siDirect version 2.0 result page. Help

2017-07-11 23:23:05, siDirect v.2.0

Query

Query name:
Query sequence: 2834 bp
Functional siRNA selection: Ui-Tei
Seed-duplex stability - Max Tm: 21.5°C
Specificity check: Homo sapiens non-redundant database

Effective siRNA candidates

target
position
target sequence
21nt target + 2nt overhang
RNA oligo sequences
21nt guide (5′→3′)
21nt passenger (5′→3′)
functional
siRNA
selection:
Ui-Tei
seed-duplex
stabilty (Tm);
specificity check:
minimum number of
mismatches against
any off-targets;
guidepassenger guidepassenger
156-178 CTGCATGAAGTCTGTAACTGAGC UCAGUUACAGACUUCAUGCAG
GCAUGAAGUCUGUAACUGAGC
U    19.0 °C 18.1 °C 1 [detail]2 [detail]
320-342 CTCGAGAATACAGAGAGAAAATT UUUUCUCUCUGUAUUCUCGAG
CGAGAAUACAGAGAGAAAAUU
U    19.1 °C 16.0 °C 1 [detail]2 [detail]
321-343 TCGAGAATACAGAGAGAAAATTG AUUUUCUCUCUGUAUUCUCGA
GAGAAUACAGAGAGAAAAUUG
U    14.8 °C 14.5 °C 1 [detail]2 [detail]
354-376 AAGAGATATCTGCAATGATGTAC ACAUCAUUGCAGAUAUCUCUU
GAGAUAUCUGCAAUGAUGUAC
U    13.6 °C 15.9 °C 1 [detail]2 [detail]
378-400 GTCTCTTTTGGAAAAGTTCTTGA AAGAACUUUUCCAAAAGAGAC
CUCUUUUGGAAAAGUUCUUGA
U    17.7 °C 12.2 °C 0 [detail]2 [detail]
380-402 CTCTTTTGGAAAAGTTCTTGATC UCAAGAACUUUUCCAAAAGAG
CUUUUGGAAAAGUUCUUGAUC
U    19.2 °C 20.1 °C 0 [detail]2 [detail]
423-445 GAGCAAAGTCTTCTATTTGAAAA UUCAAAUAGAAGACUUUGCUC
GCAAAGUCUUCUAUUUGAAAA
U    8.9 °C 19.2 °C 0 [detail]2 [detail]
424-446 AGCAAAGTCTTCTATTTGAAAAT UUUCAAAUAGAAGACUUUGCU
CAAAGUCUUCUAUUUGAAAAU
U    7.4 °C 17.7 °C 0 [detail]2 [detail]
428-450 AAGTCTTCTATTTGAAAATGAAA UCAUUUUCAAAUAGAAGACUU
GUCUUCUAUUUGAAAAUGAAA
U    7.4 °C 20.2 °C 0 [detail]2 [detail]
430-452 GTCTTCTATTTGAAAATGAAAGG UUUCAUUUUCAAAUAGAAGAC
CUUCUAUUUGAAAAUGAAAGG
U    7.4 °C 6.9 °C 0 [detail]2 [detail]
450-472 AGGAGATTACTACCGTTACTTGG AAGUAACGGUAGUAAUCUCCU
GAGAUUACUACCGUUACUUGG
U    19.6 °C 14.5 °C 0 [detail]3 [detail]
525-547 AGCATACCAAGAAGCTTTTGAAA UCAAAAGCUUCUUGGUAUGCU
CAUACCAAGAAGCUUUUGAAA
U    18.6 °C 20.0 °C 0 [detail]3 [detail]
537-559 AGCTTTTGAAATCAGCAAAAAGG UUUUUGCUGAUUUCAAAAGCU
CUUUUGAAAUCAGCAAAAAGG
U    18.6 °C 7.7 °C 0 [detail]2 [detail]
542-564 TTGAAATCAGCAAAAAGGAAATG UUUCCUUUUUGCUGAUUUCAA
GAAAUCAGCAAAAAGGAAAUG
U    18.7 °C 12.0 °C 0 [detail]1 [detail]
547-569 ATCAGCAAAAAGGAAATGCAACC UUGCAUUUCCUUUUUGCUGAU
CAGCAAAAAGGAAAUGCAACC
U    20.0 °C 18.6 °C 0 [detail]2 [detail]
657-679 TGCAAAGACAGCTTTTGATGAAG UCAUCAAAAGCUGUCUUUGCA
CAAAGACAGCUUUUGAUGAAG
U    13.8 °C 19.2 °C 0 [detail]2 [detail]
715-737 TACAAAGACAGCACGCTAATAAT UAUUAGCGUGCUGUCUUUGUA
CAAAGACAGCACGCUAAUAAU
U    20.4 °C 19.2 °C 1 [detail]3 [detail]
726-748 CACGCTAATAATGCAATTACTGA AGUAAUUGCAUUAUUAGCGUG
CGCUAAUAAUGCAAUUACUGA
U    6.9 °C 14.9 °C 1 [detail]2 [detail]
728-750 CGCTAATAATGCAATTACTGAGA UCAGUAAUUGCAUUAUUAGCG
CUAAUAAUGCAAUUACUGAGA
U    11.6 °C -8.0 °C 0 [detail]2 [detail]
833-855 AACTTTTGTCTGCCTCATTCTAA AGAAUGAGGCAGACAAAAGUU
CUUUUGUCUGCCUCAUUCUAA
U    20.4 °C 14.9 °C 1 [detail]1 [detail]
843-865 TGCCTCATTCTAAAATTTACACA UGUAAAUUUUAGAAUGAGGCA
