siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs, Sidirect 158   322   323   356   380   425   426   432   452   539   544   717   728   845   901   913   923   925   926   932  
936   939   964   966   967   1053   1055   1056   1138   1312   1351   1438   1441   1445   1464   1466   1468   1496   1499   1504  
1507   1518   1586   1593   1594   1615   1616   1623   1624   1629   1631   1673   1685   1722   1747   1755   1766   1776   1777   1798  
1799   1819   1841   1843   1866   1871   1878   1880   1892   1946   1947   1950   1957   1959   1969   1974   2076   2081   2178   2211  
2213   2228   2255   2265   2440   2493   2535   2537   2573   2576   2616   2638   2647   2648   2650   2662   2684   2686   2725   2731  
2762   2764   2770  
Biltr, Sidirect 382   430   527   549   659   730   835   892   893   1005   1013   1098   1222   1280   1291   1527   1537   1543   1546   1547  
1552   1714   1717   1750   1779   1821   1832   1869   1875   1886   1942   2119   2138   2182   2194   2205   2206   2220   2269   2467  
2754   2760  
Biltr, Rnaxs 3   32   33   36   37   40   41   42   43   44   49   50   51   52   53   54   57   58   59   60  
65   79   86   87   88   129   130   131   132   154   155   156   157   162   176   177   181   182   183   184  
193   205   206   209   210   211   212   213   214   215   216   217   218   219   220   222   223   242   246   263  
267   268   269   270   271   299   300   311   312   313   317   318   319   320   321   324   325   336   347   351  
352   355   357   358   363   364   365   366   367   368   369   372   373   374   376   377   378   379   381   390  
394   395   399   410   411   420   421   422   423   424   439   440   441   449   450   458   502   503   511   512  
513   516   517   518   519   520   526   529   530   531   538   543   545   551   557   558   563   564   592   593  
594   595   596   597   600   601   602   603   605   606   607   608   609   610   611   614   615   658   672   673  
675   676   678   679   680   683   684   685   702   703   704   715   716   718   719   720   726   727   729   737  
738   744   745   746   754   759   760   761   773   774   775   778   779   780   781   783   784   787   788   789  
790   792   793   802   803   804   805   820   821   822   823   824   825   826   827   830   831   832   833   834  
837   838   839   840   841   842   843   844   846   847   850   857   858   862   863   864   868   870   871   882  
883   885   886   887   888   889   890   895   899   900   911   912   914   917   920   921   922   924   930   931  
935   937   938   940   945   951   952   953   954   955   958   959   960   961   962   963   965   974   975   984  
985   986   987   988   989   990   991   992   993   996   997   998   999   1007   1008   1010   1011   1020   1025   1026  
1027   1028   1029   1046   1047   1048   1049   1050   1051   1052   1054   1057   1058   1064   1069   1070   1076   1077   1078   1079  
1122   1123   1124   1134   1137   1140   1141   1148   1151   1155   1156   1157   1158   1159   1160   1182   1183   1184   1193   1194  
1195   1202   1203   1204   1206   1228   1230   1231   1240   1255   1257   1307   1311   1313   1318   1319   1320   1324   1332   1344  
1345   1346   1347   1348   1349   1350   1352   1354   1355   1368   1370   1396   1397   1398   1399   1406   1407   1408   1410   1411  
1412   1413   1415   1416   1417   1425   1434   1435   1436   1437   1439   1440   1444   1449   1453   1454   1455   1456   1458   1459  
1460   1461   1462   1463   1465   1467   1469   1493   1494   1495   1497   1498   1500   1503   1506   1515   1516   1517   1521   1522  
1523   1550   1551   1563   1565   1566   1567   1568   1570   1571   1572   1573   1574   1577   1578   1579   1580   1583   1584   1585  
1590   1591   1592   1595   1596   1597   1601   1602   1603   1604   1605   1609   1610   1614   1617   1618   1619   1620   1621   1622  
1625   1626   1627   1628   1630   1632   1645   1663   1664   1665   1666   1667   1669   1670   1671   1672   1679   1680   1681   1682  
1689   1690   1691   1692   1693   1694   1702   1703   1704   1705   1706   1707   1708   1709   1710   1711   1712   1713   1715   1716  
1720   1721   1723   1724   1725   1731   1735   1736   1743   1744   1745   1746   1751   1752   1753   1754   1757   1758   1764   1765  
1767   1768   1769   1770   1771   1773   1774   1775   1784   1785   1786   1787   1791   1792   1793   1794   1805   1806   1807   1813  
1814   1816   1817   1818   1828   1829   1830   1831   1835   1840   1842   1850   1851   1856   1860   1861   1864   1865   1870   1872  
1876   1877   1879   1881   1882   1883   1884   1885   1888   1889   1890   1891   1893   1894   1895   1899   1901   1902   1912   1913  
1917   1918   1919   1935   1936   1937   1938   1939   1940   1944   1945   1948   1949   1955   1956   1958   1960   1961   1962   1963  
1968   1970   1971   1972   1973   1975   1982   1983   1984   1985   1995   1998   1999   2003   2007   2008   2009   2010   2016   2017  
2018   2020   2022   2023   2024   2029   2035   2038   2039   2040   2041   2042   2061   2062   2063   2064   2065   2066   2067   2068  
2069   2070   2071   2072   2073   2074   2075   2077   2079   2080   2085   2086   2091   2092   2093   2094   2095   2096   2097   2098  
2099   2100   2101   2105   2106   2107   2123   2126   2127   2153   2174   2175   2176   2177   2179   2180   2181   2186   2187   2190  
2192   2193   2199   2200   2210   2212   2218   2219   2229   2230   2239   2240   2241   2242   2243   2244   2245   2246   2248   2249  
2250   2252   2253   2254   2256   2257   2258   2261   2264   2266   2267   2268   2290   2297   2298   2299   2303   2304   2307   2308  
2309   2310   2311   2317   2318   2319   2323   2324   2325   2326   2327   2328   2329   2330   2351   2352   2375   2378   2387   2388  
2406   2407   2408   2409   2410   2411   2414   2415   2418   2419   2424   2425   2426   2427   2428   2431   2432   2433   2434   2435  
2438   2439   2441   2442   2445   2446   2447   2448   2461   2462   2463   2464   2465   2466   2482   2483   2489   2490   2491   2492  
2494   2495   2499   2500   2502   2503   2504   2511   2512   2513   2518   2521   2522   2523   2524   2530   2531   2532   2533   2534  
2536   2541   2542   2544   2545   2546   2547   2548   2555   2556   2559   2560   2561   2562   2563   2566   2567   2568   2569   2570  
2571   2572   2574   2575   2597   2605   2610   2612   2613   2614   2615   2617   2624   2625   2628   2635   2636   2637   2642   2643  
2646   2649   2655   2656   2657   2658   2659   2660   2661   2663   2664   2672   2673   2674   2675   2676   2680   2681   2682   2683  
2685   2690   2700   2719   2720   2721   2722   2723   2724   2726   2727   2729   2730   2738   2741   2751   2752   2756   2757   2758  
2761   2763   2765   2768   2769   2771   2796   2797   2802   2805   2806   2807   2812   2813   2814   2815  


