTGTACTTTGCTTTCGAAAGCAAAGTACAGCCCC0.278400.001100.819000.750000.978300.87500


Target Position: 1244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1244CUGUUCUGUGGUUCCUCUG64.581806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2061262CTGTTCTGTGGTTCCTCTGCAGAGGAACCACAGAACAG0.210600.002100.500000.500001.000001.00000


Target Position: 1514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514CCGUCUCUACUAAAAAUAC76.4899320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
461532CCGTCTCTACTAAAAATACGTATTTTTAGTAGAGACGG0.585700.140500.732800.750001.000001.00000


Target Position: 1286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1286UAGCAACUCAGAGAAAAAU73.0373426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1951304TAGCAACTCAGAGAAAAATATTTTTCTCTGAGTTGCTA0.039100.010600.663800.500001.000001.00000


Target Position: 1523, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1523CUAAAAAUACAAAAAAAAU84.867693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
951541CTAAAAATACAAAAAAAATATTTTTTTTGTATTTTTAG0.722200.623300.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1521-1543TACTAAAAATACAAAAAAAATTTAUUUUUUUUGUAUUUUUAGUACUAAAAAUACAAAAAAAAUUUU-11.3-9.700


Target Position: 565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
565UCUACUUCAACAUGGGCAA72.9795427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
151583TCTACTTCAACATGGGCAATTGCCCATGTTGAAGTAGA0.618300.008100.577600.750001.000001.00000


Target Position: 1687, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1687CUCAAAAAAAAAAAAAAAA81.5223179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
741705CTCAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTGAG0.999900.985100.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1685-1707GTCTCAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUGAGACCUCAAAAAAAAAAAAAAAAAAU-11.37.700


Target Position: 1583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1583UGGGAGGCUGAGGCAGGAG52.81521333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2101601TGGGAGGCTGAGGCAGGAGCTCCTGCCTCAGCCTCCCA0.073800.001900.534500.500001.000001.00000


Target Position: 774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
774UGCGAAGUCAAGGGGGAAG50.75871415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
209792TGCGAAGTCAAGGGGGAAGCTTCCCCCTTGACTTCGCA0.028800.005400.715500.500001.000001.00000


Target Position: 1284, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1284CUUAGCAACUCAGAGAAAA85.053888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1251302CTTAGCAACTCAGAGAAAATTTTCTCTGAGTTGCTAAG0.142100.040700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1282-1304CTCTTAGCAACTCAGAGAAAAATUUUUCUCUGAGUUGCUAAGAGCUUAGCAACUCAGAGAAAAAUU19.119.722


Target Position: 886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
886AGGAGGGCUGCAUGGAGAA80.7243194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
219904AGGAGGGCTGCATGGAGAATTCTCCATGCAGCCCTCCT0.024400.001800.672400.750001.000001.00000