CCUCAUUCUAAAAUUUACACA
U    -0.3 °C 20.4 °C 0 [detail]2 [detail]
890-912 TCCCACAAATAGTTTTTTGTTTA AACAAAAAACUAUUUGUGGGA
CCACAAAUAGUUUUUUGUUUA
U    5.6 °C 12.1 °C 0 [detail]2 [detail]
891-913 CCCACAAATAGTTTTTTGTTTAC AAACAAAAAACUAUUUGUGGG
CACAAAUAGUUUUUUGUUUAC
U    5.6 °C 6.9 °C 0 [detail]2 [detail]
899-921 TAGTTTTTTGTTTACGATTTATG UAAAUCGUAAACAAAAAACUA
GUUUUUUGUUUACGAUUUAUG
U    15.2 °C -2.9 °C 1 [detail]2 [detail]
911-933 TACGATTTATGACAGGTTTATGT AUAAACCUGUCAUAAAUCGUA
CGAUUUAUGACAGGUUUAUGU
U    18.6 °C 1.8 °C 1 [detail]3 [detail]
921-943 GACAGGTTTATGTTACTTCTATT UAGAAGUAACAUAAACCUGUC
CAGGUUUAUGUUACUUCUAUU
U    18.9 °C 18.6 °C 1 [detail]2 [detail]
923-945 CAGGTTTATGTTACTTCTATTTG AAUAGAAGUAACAUAAACCUG
GGUUUAUGUUACUUCUAUUUG
U    11.6 °C 6.9 °C 0 [detail]3 [detail]
924-946 AGGTTTATGTTACTTCTATTTGA AAAUAGAAGUAACAUAAACCU
GUUUAUGUUACUUCUAUUUGA
U    6.9 °C 6.9 °C 0 [detail]3 [detail]
930-952 ATGTTACTTCTATTTGAATTTCT AAAUUCAAAUAGAAGUAACAU
GUUACUUCUAUUUGAAUUUCU
U    7.4 °C 14.6 °C 1 [detail]2 [detail]
934-956 TACTTCTATTTGAATTTCTATAT AUAGAAAUUCAAAUAGAAGUA
CUUCUAUUUGAAUUUCUAUAU
U    6.9 °C 6.9 °C 1 [detail]1 [detail]
937-959 TTCTATTTGAATTTCTATATTTC AAUAUAGAAAUUCAAAUAGAA
CUAUUUGAAUUUCUAUAUUUC
U    8.2 °C 8.9 °C 1 [detail]2 [detail]
962-984 ATGTGGTTTTTATGTTTAATATT UAUUAAACAUAAAAACCACAU
GUGGUUUUUAUGUUUAAUAUU
U    -0.3 °C 18.8 °C 2 [detail]2 [detail]
964-986 GTGGTTTTTATGTTTAATATTAG AAUAUUAAACAUAAAAACCAC
GGUUUUUAUGUUUAAUAUUAG
U    -8.0 °C 0.0 °C 2 [detail]2 [detail]
965-987 TGGTTTTTATGTTTAATATTAGG UAAUAUUAAACAUAAAAACCA
GUUUUUAUGUUUAAUAUUAGG
U    -8.0 °C -9.7 °C 1 [detail]2 [detail]
1003-1025 AACATTTAGGGAGTTATCTGTTT ACAGAUAACUCCCUAAAUGUU
CAUUUAGGGAGUUAUCUGUUU
U    13.4 °C 10.9 °C 1 [detail]2 [detail]
1011-1033 GGGAGTTATCTGTTTTCATCTTG AGAUGAAAACAGAUAACUCCC
GAGUUAUCUGUUUUCAUCUUG
U    16.3 °C 14.5 °C 1 [detail]2 [detail]
1051-1073 ATGTGGAATTTTTATACAAGTTA ACUUGUAUAAAAAUUCCACAU
GUGGAAUUUUUAUACAAGUUA
U    11.6 °C 20.1 °C 2 [detail]2 [detail]
1053-1075 GTGGAATTTTTATACAAGTTATA UAACUUGUAUAAAAAUUCCAC
GGAAUUUUUAUACAAGUUAUA
U    17.8 °C 0.4 °C 1 [detail]2 [detail]
1054-1076 TGGAATTTTTATACAAGTTATAA AUAACUUGUAUAAAAAUUCCA
GAAUUUUUAUACAAGUUAUAA
U    11.8 °C -12.0 °C 1 [detail]2 [detail]
1096-1118 TGGTACATTGTGGCTTCAAAAGG UUUUGAAGCCACAAUGUACCA
GUACAUUGUGGCUUCAAAAGG
U    12.2 °C 13.5 °C 1 [detail]2 [detail]
1136-1158 TCCATGTCTAAGCAAAGAAAACT UUUUCUUUGCUUAGACAUGGA
CAUGUCUAAGCAAAGAAAACU
U    5.5 °C 20.3 °C 0 [detail]2 [detail]
1220-1242 TAGTAATTGTGGGTACTTTAAGG UUAAAGUACCCACAAUUACUA
GUAAUUGUGGGUACUUUAAGG
U    6.6 °C 6.9 °C 1 [detail]3 [detail]
1278-1300 CCCATGGATACCACATATTAAAC UUAAUAUGUGGUAUCCAUGGG
CAUGGAUACCACAUAUUAAAC
U    0.0 °C 21.2 °C 1 [detail]3 [detail]
1289-1311 CACATATTAAACCATGTATATCT AUAUACAUGGUUUAAUAUGUG
CAUAUUAAACCAUGUAUAUCU
U    8.2 °C -8.0 °C 1 [detail]2 [detail]
1310-1332 CTGTGGAATACTCAATGTGTACA UACACAUUGAGUAUUCCACAG
GUGGAAUACUCAAUGUGUACA
U    19.3 °C 21.2 °C 2 [detail]3 [detail]
1349-1371 CAGAAGTGTTCCTTTAGACAAAG UUGUCUAAAGGAACACUUCUG
GAAGUGUUCCUUUAGACAAAG