Target Position: 1959, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1959CAAAAUUUAUCAUAACAAA98.698822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4181977CAAAATTTATCATAACAAATTTGTTATGATAAATTTTG0.859500.750100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1957-1979CACAAAATTTATCATAACAAAAAUUUGUUAUGAUAAAUUUUGUGCAAAAUUUAUCAUAACAAAAAU6.9-12.012


Target Position: 54, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
54UGCUUCUAGGAGAUAAAAA82.2009639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
32672TGCTTCTAGGAGATAAAAATTTTTATCTCCTAGAAGCA0.553300.067000.853400.750001.000001.00000


Target Position: 1466, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1466CUCAUUUUAUUUGUAUUUA83.6279540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551484CTCATTTTATTTGTATTTATAAATACAAATAAAATGAG0.173400.136000.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1464-1486CACTCATTTTATTTGTATTTAAAUAAAUACAAAUAAAAUGAGUGCUCAUUUUAUUUGUAUUUAAAU6.97.402


Target Position: 1007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1007UUUAGGGAGUUAUCUGUUU68.32711775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8491025TTTAGGGAGTTATCTGTTTAAACAGATAACTCCCTAAA0.065800.004100.500000.500001.000001.00000


Target Position: 218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
218CAGUUGCUUAUAAAAAUGU77.34091029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
788236CAGTTGCTTATAAAAATGTACATTTTTATAAGCAACTG0.149100.021500.577600.500001.000001.00000


Target Position: 1764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1764UUGUUAAGAACACGUGUAU69.42961679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7841782TTGTTAAGAACACGTGTATATACACGTGTTCTTAACAA0.112200.015300.603400.500001.000001.00000


Target Position: 2813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2813AAGGGUGAGAAACUGAAAU74.78271244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8522831AAGGGTGAGAAACTGAAATATTTCAGTTTCTCACCCTT0.290600.057100.629300.500001.000001.00000


Target Position: 545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
545AAAUCAGCAAAAAGGAAAU76.49471104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
966563AAATCAGCAAAAAGGAAATATTTCCTTTTTGCTGATTT0.032200.024100.491400.500001.000001.00000


