Input target sequence

Length: 3700
AGCCGCCGCCACCCGCCGCGCCCGACACCCGGGAGGCCCCGCCAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCCGGGCCCCGGACGCCGCGCGGAAAAGATGAATTTACAACCAATTTTCTGGATTGGACTGATCAGTTCAGTTTGCTGTGTGTTTGCTCAAACAGATGAAAATAGATGTTTAAAAGCAAATGCCAAATCATGTGGAGAATGTATACAAGCAGGGCCAAATTGTGGGTGGTGCACAAATTCAACATTTTTACAGGAAGGAATGCCTACTTCTGCACGATGTGATGATTTAGAAGCCTTAAAAAAGAAGGGTTGCCCTCCAGATGACATAGAAAATCCCAGAGGCTCCAAAGATATAAAGAAAAATAAAAATGTAACCAACCGTAGCAAAGGAACAGCAGAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAGCTAAGCTCAGGAACCCTTGCACAAGTGAACAGAACTGCACCAGCCCATTTAGCTACAAAAATGTGCTCAGTCTTACTAATAAAGGAGAAGTATTTAATGAACTTGTTGGAAAACAGCGCATATCTGGAAATTTGGATTCTCCAGAAGGTGGTTTCGATGCCATCATGCAAGTTGCAGTTTGTGGATCACTGATTGGCTGGAGGAATGTTACACGGCTGCTGGTGTTTTCCACAGATGCCGGGTTTCACTTTGCTGGAGATGGGAAACTTGGTGGCATTGTTTTACCAAATGATGGACAATGTCACCTGGAAAATAATATGTACACAATGAGCCATTATTATGATTATCCTTCTATTGCTCACCTTGTCCAGAAACTGAGTGAAAATAATATTCAGACAATTTTTGCAGTTACTGAAGAATTTCAGCCTGTTTACAAGGAGCTGAAAAACTTGATCCCTAAGTCAGCAGTAGGAACATTATCTGCAAATTCTAGCAATGTAATTCAGTTGATCATTGATGCATACAATTCCCTTTCCTCAGAAGTCATTTTGGAAAACGGCAAATTGTCAGAAGGAGTAACAATAAGTTACAAATCTTACTGCAAGAACGGGGTGAATGGAACAGGGGAAAATGGAAGAAAATGTTCCAATATTTCCATTGGAGATGAGGTTCAATTTGAAATTAGCATAACTTCAAATAAGTGTCCAAAAAAGGATTCTGACAGCTTTAAAATTAGGCCTCTGGGCTTTACGGAGGAAGTAGAGGTTATTCTTCAGTACATCTGTGAATGTGAATGCCAAAGCGAAGGCATCCCTGAAAGTCCCAAGTGTCATGAAGGAAATGGGACATTTGAGTGTGGCGCGTGCAGGTGCAATGAAGGGCGTGTTGGTAGACATTGTGAATGCAGCACAGATGAAGTTAACAGTGAAGACATGGATGCTTACTGCAGGAAAGAAAACAGTTCAGAAATCTGCAGTAACAATGGAGAGTGCGTCTGCGGACAGTGTGTTTGTAGGAAGAGGGATAATACAAATGAAATTTATTCTGGCAAATTCTGCGAGTGTGATAATTTCAACTGTGATAGATCCAATGGCTTAATTTGTGGAGGAAATGGTGTTTGCAAGTGTCGTGTGTGTGAGTGCAACCCCAACTACACTGGCAGTGCATGTGACTGTTCTTTGGATACTAGTACTTGTGAAGCCAGCAACGGACAGATCTGCAATGGCCGGGGCATCTGCGAGTGTGGTGTCTGTAAGTGTACAGATCCGAAGTTTCAAGGGCAAACGTGTGAGATGTGTCAGACCTGCCTTGGTGTCTGTGCTGAGCATAAAGAATGTGTTCAGTGCAGAGCCTTCAATAAAGGAGAAAAGAAAGACACATGCACACAGGAATGTTCCTATTTTAACATTACCAAGGTAGAAAGTCGGGACAAATTACCCCAGCCGGTCCAACCTGATCCTGTGTCCCATTGTAAGGAGAAGGATGTTGACGACTGTTGGTTCTATTTTACGTATTCAGTGAATGGGAACAACGAGGTCATGGTTCATGTTGTGGAGAATCCAGAGTGTCCCACTGGTCCAGACATCATTCCAATTGTAGCTGGTGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAAAGTAGCAATTTCCATAGTCACAGTTAGGTAGCTTTAGGGCAATATTGCCATGGTTTTACTCATGTGCAGGTTTTGAAAATGTACAATATGTATAATTTTTAAAATGTTTTATTATTTTGAAAATAATGTTGTAATTCATGCCAGGGACTGACAAAAGACTTGAGACAGGATGGTTATTCTTGTCAGCTAAGGTCACATTGTGCCTTTTTGACCTTTTCTTCCTGGACTATTGAAATCAAGCTTATTGGATTAAGTGATATTTCTATAGCGATTGAAAGGGCAATAGTTAAAGTAATGAGCATGATGAGAGTTTCTGTTAATCATGTATTAAAACTGATTTTTAGCTTTACAAATATGTCAGTTTGCAGTTATGCAGAATCCAAAGTAAATGTCCTGCTAGCTAGTTAAGGATTGTTTTAAATCTGTTATTTTGCTATTTGCCTGTTAGACATGACTGATGACATATCTGAAAGACAAGTATGTTGAGAGTTGCTGGTGTAAAATACGTTTGAAATAGTTGATCTACAAAGGCCATGGGAAAAATTCAGAGAGTTAGGAAGGAAAAACCAATAGCTTTAAAACCTGTGTGCCATTTTAAGAGTTACTTAATGTTTGGTAACTTTTATGCCTTCACTTTACAAATTCAAGCCTTAGATAAAAGAACCGAGCAATTTTCTGCTAAAAAGTCCTTGATTTAGCACTATTTACATACAGGCCATACTTTACAAAGTATTTGCTGAATGGGGACCTTTTGAGTTGAATTTATTTTATTATTTTTATTTTGTTTAATGTCTGGTGCTTTCTATCACCTCTTCTAATCTTTTAATGTATTTGTTTGCAATTTTGGGGTAAGACTTTTTTATGAGTACTTTTTCTTTGAAGTTTTAGCGGTCAATTTGCCTTTTTAATGAACATGTGAAGTTATACTGTGGCTATGCAACAGCTCTCACCTACGCGAGTCTTACTTTGAGTTAGTGCCATAACAGACCACTGTATGTTTACTTCTCACCATTTGAGTTGCCCATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTGCTATTTACTGAAGTTATTTATTAAATATGCCTAAAATACTTAAATCGGA