U    20.3 °C 17.8 °C 1 [detail]2 [detail]
1436-1458 CTGCTGTTAGCTTTCATTATTTT AAUAAUGAAAGCUAACAGCAG
GCUGUUAGCUUUCAUUAUUUU
U    8.7 °C 16.4 °C 1 [detail]2 [detail]
1439-1461 CTGTTAGCTTTCATTATTTTTGC AAAAAUAAUGAAAGCUAACAG
GUUAGCUUUCAUUAUUUUUGC
U    -9.7 °C 18.3 °C 1 [detail]2 [detail]
1443-1465 TAGCTTTCATTATTTTTGCTACA UAGCAAAAAUAAUGAAAGCUA
GCUUUCAUUAUUUUUGCUACA
U    18.6 °C 12.0 °C 1 [detail]2 [detail]
1462-1484 TACACTCATTTTATTTGTATTTA AAUACAAAUAAAAUGAGUGUA
CACUCAUUUUAUUUGUAUUUA
U    6.9 °C 19.2 °C 0 [detail]2 [detail]
1464-1486 CACTCATTTTATTTGTATTTAAA UAAAUACAAAUAAAAUGAGUG
CUCAUUUUAUUUGUAUUUAAA
U    6.9 °C 7.4 °C 0 [detail]2 [detail]
1466-1488 CTCATTTTATTTGTATTTAAATG UUUAAAUACAAAUAAAAUGAG
CAUUUUAUUUGUAUUUAAAUG
U    -7.5 °C -10.3 °C 0 [detail]1 [detail]
1494-1516 GGCAACCTAAGAACAAATGTAAA UACAUUUGUUCUUAGGUUGCC
CAACCUAAGAACAAAUGUAAA
U    12.1 °C 18.6 °C 0 [detail]2 [detail]
1497-1519 AACCTAAGAACAAATGTAAAAGT UUUUACAUUUGUUCUUAGGUU
CCUAAGAACAAAUGUAAAAGU
U    6.9 °C 11.7 °C 0 [detail]2 [detail]
1502-1524 AAGAACAAATGTAAAAGTAAAGA UUUACUUUUACAUUUGUUCUU
GAACAAAUGUAAAAGUAAAGA
U    4.9 °C 5.3 °C 0 [detail]2 [detail]
1505-1527 AACAAATGTAAAAGTAAAGATGC AUCUUUACUUUUACAUUUGUU
CAAAUGUAAAAGUAAAGAUGC
U    14.6 °C 6.9 °C 0 [detail]1 [detail]
1516-1538 AAGTAAAGATGCAGGAAAAATGA AUUUUUCCUGCAUCUUUACUU
GUAAAGAUGCAGGAAAAAUGA
U    14.3 °C 6.9 °C 1 [detail]2 [detail]
1525-1547 TGCAGGAAAAATGAATTGCTTGG AAGCAAUUCAUUUUUCCUGCA
CAGGAAAAAUGAAUUGCUUGG
U    18.5 °C 18.7 °C 1 [detail]1 [detail]
1535-1557 ATGAATTGCTTGGTATTCATTAC AAUGAAUACCAAGCAAUUCAU
GAAUUGCUUGGUAUUCAUUAC
U    8.7 °C 18.5 °C 1 [detail]3 [detail]
1541-1563 TGCTTGGTATTCATTACTTCATG UGAAGUAAUGAAUACCAAGCA
CUUGGUAUUCAUUACUUCAUG
U    14.6 °C 20.0 °C 1 [detail]1 [detail]
1544-1566 TTGGTATTCATTACTTCATGTAT ACAUGAAGUAAUGAAUACCAA
GGUAUUCAUUACUUCAUGUAU
U    18.1 °C 16.1 °C 1 [detail]2 [detail]
1545-1567 TGGTATTCATTACTTCATGTATA UACAUGAAGUAAUGAAUACCA
GUAUUCAUUACUUCAUGUAUA
U    20.5 °C 8.7 °C 1 [detail]2 [detail]
1550-1572 TTCATTACTTCATGTATATCAAG UGAUAUACAUGAAGUAAUGAA
CAUUACUUCAUGUAUAUCAAG
U    11.2 °C 4.6 °C 1 [detail]2 [detail]
1584-1606 AACAAAAACCCATGTATTTAACT UUAAAUACAUGGGUUUUUGUU
CAAAAACCCAUGUAUUUAACU
U    1.4 °C 12.6 °C 0 [detail]2 [detail]
1591-1613 ACCCATGTATTTAACTTTTTTTT AAAAAAGUUAAAUACAUGGGU
CCAUGUAUUUAACUUUUUUUU
U    3.2 °C 13.3 °C 0 [detail]2 [detail]
1592-1614 CCCATGTATTTAACTTTTTTTTA AAAAAAAGUUAAAUACAUGGG
CAUGUAUUUAACUUUUUUUUA
U    -5.9 °C 6.7 °C 0 [detail]2 [detail]
1613-1635 TAGGATTTTTGCTTTTGTGATTT AUCACAAAAGCAAAAAUCCUA
GGAUUUUUGCUUUUGUGAUUU
U    20.5 °C 0.4 °C 1 [detail]2 [detail]
1614-1636 AGGATTTTTGCTTTTGTGATTTT AAUCACAAAAGCAAAAAUCCU
GAUUUUUGCUUUUGUGAUUUU
U    20.5 °C -3.3 °C 1 [detail]2 [detail]
1621-1643 TTGCTTTTGTGATTTTTTTTTTT AAAAAAAAAUCACAAAAGCAA
GCUUUUGUGAUUUUUUUUUUU
U    -11.3 °C 10.3 °C 0 [detail]1 [detail]
1622-1644 TGCTTTTGTGATTTTTTTTTTTT AAAAAAAAAAUCACAAAAGCA
CUUUUGUGAUUUUUUUUUUUU
U    -11.3 °C 12.2 °C 1 [detail]0 [detail]
1627-1649 TTGTGATTTTTTTTTTTTTTTTT AAAAAAAAAAAAAAAUCACAA