Target Position: 986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
986GGGGAGUAGAGCCAGUUAA90.8804173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9111004GGGGAGTAGAGCCAGTTAATTAACTGGCTCTACTCCCC0.144400.002500.956901.000001.000001.00000


Target Position: 679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
679GCCAUUGCUGAACUUGAUA85.1968446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
551697GCCATTGCTGAACTTGATATATCAAGTTCAGCAATGGC0.218300.022300.956901.000001.000001.00000


Target Position: 2770, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2770GCUCAAUAAAUAUUGAUGA88.9453247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8702788GCTCAATAAATATTGATGATCATCAATATTTATTGAGC0.046900.004800.629300.750000.918500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2768-2790ATGCTCAATAAATATTGATGATGUCAUCAAUAUUUAUUGAGCAUGCUCAAUAAAUAUUGAUGAUGU13.613.402


Target Position: 883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
883CAUGCUGUCCCACAAAUAG76.73491080

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
990901CATGCTGTCCCACAAATAGCTATTTGTGGGACAGCATG0.084200.004100.482800.500000.967400.62500


Target Position: 1010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1010AGGGAGUUAUCUGUUUUCA81.5186710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9771028AGGGAGTTATCTGTTTTCATGAAAACAGATAACTCCCT0.023500.002200.620700.500001.000001.00000


Target Position: 87, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
87GGAUAAAAAUGAGCUGGUU87.3009328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
880105GGATAAAAATGAGCTGGTTAACCAGCTCATTTTTATCC0.045500.016600.724101.000001.000001.00000


Target Position: 1895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895CAUUUUUUGAAAUUUAUUC68.81271732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9361913CATTTTTTGAAATTTATTCGAATAAATTTCAAAAAATG0.247800.134000.482800.500000.972800.62500


Target Position: 2439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2439ACUAUUUCCCUCAUCCUAU79.1218879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3822457ACTATTTCCCTCATCCTATATAGGATGAGGGAAATAGT0.781700.728300.663800.750001.000001.00000


Target Position: 2658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2658CAAACAAAAAUGCCAUUUU79.9755801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5432676CAAACAAAAATGCCATTTTAAAATGGCATTTTTGTTTG0.132200.145900.646600.750000.962000.75000


Target Position: 1791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1791UGUAAGUGGAAUAAAAGUU73.34691378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8941809TGTAAGTGGAATAAAAGTTAACTTTTATTCCACTTACA0.040700.021700.560300.750001.000001.00000


Target Position: 954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
954UAUUUCCCAUGUGGUUUUU61.34462247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
824972TATTTCCCATGTGGTTTTTAAAAACCACATGGGAAATA0.071600.004700.543100.500000.956501.00000


Target Position: 1618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1618UUUUUGCUUUUGUGAUUUU66.13321943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8291636TTTTTGCTTTTGTGATTTTAAAATCACAAAAGCAAAAA0.496900.075700.500000.500001.000001.00000


Target Position: 2299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2299GAUUACCUUCCUGUUUUAG69.93441631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8022317GATTACCTTCCTGTTTTAGCTAAAACAGGAAGGTAATC0.259400.179600.508600.500001.000001.00000


Target Position: 2682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2682AGGUGUAUUUUUUCUUUUA91.544146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152700AGGTGTATTTTTTCTTTTATAAAAGAAAAAATACACCT0.115500.011700.810300.750001.000001.00000


Target Position: 527, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
527CAUACCAAGAAGCUUUUGA80.8239746

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
525-547AGCATACCAAGAAGCTTTTGAAAUCAAAAGCUUCUUGGUAUGCUCAUACCAAGAAGCUUUUGAAAU18.620.003


Target Position: 1005, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1005CAUUUAGGGAGUUAUCUGU81.8646677

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1003-1025AACATTTAGGGAGTTATCTGTTTACAGAUAACUCCCUAAAUGUUCAUUUAGGGAGUUAUCUGUUUU13.410.912


Target Position: 37, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
37CGACGUCCCUCAAACCUUG75.81011148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
94655CGACGTCCCTCAAACCTTGCAAGGTTTGAGGGACGTCG0.125700.001900.646600.750001.000001.00000


Target Position: 220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
220GUUGCUUAUAAAAAUGUUG69.07971715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
874238GTTGCTTATAAAAATGTTGCAACATTTTTATAAGCAAC0.121300.021900.500000.500001.000001.00000


Target Position: 1020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1020CUGUUUUCAUCUUGAGGUG69.63471655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9431038CTGTTTTCATCTTGAGGTGCACCTCAAGATGAAAACAG0.036700.002000.491400.500001.000001.00000


Target Position: 1151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1151AGAAAACUGCCUACAUACU79.1764874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7801169AGAAAACTGCCTACATACTAGTATGTAGGCAGTTTTCT0.284700.018300.517200.500001.000001.00000


Target Position: 2179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2179UAGCAUUAACUGUAAGUUU78.316944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8882197TAGCATTAACTGTAAGTTTAAACTTACAGTTAATGCTA0.052300.012600.672400.500000.989100.62500


Target Position: 1436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1436CUGCUGUUAGCUUUCAUUA87.194333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9821454CTGCTGTTAGCTTTCATTATAATGAAAGCTAACAGCAG0.474200.001200.750000.750000.940200.75000


Target Position: 356, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
356GAGAUAUCUGCAAUGAUGU84.3212504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
979374GAGATATCTGCAATGATGTACATCATTGCAGATATCTC0.036600.001300.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
354-376AAGAGATATCTGCAATGATGTACACAUCAUUGCAGAUAUCUCUUGAGAUAUCUGCAAUGAUGUACU13.615.912


Target Position: 1670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1670UGUGCUGUAAAAAUAGUUA83.6882535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8041688TGTGCTGTAAAAATAGTTATAACTATTTTTACAGCACA0.111500.005400.672400.750001.000001.00000


Target Position: 704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
704GUGAAGAGUCAUACAAAGA89.7138210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
922722GTGAAGAGTCATACAAAGATCTTTGTATGACTCTTCAC0.150200.012500.569000.500001.000001.00000


Target Position: 2494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2494UGUUUAUCUCCCUUUAAAA88.0786289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2012512TGTTTATCTCCCTTTAAAATTTTAAAGGGAGATAAACA0.658900.424100.706900.750001.000001.00000


Target Position: 1499, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1499CCUAAGAACAAAUGUAAAA89.2088234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2281517CCTAAGAACAAATGTAAAATTTTACATTTGTTCTTAGG0.476100.116000.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1497-1519AACCTAAGAACAAATGTAAAAGTUUUUACAUUUGUUCUUAGGUUCCUAAGAACAAAUGUAAAAGUU6.911.702


Target Position: 1841, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1841CAGCUUUUCAUGUAAAUUA93.1054100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9141859CAGCTTTTCATGTAAATTATAATTTACATGAAAAGCTG0.035900.015500.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1839-1861TACAGCTTTTCATGTAAATTAGTUAAUUUACAUGAAAAGCUGUACAGCUUUUCAUGUAAAUUAGUU-0.317.002


Target Position: 2206, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2206CAAAUCACUUUUUGGUUUU75.60171166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2204-2226TCCAAATCACTTTTTGGTTTTTAAAAACCAAAAAGUGAUUUGGACAAAUCACUUUUUGGUUUUUAU18.814.802


Target Position: 2205, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2205CCAAAUCACUUUUUGGUUU77.23161039

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2203-2225TTCCAAATCACTTTTTGGTTTTTAAACCAAAAAGUGAUUUGGAACCAAAUCACUUUUUGGUUUUUU18.813.802


Target Position: 595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
595GCCCUUAACUUCUCUGUGU78.4563930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
841613GCCCTTAACTTCTCTGTGTACACAGAGAAGTTAAGGGC0.052200.044200.793100.750001.000001.00000


Target Position: 222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
222UGCUUAUAAAAAUGUUGUA82.1524645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
655240TGCTTATAAAAATGTTGTATACAACATTTTTATAAGCA0.100100.021800.672400.750001.000001.00000


Target Position: 2193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2193AGUUUUGUGCUUCCAAAUC62.27272195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8182211AGTTTTGTGCTTCCAAATCGATTTGGAAGCACAAAACT0.130600.011100.525900.500000.929300.62500


Target Position: 2610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2610CCAAAGCUCACUUUACAAA88.3643271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1542628CCAAAGCTCACTTTACAAATTTGTAAAGTGAGCTTTGG0.505300.237800.844801.000000.962000.62500


Target Position: 931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
931UGUUACUUCUAUUUGAAUU76.63041092

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
391949TGTTACTTCTATTTGAATTAATTCAAATAGAAGTAACA0.305900.096100.698300.750001.000001.00000


Target Position: 1885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1885GGAAAUUGUACAUUUUUUG74.76671245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4731903GGAAATTGTACATTTTTTGCAAAAAATGTACAATTTCC0.313500.075000.724100.750001.000001.00000


Target Position: 2771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2771CUCAAUAAAUAUUGAUGAU86.8702347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9552789CTCAATAAATATTGATGATATCATCAATATTTATTGAG0.025200.010500.629300.750000.918500.62500


Target Position: 2192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2192AAGUUUUGUGCUUCCAAAU75.84511147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7812210AAGTTTTGTGCTTCCAAATATTTGGAAGCACAAAACTT0.067800.007900.629300.500000.929300.62500