GUGAUUUUUUUUUUUUUUUUU
U    -11.3 °C 7.4 °C 0 [detail]0 [detail]
1629-1651 GTGATTTTTTTTTTTTTTTTTTG AAAAAAAAAAAAAAAAAUCAC
GAUUUUUUUUUUUUUUUUUUG
U    -11.3 °C -12.0 °C 0 [detail]0 [detail]
1671-1693 GTGCTGTAAAAATAGTTAACAGG UGUUAACUAUUUUUACAGCAC
GCUGUAAAAAUAGUUAACAGG
U    12.9 °C 11.8 °C 0 [detail]2 [detail]
1683-1705 TAGTTAACAGGGAAATAACTTGA AAGUUAUUUCCCUGUUAACUA
GUUAACAGGGAAAUAACUUGA
U    4.6 °C 11.8 °C 0 [detail]2 [detail]
1712-1734 GGCTAGCTTTGTTTAATGTCTTA AGACAUUAAACAAAGCUAGCC
CUAGCUUUGUUUAAUGUCUUA
U    16.1 °C 18.3 °C 0 [detail]3 [detail]
1715-1737 TAGCTTTGTTTAATGTCTTATGA AUAAGACAUUAAACAAAGCUA
GCUUUGUUUAAUGUCUUAUGA
U    20.3 °C 10.3 °C 0 [detail]3 [detail]
1720-1742 TTGTTTAATGTCTTATGAAATTT AUUUCAUAAGACAUUAAACAA
GUUUAAUGUCUUAUGAAAUUU
U    8.9 °C -1.4 °C 0 [detail]2 [detail]
1745-1767 ATGAACAATCCAAGCATAATTGT AAUUAUGCUUGGAUUGUUCAU
GAACAAUCCAAGCAUAAUUGU
U    15.2 °C 14.8 °C 0 [detail]3 [detail]
1748-1770 AACAATCCAAGCATAATTGTTAA AACAAUUAUGCUUGGAUUGUU
CAAUCCAAGCAUAAUUGUUAA
U    6.9 °C 20.1 °C 0 [detail]2 [detail]
1753-1775 TCCAAGCATAATTGTTAAGAACA UUCUUAACAAUUAUGCUUGGA
CAAGCAUAAUUGUUAAGAACA
U    14.6 °C 19.7 °C 0 [detail]3 [detail]
1764-1786 TTGTTAAGAACACGTGTATTAAA UAAUACACGUGUUCUUAACAA
GUUAAGAACACGUGUAUUAAA
U    14.6 °C 7.1 °C 0 [detail]1 [detail]
1774-1796 CACGTGTATTAAATTCATGTAAG UACAUGAAUUUAAUACACGUG
CGUGUAUUAAAUUCAUGUAAG
U    20.5 °C 14.6 °C 0 [detail]2 [detail]
1775-1797 ACGTGTATTAAATTCATGTAAGT UUACAUGAAUUUAAUACACGU
GUGUAUUAAAUUCAUGUAAGU
U    21.5 °C 8.5 °C 0 [detail]2 [detail]
1777-1799 GTGTATTAAATTCATGTAAGTGG ACUUACAUGAAUUUAAUACAC
GUAUUAAAUUCAUGUAAGUGG
U    11.6 °C -7.5 °C 0 [detail]3 [detail]
1796-1818 GTGGAATAAAAGTTTTATGAATG UUCAUAAAACUUUUAUUCCAC
GGAAUAAAAGUUUUAUGAAUG
U    8.9 °C 2.1 °C 0 [detail]2 [detail]
1797-1819 TGGAATAAAAGTTTTATGAATGG AUUCAUAAAACUUUUAUUCCA
GAAUAAAAGUUUUAUGAAUGG
U    8.9 °C -9.7 °C 0 [detail]1 [detail]
1817-1839 TGGACTTTTCAACTACTTTCTCT AGAAAGUAGUUGAAAAGUCCA
GACUUUUCAACUACUUUCUCU
U    14.6 °C 13.3 °C 0 [detail]2 [detail]
1819-1841 GACTTTTCAACTACTTTCTCTAC AGAGAAAGUAGUUGAAAAGUC
CUUUUCAACUACUUUCUCUAC
U    19.1 °C 7.7 °C 0 [detail]2 [detail]
1830-1852 TACTTTCTCTACAGCTTTTCATG UGAAAAGCUGUAGAGAAAGUA
CUUUCUCUACAGCUUUUCAUG
U    21.0 °C 19.1 °C 0 [detail]1 [detail]
1839-1861 TACAGCTTTTCATGTAAATTAGT UAAUUUACAUGAAAAGCUGUA
CAGCUUUUCAUGUAAAUUAGU
U    -0.3 °C 17.0 °C 0 [detail]2 [detail]
1841-1863 CAGCTTTTCATGTAAATTAGTCT ACUAAUUUACAUGAAAAGCUG
GCUUUUCAUGUAAAUUAGUCU
U    -4.3 °C 12.2 °C 0 [detail]2 [detail]
1864-1886 TGGTTCTGAAACTTCTCTAAAGG UUUAGAGAAGUUUCAGAACCA
GUUCUGAAACUUCUCUAAAGG
U    20.2 °C 20.4 °C 0 [detail]1 [detail]
1867-1889 TTCTGAAACTTCTCTAAAGGAAA UCCUUUAGAGAAGUUUCAGAA
CUGAAACUUCUCUAAAGGAAA
U    15.8 °C 19.2 °C 0 [detail]2 [detail]
1869-1891 CTGAAACTTCTCTAAAGGAAATT UUUCCUUUAGAGAAGUUUCAG
GAAACUUCUCUAAAGGAAAUU
U    18.7 °C 13.3 °C 0 [detail]2 [detail]
1873-1895 AACTTCTCTAAAGGAAATTGTAC ACAAUUUCCUUUAGAGAAGUU
CUUCUCUAAAGGAAAUUGUAC
U    7.4 °C 20.2 °C 0 [detail]2 [detail]
1876-1898 TTCTCTAAAGGAAATTGTACATT UGUACAAUUUCCUUUAGAGAA