Target Position: 2212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2212ACUUUUUGGUUUUUAAGAA84.5218486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9592230ACTTTTTGGTTTTTAAGAATTCTTAAAAACCAAAAAGT0.078700.001600.534500.750001.000001.00000


Target Position: 363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
363CUGCAAUGAUGUACUGUCU83.9769523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
819381CTGCAATGATGTACTGTCTAGACAGTACATCATTGCAG0.056500.009300.560300.500001.000001.00000


Target Position: 2328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2328UGUCACCAACCAUUCUUAC62.69922173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7922346TGTCACCAACCATTCTTACGTAAGAATGGTTGGTGACA0.596400.029700.525900.500001.000001.00000


Target Position: 2264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2264UGAUCCUUUAUUCUUUCUA78.0324971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6732282TGATCCTTTATTCTTTCTATAGAAAGAATAAAGGATCA0.471100.302600.551700.750001.000001.00000


Target Position: 1076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1076AGUGUUUGGCAUAGUACUU78.8419898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7991094AGTGTTTGGCATAGTACTTAAGTACTATGCCAAACACT0.073100.005600.569000.750001.000001.00000


Target Position: 518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
518CACAACAAGCAUACCAAGA82.0176661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
807536CACAACAAGCATACCAAGATCTTGGTATGCTTGTTGTG0.562300.090200.569000.500001.000001.00000


Target Position: 2756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2756AGUACACUGUAAAUGCUCA92.4007121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9292774AGTACACTGTAAATGCTCATGAGCATTTACAGTGTACT0.089000.071200.482800.500000.934800.75000


Target Position: 351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
351GCUAAGAGAUAUCUGCAAU90.9197169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
858369GCTAAGAGATATCTGCAATATTGCAGATATCTCTTAGC0.049100.035800.844801.000001.000001.00000


Target Position: 526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
526GCAUACCAAGAAGCUUUUG63.6662107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
963544GCATACCAAGAAGCTTTTGCAAAAGCTTCTTGGTATGC0.023000.010100.706900.750000.978301.00000


Target Position: 1893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1893UACAUUUUUUGAAAUUUAU74.62241259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9861911TACATTTTTTGAAATTTATATAAATTTCAAAAAATGTA0.272900.134900.637900.500001.000001.00000


Target Position: 1202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1202UGGUUCCAGUCACAGGUGU63.04612154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5731220TGGTTCCAGTCACAGGTGTACACCTGTGACTGGAACCA0.360400.040400.637900.500000.972800.87500


Target Position: 1793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1793UAAGUGGAAUAAAAGUUUU75.21491201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9641811TAAGTGGAATAAAAGTTTTAAAACTTTTATTCCACTTA0.022900.010100.534500.500001.000001.00000


Target Position: 1828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1828ACUACUUUCUCUACAGCUU78.4477931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6641846ACTACTTTCTCTACAGCTTAAGCTGTAGAGAAAGTAGT0.136100.015000.569000.750000.940200.62500


Target Position: 2187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2187ACUGUAAGUUUUGUGCUUC64.32562058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9722205ACTGTAAGTTTTGTGCTTCGAAGCACAAAACTTACAGT0.019900.002100.534500.500001.000001.00000


Target Position: 1829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1829CUACUUUCUCUACAGCUUU79.4398848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6851847CTACTTTCTCTACAGCTTTAAAGCTGTAGAGAAAGTAG0.123100.013900.672400.750000.940200.62500


Target Position: 1465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1465ACUCAUUUUAUUUGUAUUU72.66181441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4291483ACTCATTTTATTTGTATTTAAATACAAATAAAATGAGT0.275600.141900.706900.750001.000001.00000


Target Position: 2418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2418UCCUUUGCUUGCAUCCCAC58.8722366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262436TCCTTTGCTTGCATCCCACGTGGGATGCAAGCAAAGGA0.188300.066100.577600.500001.000001.00000


Target Position: 2085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2085AGAAAAAAAUGUAGUGUGU78.7003909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9962103AGAAAAAAATGTAGTGTGTACACACTACATTTTTTTCT0.061700.045200.517200.500001.000001.00000


Target Position: 1307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1307UAUCUGUGGAAUACUCAAU76.12921129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9631325TATCTGTGGAATACTCAATATTGAGTATTCCACAGATA0.108100.001500.534500.500001.000001.00000


Target Position: 1767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1767UUAAGAACACGUGUAUUAA81.8027689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8461785TTAAGAACACGTGTATTAATTAATACACGTGTTCTTAA0.130600.048400.500000.500001.000001.00000


Target Position: 1865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1865GGUUCUGAAACUUCUCUAA96.890634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6671883GGTTCTGAAACTTCTCTAATTAGAGAAGTTTCAGAACC0.096600.034200.819001.000001.000001.00000


Target Position: 1974, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1974CAAAAAUACUACUAAUAUA107.721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5621992CAAAAATACTACTAATATATATATTAGTAGTATTTTTG0.670500.604600.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1972-1994AACAAAAATACTACTAATATAACUAUAUUAGUAGUAUUUUUGUUCAAAAAUACUACUAAUAUAACU-2.7-9.701


Target Position: 1368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1368AAAGUUGUGACCCAUUUUA81.1397729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9781386AAAGTTGTGACCCATTTTATAAAATGGGTCACAACTTT0.056100.001300.465500.500001.000001.00000


Target Position: 1453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1453UAUUUUUGCUACACUCAUU80.2662788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9691471TATTTTTGCTACACTCATTAATGAGTGTAGCAAAAATA0.337000.168100.534500.500001.000001.00000


Target Position: 1888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1888AAUUGUACAUUUUUUGAAA90.7792175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9551906AATTGTACATTTTTTGAAATTTCAAAAAATGTACAATT0.246000.164900.508600.500001.000001.00000


Target Position: 2438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2438GACUAUUUCCCUCAUCCUA93.394295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4442456GACTATTTCCCTCATCCTATAGGATGAGGGAAATAGTC0.779100.730500.646600.750001.000001.00000


Target Position: 2068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2068AGAGGGGGGGAUUGAUUAG66.61131913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7502086AGAGGGGGGGATTGATTAGCTAATCAATCCCCCCCTCT0.141400.057500.551700.500001.000001.00000


Target Position: 1689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1689ACAGGGAAAUAACUUGAGA82.8425595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9311707ACAGGGAAATAACTTGAGATCTCAAGTTATTTCCCTGT0.080500.045100.482800.500001.000001.00000


Target Position: 2177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2177GGUAGCAUUAACUGUAAGU80.9521735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7452195GGTAGCATTAACTGTAAGTACTTACAGTTAATGCTACC0.073800.019100.646600.750000.989100.87500


Target Position: 558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
558GGAAAUGCAACCAACACAU85.6502426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
389576GGAAATGCAACCAACACATATGTGTTGGTTGCATTTCC0.275800.047800.715501.000000.934800.75000


Target Position: 730, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730CUAAUAAUGCAAUUACUGA90.7671177

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
728-750CGCTAATAATGCAATTACTGAGAUCAGUAAUUGCAUUAUUAGCGCUAAUAAUGCAAUUACUGAGAU11.6-8.002


Target Position: 131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
131CUGAGCGAUAUGAUGACAU79.1195881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
701149CTGAGCGATATGATGACATATGTCATCATATCGCTCAG0.087200.044200.629300.750001.000001.00000


Target Position: 2029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2029UCCCCACCCUGAAAAAAAU69.97171624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4982047TCCCCACCCTGAAAAAAATATTTTTTTCAGGGTGGGGA0.152000.132100.862100.750001.000001.00000


Target Position: 2303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2303ACCUUCCUGUUUUAGCCUU65.84011968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3782321ACCTTCCTGTTTTAGCCTTAAGGCTAAAACAGGAAGGT0.320100.222300.715500.750001.000001.00000


Target Position: 1736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1736GAAAUUUUCAUGAACAAUC72.98121406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9181754GAAATTTTCATGAACAATCGATTGTTCATGAAAATTTC0.062100.016600.491400.500001.000001.00000


Target Position: 2086, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2086GAAAAAAAUGUAGUGUGUU82.6189614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8442104GAAAAAAATGTAGTGTGTTAACACACTACATTTTTTTC0.051300.033200.525900.750001.000001.00000


Target Position: 440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
440UGAAAAUGAAAGGAGAUUA81.7572692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
928458TGAAAATGAAAGGAGATTATAATCTCCTTTCATTTTCA0.032600.013800.689700.750001.000001.00000


Target Position: 925, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
925GGUUUAUGUUACUUCUAUU98.871321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
286943GGTTTATGTTACTTCTATTAATAGAAGTAACATAAACC0.372500.077400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
923-945CAGGTTTATGTTACTTCTATTTGAAUAGAAGUAACAUAAACCUGGGUUUAUGUUACUUCUAUUUGU11.66.903


Target Position: 1494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1494GGCAACCUAAGAACAAAUG66.65111910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261512GGCAACCTAAGAACAAATGCATTTGTTCTTAGGTTGCC0.177000.025400.844800.750001.000001.00000


Target Position: 1830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1830UACUUUCUCUACAGCUUUU76.54551098

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9741848TACTTTCTCTACAGCTTTTAAAAGCTGTAGAGAAAGTA0.115500.019300.681000.500000.940200.62500