CUCUAAAGGAAAUUGUACAUU
U    14.6 °C 11.7 °C 0 [detail]2 [detail]
1878-1900 CTCTAAAGGAAATTGTACATTTT AAUGUACAAUUUCCUUUAGAG
CUAAAGGAAAUUGUACAUUUU
U    20.4 °C 19.9 °C 0 [detail]2 [detail]
1884-1906 AGGAAATTGTACATTTTTTGAAA UCAAAAAAUGUACAAUUUCCU
GAAAUUGUACAUUUUUUGAAA
U    -2.9 °C 5.3 °C 1 [detail]2 [detail]
1890-1912 TTGTACATTTTTTGAAATTTATT UAAAUUUCAAAAAAUGUACAA
GUACAUUUUUUGAAAUUUAUU
U    0.4 °C 6.9 °C 2 [detail]1 [detail]
1940-1962 CTCTTACCAAGTTTAAACACAAA UGUGUUUAAACUUGGUAAGAG
CUUACCAAGUUUAAACACAAA
U    14.7 °C 20.0 °C 1 [detail]3 [detail]
1944-1966 TACCAAGTTTAAACACAAAATTT AUUUUGUGUUUAAACUUGGUA
CCAAGUUUAAACACAAAAUUU
U    12.2 °C 10.3 °C 1 [detail]1 [detail]
1945-1967 ACCAAGTTTAAACACAAAATTTA AAUUUUGUGUUUAAACUUGGU
CAAGUUUAAACACAAAAUUUA
U    5.3 °C 4.9 °C 1 [detail]2 [detail]
1948-1970 AAGTTTAAACACAAAATTTATCA AUAAAUUUUGUGUUUAAACUU
GUUUAAACACAAAAUUUAUCA
U    -9.7 °C 0.0 °C 1 [detail]2 [detail]
1955-1977 AACACAAAATTTATCATAACAAA UGUUAUGAUAAAUUUUGUGUU
CACAAAAUUUAUCAUAACAAA
U    16.1 °C 5.3 °C 1 [detail]2 [detail]
1957-1979 CACAAAATTTATCATAACAAAAA UUUGUUAUGAUAAAUUUUGUG
CAAAAUUUAUCAUAACAAAAA
U    6.9 °C -12.0 °C 1 [detail]2 [detail]
1967-1989 ATCATAACAAAAATACTACTAAT UAGUAGUAUUUUUGUUAUGAU
CAUAACAAAAAUACUACUAAU
U    18.8 °C 6.9 °C 2 [detail]2 [detail]
1972-1994 AACAAAAATACTACTAATATAAC UAUAUUAGUAGUAUUUUUGUU
CAAAAAUACUACUAAUAUAAC
U    -2.7 °C -9.7 °C 0 [detail]1 [detail]
2074-2096 GGGGATTGATTAGAAAAAAATGT AUUUUUUUCUAAUCAAUCCCC
GGAUUGAUUAGAAAAAAAUGU
U    -11.3 °C 16.2 °C 1 [detail]2 [detail]
2079-2101 TTGATTAGAAAAAAATGTAGTGT ACUACAUUUUUUUCUAAUCAA
GAUUAGAAAAAAAUGUAGUGU
U    11.6 °C 6.9 °C 1 [detail]1 [detail]
2117-2139 TTGGCATATGGCATTTTCTAACT UUAGAAAAUGCCAUAUGCCAA
GGCAUAUGGCAUUUUCUAACU
U    7.1 °C 21.1 °C 0 [detail]3 [detail]
2136-2158 AACTTAGGAAGCCACAATGTTCT AACAUUGUGGCUUCCUAAGUU
CUUAGGAAGCCACAAUGUUCU
U    19.3 °C 19.9 °C 0 [detail]3 [detail]
2176-2198 GGGTAGCATTAACTGTAAGTTTT AACUUACAGUUAAUGCUACCC
GUAGCAUUAACUGUAAGUUUU
U    19.0 °C 19.7 °C 0 [detail]3 [detail]
2180-2202 AGCATTAACTGTAAGTTTTGTGC ACAAAACUUACAGUUAAUGCU
CAUUAACUGUAAGUUUUGUGC
U    10.3 °C 4.6 °C 0 [detail]2 [detail]
2192-2214 AAGTTTTGTGCTTCCAAATCACT UGAUUUGGAAGCACAAAACUU
GUUUUGUGCUUCCAAAUCACU
U    20.1 °C 12.2 °C 0 [detail]2 [detail]
2203-2225 TTCCAAATCACTTTTTGGTTTTT AAACCAAAAAGUGAUUUGGAA
CCAAAUCACUUUUUGGUUUUU
U    18.8 °C 13.8 °C 0 [detail]2 [detail]
2204-2226 TCCAAATCACTTTTTGGTTTTTA AAAACCAAAAAGUGAUUUGGA
CAAAUCACUUUUUGGUUUUUA
U    18.8 °C 14.8 °C 0 [detail]2 [detail]
2209-2231 ATCACTTTTTGGTTTTTAAGAAT UCUUAAAAACCAAAAAGUGAU
CACUUUUUGGUUUUUAAGAAU
U    -3.8 °C 3.2 °C 0 [detail]2 [detail]
2211-2233 CACTTTTTGGTTTTTAAGAATTT AUUCUUAAAAACCAAAAAGUG
CUUUUUGGUUUUUAAGAAUUU
U    7.1 °C 11.5 °C 0 [detail]2 [detail]
2218-2240 TGGTTTTTAAGAATTTCTTGATA UCAAGAAAUUCUUAAAAACCA
GUUUUUAAGAAUUUCUUGAUA
U    12.2 °C -9.1 °C 0 [detail]1 [detail]
2226-2248 AAGAATTTCTTGATACTCTTATA UAAGAGUAUCAAGAAAUUCUU
GAAUUUCUUGAUACUCUUAUA
U    18.9 °C 5.3 °C 0 [detail]2 [detail]