Target Position: 1774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1774CACGUGUAUUAAAUUCAUG77.8898981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9871792CACGTGTATTAAATTCATGCATGAATTTAATACACGTG0.137200.024900.637900.500001.000001.00000


Target Position: 2730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2730UGUUUUCUGUAUGUUCUAU77.60941007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232748TGTTTTCTGTATGTTCTATATAGAACATACAGAAAACA0.055100.012100.663800.750001.000001.00000


Target Position: 2568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2568UUCCUCCUCUAUUCUCUAA76.53481101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232586TTCCTCCTCTATTCTCTAATTAGAGAATAGAGGAGGAA0.491300.297700.637900.500001.000001.00000


Target Position: 1622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1622UGCUUUUGUGAUUUUUUUU69.76631640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2001640TGCTTTTGTGATTTTTTTTAAAAAAAATCACAAAAGCA0.761300.425400.853400.750001.000001.00000


Target Position: 1347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1347UGCAGAAGUGUUCCUUUAG65.43961998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6911365TGCAGAAGTGTTCCTTTAGCTAAAGGAACACTTCTGCA0.116500.013100.681000.500000.978300.87500


Target Position: 1597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1597GUAUUUAACUUUUUUUUAG77.22531040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7961615GTATTTAACTTTTTTTTAGCTAAAAAAAAGTTAAATAC0.165900.082500.508600.500001.000001.00000


Target Position: 2098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2098GUGUGUUCCAUUUAAAAUU80.3348779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5182116GTGTGTTCCATTTAAAATTAATTTTAAATGGAACACAC0.762700.026900.784500.750001.000001.00000


Target Position: 2511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2511AACCCUACCUAUCCUGAAU78.439933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6942529AACCCTACCTATCCTGAATATTCAGGATAGGTAGGGTT0.321800.111000.637900.500001.000001.00000


Target Position: 658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
658GCAAAGACAGCUUUUGAUG72.17441472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
966676GCAAAGACAGCTTTTGATGCATCAAAAGCTGTCTTTGC0.047800.001500.698300.750001.000001.00000


Target Position: 193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
193UCCAAUGAGGAGAGGAAUC54.90222539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
998211TCCAATGAGGAGAGGAATCGATTCCTCTCCTCATTGGA0.012200.001200.689700.500000.907600.62500


Target Position: 2123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2123UAUGGCAUUUUCUAACUUA87.0894339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9962141TATGGCATTTTCTAACTTATAAGTTAGAAAATGCCATA0.101300.001000.508600.500001.000001.00000


Target Position: 1619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1619UUUUGCUUUUGUGAUUUUU59.72052329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8841637TTTTGCTTTTGTGATTTTTAAAAATCACAAAAGCAAAA0.512200.085100.500000.500001.000001.00000


Target Position: 792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792AGCUGAAGCAGGAGAAGGA84.6204479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
928810AGCTGAAGCAGGAGAAGGATCCTTCTCCTGCTTCAGCT0.188500.018800.482800.500001.000001.00000


Target Position: 1694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1694GAAAUAACUUGAGAUGAUG80.1295790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9291712GAAATAACTTGAGATGATGCATCATCTCAAGTTATTTC0.129700.028700.517200.500001.000001.00000


Target Position: 439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
439UUGAAAAUGAAAGGAGAUU60.17192302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
934457TTGAAAATGAAAGGAGATTAATCTCCTTTCATTTTCAA0.030300.012300.637900.500001.000001.00000


Target Position: 2637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2637UCAGUACUUUGCAGAAAAC67.50061836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6062655TCAGTACTTTGCAGAAAACGTTTTCTGCAAAGTACTGA0.186900.038200.577600.500001.000001.00000


Target Position: 2628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2628AAUAUUUCCUCAGUACUUU76.98851058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8172646AATATTTCCTCAGTACTTTAAAGTACTGAGGAAATATT0.101800.052300.508600.500001.000001.00000


Target Position: 917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
917UUAUGACAGGUUUAUGUUA82.6256612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
849935TTATGACAGGTTTATGTTATAACATAAACCTGTCATAA0.158600.006100.500000.500001.000001.00000


Target Position: 1610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1610UUUUAGGAUUUUUGCUUUU63.87092088

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8451628TTTTAGGATTTTTGCTTTTAAAAGCAAAAATCCTAAAA0.090600.033200.500000.500001.000001.00000


Target Position: 775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
775GAUACCCAAGGAGACGAAG66.0771948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
794793GATACCCAAGGAGACGAAGCTTCGTCTCCTTGGGTATC0.205400.044700.543100.500001.000001.00000