2253-2275 GCCTTCAATTTTGATCCTTTATT UAAAGGAUCAAAAUUGAAGGC
CUUCAAUUUUGAUCCUUUAUU
U    18.7 °C 7.4 °C 1 [detail]2 [detail]
2263-2285 TTGATCCTTTATTCTTTCTATTT AUAGAAAGAAUAAAGGAUCAA
GAUCCUUUAUUCUUUCUAUUU
U    11.7 °C 18.7 °C 0 [detail]1 [detail]
2267-2289 TCCTTTATTCTTTCTATTTGTCA ACAAAUAGAAAGAAUAAAGGA
CUUUAUUCUUUCUAUUUGUCA
U    3.5 °C 2.1 °C 0 [detail]2 [detail]
2438-2460 GACTATTTCCCTCATCCTATTTA AAUAGGAUGAGGGAAAUAGUC
CUAUUUCCCUCAUCCUAUUUA
U    19.9 °C 15.5 °C 0 [detail]3 [detail]
2465-2487 AGCAAATCTCTCCTTAGTTGATG UCAACUAAGGAGAGAUUUGCU
CAAAUCUCUCCUUAGUUGAUG
U    11.8 °C 14.8 °C 0 [detail]2 [detail]
2491-2513 CTGTGTTTATCTCCCTTTAAAAC UUUAAAGGGAGAUAAACACAG
GUGUUUAUCUCCCUUUAAAAC
U    11.0 °C 6.9 °C 0 [detail]2 [detail]
2533-2555 CTGTCATTGTCTGCCTTTAAAAT UUUAAAGGCAGACAAUGACAG
GUCAUUGUCUGCCUUUAAAAU
U    11.0 °C 20.5 °C 0 [detail]2 [detail]
2535-2557 GTCATTGTCTGCCTTTAAAATCC AUUUUAAAGGCAGACAAUGAC
CAUUGUCUGCCUUUAAAAUCC
U    -9.1 °C 19.2 °C 0 [detail]2 [detail]
2571-2593 CTCCTCTATTCTCTAAATAATGA AUUAUUUAGAGAAUAGAGGAG
CCUCUAUUCUCUAAAUAAUGA
U    -7.5 °C 11.6 °C 0 [detail]3 [detail]
2574-2596 CTCTATTCTCTAAATAATGATGG AUCAUUAUUUAGAGAAUAGAG
CUAUUCUCUAAAUAAUGAUGG
U    8.7 °C 16.0 °C 0 [detail]3 [detail]
2614-2636 AGCTCACTTTACAAAATATTTCC AAAUAUUUUGUAAAGUGAGCU
CUCACUUUACAAAAUAUUUCC
U    -10.3 °C 19.2 °C 0 [detail]2 [detail]
2636-2658 CTCAGTACTTTGCAGAAAACACC UGUUUUCUGCAAAGUACUGAG
CAGUACUUUGCAGAAAACACC
U    13.3 °C 17.6 °C 0 [detail]3 [detail]
2645-2667 TTGCAGAAAACACCAAACAAAAA UUUGUUUGGUGUUUUCUGCAA
GCAGAAAACACCAAACAAAAA
U    12.2 °C 12.2 °C 0 [detail]2 [detail]
2646-2668 TGCAGAAAACACCAAACAAAAAT UUUUGUUUGGUGUUUUCUGCA
CAGAAAACACCAAACAAAAAU
U    5.6 °C 13.3 °C 0 [detail]1 [detail]
2648-2670 CAGAAAACACCAAACAAAAATGC AUUUUUGUUUGGUGUUUUCUG
GAAAACACCAAACAAAAAUGC
U    5.6 °C 13.3 °C 0 [detail]1 [detail]
2660-2682 AACAAAAATGCCATTTTAAAAAA UUUUAAAAUGGCAUUUUUGUU
CAAAAAUGCCAUUUUAAAAAA
U    -9.1 °C -3.3 °C 0 [detail]1 [detail]
2682-2704 AGGTGTATTTTTTCTTTTAGAAT UCUAAAAGAAAAAAUACACCU
GUGUAUUUUUUCUUUUAGAAU
U    1.3 °C 6.9 °C 0 [detail]1 [detail]
2684-2706 GTGTATTTTTTCTTTTAGAATGT AUUCUAAAAGAAAAAAUACAC
GUAUUUUUUCUUUUAGAAUGU
U    7.1 °C -9.7 °C 0 [detail]1 [detail]
2723-2745 GGGACAATGTTTTCTGTATGTTC ACAUACAGAAAACAUUGUCCC
GACAAUGUUUUCUGUAUGUUC
U    17.9 °C 19.3 °C 0 [detail]3 [detail]
2729-2751 ATGTTTTCTGTATGTTCTATTGT AAUAGAACAUACAGAAAACAU
GUUUUCUGUAUGUUCUAUUGU
U    14.5 °C 12.2 °C 0 [detail]2 [detail]
2752-2774 GCCTAGTACACTGTAAATGCTCA AGCAUUUACAGUGUACUAGGC
CUAGUACACUGUAAAUGCUCA
U    15.3 °C 20.2 °C 0 [detail]2 [detail]
2758-2780 TACACTGTAAATGCTCAATAAAT UUAUUGAGCAUUUACAGUGUA
CACUGUAAAUGCUCAAUAAAU
U    13.4 °C 19.0 °C 0 [detail]1 [detail]
2760-2782 CACTGTAAATGCTCAATAAATAT AUUUAUUGAGCAUUUACAGUG
CUGUAAAUGCUCAAUAAAUAU
U    -1.4 °C 6.9 °C 0 [detail]1 [detail]
2762-2784 CTGTAAATGCTCAATAAATATTG AUAUUUAUUGAGCAUUUACAG
GUAAAUGCUCAAUAAAUAUUG
U    -8.0 °C 15.3 °C 0 [detail]1 [detail]
2768-2790 ATGCTCAATAAATATTGATGATG UCAUCAAUAUUUAUUGAGCAU
GCUCAAUAAAUAUUGAUGAUG
U    13.6 °C 13.4 °C 0 [detail]2 [detail]

Graphical view of effective siRNA candidates

start-end Functional, off-target reduced siRNA (seed duplex Tm < 10 °C)
start-end Functional, off-target reduced siRNA (seed duplex Tm < 15 °C)
start-end Functional, off-target reduced siRNA (seed duplex Tm < 21.5 °C)
start-end Functional siRNA
10 20 30 40 50 60 70 80 90 100  
GCCCACTCCCACCGCCAGCTGGAACCCTGGGGACTACGACGTCCCTCAAACCTTGCTTCTAGGAGATAAAAAGAACATCCAGTCATGGATAAAAATGAGC   1-100
 
110 120 130 140 150 160 170 180 190 200  
TGGTTCAGAAGGCCAAACTGGCCGAGCAGGCTGAGCGATATGATGACATGGCAGCCTGCATGAAGTCTGTAACTGAGCAAGGAGCTGAATTATCCAATGA   101-200
156-178 U
 
210 220 230 240 250 260 270 280 290 300  
GGAGAGGAATCTTCTCTCAGTTGCTTATAAAAATGTTGTAGGAGCCCGTAGGTCATCTTGGAGGGTCGTCTCAAGTATTGAACAAAAGACGGAAGGTGCT   201-300
 
310 320 330 340 350 360 370 380 390 400  
GAGAAAAAACAGCAGATGGCTCGAGAATACAGAGAGAAAATTGAGACGGAGCTAAGAGATATCTGCAATGATGTACTGTCTCTTTTGGAAAAGTTCTTGA   301-400
320-342 U
321-343 U
354-376 U
378-400 U
380-402 U
 
410 420 430 440 450 460 470 480 490 500  
TCCCCAATGCTTCACAAGCAGAGAGCAAAGTCTTCTATTTGAAAATGAAAGGAGATTACTACCGTTACTTGGCTGAGGTTGCCGCTGGTGATGACAAGAA   401-500
 
423-445 U
424-446 U
428-450 U
430-452 U
450-472 U
 
510 520 530 540 550 560 570 580 590 600  
AGGGATTGTCGATCAGTCACAACAAGCATACCAAGAAGCTTTTGAAATCAGCAAAAAGGAAATGCAACCAACACATCCTATCAGACTGGGTCTGGCCCTT   501-600
525-547 U
537-559 U
542-564 U
547-569 U
 
610 620 630 640 650 660 670 680 690 700  
AACTTCTCTGTGTTCTATTATGAGATTCTGAACTCCCCAGAGAAAGCCTGCTCTCTTGCAAAGACAGCTTTTGATGAAGCCATTGCTGAACTTGATACAT   601-700
657-679 U
 
710 720 730 740 750 760 770 780 790 800  
TAAGTGAAGAGTCATACAAAGACAGCACGCTAATAATGCAATTACTGAGAGACAACTTGACATTGTGGACATCGGATACCCAAGGAGACGAAGCTGAAGC   701-800
715-737 U
726-748 U
728-750 U
 
810 820 830 840 850 860 870 880 890 900  
AGGAGAAGGAGGGGAAAATTAACCGGCCTTCCAACTTTTGTCTGCCTCATTCTAAAATTTACACAGTAGACCATTTGTCATCCATGCTGTCCCACAAATA   801-900
833-855 U
843-865 U
890-912 U
891-913 U
899-921 U
 
910 920 930 940 950 960 970 980 990 1000  
GTTTTTTGTTTACGATTTATGACAGGTTTATGTTACTTCTATTTGAATTTCTATATTTCCCATGTGGTTTTTATGTTTAATATTAGGGGAGTAGAGCCAG   901-1000
 
 
 
911-933 U
921-943 U
923-945 U
924-946 U
930-952 U
934-956 U
937-959 U
962-984 U
964-986 U
965-987 U
 
1010 1020 1030 1040 1050 1060 1070 1080 1090 1100  
TTAACATTTAGGGAGTTATCTGTTTTCATCTTGAGGTGGCCAATATGGGGATGTGGAATTTTTATACAAGTTATAAGTGTTTGGCATAGTACTTTTGGTA   1001-1100
1003-1025 U
1011-1033 U
1051-1073 U
1053-1075 U
1054-1076 U
1096-1118 U
 
1110 1120 1130 1140 1150 1160 1170 1180 1190 1200  
CATTGTGGCTTCAAAAGGGCCAGTGTAAAACTGCTTCCATGTCTAAGCAAAGAAAACTGCCTACATACTGGTTTGTCCTGGCGGGGAATAAAAGGGATCA   1101-1200
 
1136-1158 U
 
1210 1220 1230 1240 1250 1260 1270 1280 1290 1300  
TTGGTTCCAGTCACAGGTGTAGTAATTGTGGGTACTTTAAGGTTTGGAGCACTTACAAGGCTGTGGTAGAATCATACCCCATGGATACCACATATTAAAC   1201-1300
1220-1242 U
1278-1300 U
1289-1311 U
 
1310 1320 1330 1340 1350 1360 1370 1380 1390 1400  
CATGTATATCTGTGGAATACTCAATGTGTACACCTTTGACTACAGCTGCAGAAGTGTTCCTTTAGACAAAGTTGTGACCCATTTTACTCTGGATAAGGGC   1301-1400
 
1310-1332 U
1349-1371 U
 
1410 1420 1430 1440 1450 1460 1470 1480 1490 1500  
AGAAACGGTTCACATTCCATTATTTGTAAAGTTACCTGCTGTTAGCTTTCATTATTTTTGCTACACTCATTTTATTTGTATTTAAATGTTTTAGGCAACC   1401-1500
1436-1458 U
1439-1461 U
1443-1465 U
1462-1484 U
1464-1486 U
1466-1488 U
1494-1516 U
1497-1519 U
 
1510 1520 1530 1540 1550 1560 1570 1580 1590 1600  
TAAGAACAAATGTAAAAGTAAAGATGCAGGAAAAATGAATTGCTTGGTATTCATTACTTCATGTATATCAAGCACAGCAGTAAAACAAAAACCCATGTAT   1501-1600
 
 
1502-1524 U
1505-1527 U
1516-1538 U
1525-1547 U
1535-1557 U
1541-1563 U
1544-1566 U
1545-1567 U
1550-1572 U
1584-1606 U
1591-1613 U
1592-1614 U
 
1610 1620 1630 1640 1650 1660 1670 1680 1690 1700  
TTAACTTTTTTTTAGGATTTTTGCTTTTGTGATTTTTTTTTTTTTTTTTTGATACTTGCCTAACATGCATGTGCTGTAAAAATAGTTAACAGGGAAATAA   1601-1700
 
 
 
1613-1635 U
1614-1636 U
1621-1643 U
1622-1644 U
1627-1649 U
1629-1651 U
1671-1693 U
1683-1705 U
 
1710 1720 1730 1740 1750 1760 1770 1780 1790 1800  
CTTGAGATGATGGCTAGCTTTGTTTAATGTCTTATGAAATTTTCATGAACAATCCAAGCATAATTGTTAAGAACACGTGTATTAAATTCATGTAAGTGGA   1701-1800
 
1712-1734 U
1715-1737 U
1720-1742 U
1745-1767 U
1748-1770 U
1753-1775 U
1764-1786 U
1774-1796 U
1775-1797 U
1777-1799 U
1796-1818 U
1797-1819 U
 
1810 1820 1830 1840 1850 1860 1870 1880 1890 1900  
ATAAAAGTTTTATGAATGGACTTTTCAACTACTTTCTCTACAGCTTTTCATGTAAATTAGTCTTGGTTCTGAAACTTCTCTAAAGGAAATTGTACATTTT   1801-1900
 
 
1817-1839 U
1819-1841 U
1830-1852 U
1839-1861 U
1841-1863 U
1864-1886 U
1867-1889 U
1869-1891 U
1873-1895 U
1876-1898 U
1878-1900 U
1884-1906 U
1890-1912 U
 
1910 1920 1930 1940 1950 1960 1970 1980 1990 2000  
TTGAAATTTATTCCTTATTCCCTCTTGGCAGCTAATGGGCTCTTACCAAGTTTAAACACAAAATTTATCATAACAAAAATACTACTAATATAACTACTGT   1901-2000
 
 
1940-1962 U
1944-1966 U
1945-1967 U
1948-1970 U
1955-1977 U
1957-1979 U
1967-1989 U
1972-1994 U
 
2010 2020 2030 2040 2050 2060 2070 2080 2090 2100  
TTCCATGTCCCATGATCCCCTCTCTTCCTCCCCACCCTGAAAAAAATGAGTTCCTATTTTTTCTGGGAGAGGGGGGGATTGATTAGAAAAAAATGTAGTG   2001-2100
2074-2096 U
2079-2101 U
 
2110 2120 2130 2140 2150 2160 2170 2180 2190 2200  
TGTTCCATTTAAAATTTTGGCATATGGCATTTTCTAACTTAGGAAGCCACAATGTTCTTGGCCCATCATGACATTGGGTAGCATTAACTGTAAGTTTTGT   2101-2200
2117-2139 U
2136-2158 U
2176-2198 U
2180-2202 U
2192-2214 U
 
2210 2220 2230 2240 2250 2260 2270 2280 2290 2300  
GCTTCCAAATCACTTTTTGGTTTTTAAGAATTTCTTGATACTCTTATAGCCTGCCTTCAATTTTGATCCTTTATTCTTTCTATTTGTCAGGTGCACAAGA   2201-2300
 
 
2203-2225 U
2204-2226 U
2209-2231 U
2211-2233 U
2218-2240 U
2226-2248 U
2253-2275 U
2263-2285 U
2267-2289 U
 
2310 2320 2330 2340 2350 2360 2370 2380 2390 2400  
TTACCTTCCTGTTTTAGCCTTCTGTCTTGTCACCAACCATTCTTACTTGGTGGCCATGTACTTGGAAAAAGGCCGCATGATCTTTCTGGCTCCACTCAGT   2301-2400
 
2410 2420 2430 2440 2450 2460 2470 2480 2490 2500  
GTCTAAGGCACCCTGCTTCCTTTGCTTGCATCCCACAGACTATTTCCCTCATCCTATTTACTGCAGCAAATCTCTCCTTAGTTGATGAGACTGTGTTTAT   2401-2500
2438-2460 U
2465-2487 U
2491-2513 U
 
2510 2520 2530 2540 2550 2560 2570 2580 2590 2600  
CTCCCTTTAAAACCCTACCTATCCTGAATGGTCTGTCATTGTCTGCCTTTAAAATCCTTCCTCTTTCTTCCTCCTCTATTCTCTAAATAATGATGGGGCT   2501-2600
 
2533-2555 U
2535-2557 U
2571-2593 U
2574-2596 U
 
2610 2620 2630 2640 2650 2660 2670 2680 2690 2700  
AAGTTATACCCAAAGCTCACTTTACAAAATATTTCCTCAGTACTTTGCAGAAAACACCAAACAAAAATGCCATTTTAAAAAAGGTGTATTTTTTCTTTTA   2601-2700
2614-2636 U
2636-2658 U
2645-2667 U
2646-2668 U
2648-2670 U
2660-2682 U
2682-2704 U
2684-2706 U
 
2710 2720 2730 2740 2750 2760 2770 2780 2790 2800  
GAATGTAAGCTCCTCAAGAGCAGGGACAATGTTTTCTGTATGTTCTATTGTGCCTAGTACACTGTAAATGCTCAATAAATATTGATGATGGGAGGCAGTG   2701-2800
 
 
2723-2745 U
2729-2751 U
2752-2774 U
2758-2780 U
2760-2782 U
2762-2784 U
2768-2790 U
 
2810 2820 2830  
AGTCTTGATGATAAGGGTGAGAAACTGAAATCCC   2801-2834
 

Tab-delimited list (for data export)