Target Position: 1441, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1441GUUAGCUUUCAUUAUUUUU78.2969947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7821459GTTAGCTTTCATTATTTTTAAAAATAATGAAAGCTAAC0.743100.006500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1439-1461CTGTTAGCTTTCATTATTTTTGCAAAAAUAAUGAAAGCUAACAGGUUAGCUUUCAUUAUUUUUGCU-9.718.312


Target Position: 355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
355AGAGAUAUCUGCAAUGAUG81.5541706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
947373AGAGATATCTGCAATGATGCATCATTGCAGATATCTCT0.028300.002300.569000.500001.000001.00000


Target Position: 939, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
939CUAUUUGAAUUUCUAUAUU85.0682457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
529957CTATTTGAATTTCTATATTAATATAGAAATTCAAATAG0.137600.050700.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
937-959TTCTATTTGAATTTCTATATTTCAAUAUAGAAAUUCAAAUAGAACUAUUUGAAUUUCUAUAUUUCU8.28.912


Target Position: 1408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1408GUUCACAUUCCAUUAUUUG71.61541513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8591426GTTCACATTCCATTATTTGCAAATAATGGAATGTGAAC0.302700.035200.500000.500001.000001.00000


Target Position: 2245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2245UAUAGCCUGCCUUCAAUUU67.47961842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7852263TATAGCCTGCCTTCAATTTAAATTGAAGGCAGGCTATA0.326300.144000.543100.500001.000001.00000


Target Position: 964, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
964GUGGUUUUUAUGUUUAAUA87.9088299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
491982GTGGTTTTTATGTTTAATATATTAAACATAAAAACCAC0.155500.069100.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
962-984ATGTGGTTTTTATGTTTAATATTUAUUAAACAUAAAAACCACAUGUGGUUUUUAUGUUUAAUAUUU-0.318.822


Target Position: 1011, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1011GGGAGUUAUCUGUUUUCAU91.745138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9011029GGGAGTTATCTGTTTTCATATGAAAACAGATAACTCCC0.111800.002700.836201.000001.000001.00000


Target Position: 2194, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2194GUUUUGUGCUUCCAAAUCA87.8713302

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2192-2214AAGTTTTGTGCTTCCAAATCACTUGAUUUGGAAGCACAAAACUUGUUUUGUGCUUCCAAAUCACUU20.112.202


Target Position: 1596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1596UGUAUUUAACUUUUUUUUA80.4205770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3161614TGTATTTAACTTTTTTTTATAAAAAAAAGTTAAATACA0.542200.451000.672400.750001.000001.00000


Target Position: 1705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1705AGAUGAUGGCUAGCUUUGU74.65921253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7811723AGATGATGGCTAGCTTTGTACAAAGCTAGCCATCATCT0.114700.037300.517200.500001.000001.00000


Target Position: 1415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1415UUCCAUUAUUUGUAAAGUU71.99891487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7761433TTCCATTATTTGTAAAGTTAACTTTACAAATAATGGAA0.084100.082200.525900.500001.000001.00000


Target Position: 2020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2020CUCUCUUCCUCCCCACCCU69.21341701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9762038CTCTCTTCCTCCCCACCCTAGGGTGGGGAGGAAGAGAG0.564800.457300.465500.500001.000001.00000


Target Position: 2182, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2182CAUUAACUGUAAGUUUUGU80.2955786

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2180-2202AGCATTAACTGTAAGTTTTGTGCACAAAACUUACAGUUAAUGCUCAUUAACUGUAAGUUUUGUGCU10.34.602


Target Position: 181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
181GGAGCUGAAUUAUCCAAUG80.8992739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
998199GGAGCTGAATTATCCAATGCATTGGATAATTCAGCTCC0.033300.001000.715500.750001.000001.00000


Target Position: 2721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2721CAGGGACAAUGUUUUCUGU84.7419475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7702739CAGGGACAATGTTTTCTGTACAGAAAACATTGTCCCTG0.315500.007000.577600.500001.000001.00000


Target Position: 2533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2533CUGUCAUUGUCUGCCUUUA87.2452332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2942551CTGTCATTGTCTGCCTTTATAAAGGCAGACAATGACAG0.479700.252600.750000.750001.000001.00000


Target Position: 594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
594GGCCCUUAACUUCUCUGUG71.8661497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
805612GGCCCTTAACTTCTCTGTGCACAGAGAAGTTAAGGGCC0.059300.050000.706900.750001.000001.00000


Target Position: 2812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2812UAAGGGUGAGAAACUGAAA83.4157563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922830TAAGGGTGAGAAACTGAAATTTCAGTTTCTCACCCTTA0.356500.057400.534500.500001.000001.00000


Target Position: 2240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2240ACUCUUAUAGCCUGCCUUC64.3872053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7102258ACTCTTATAGCCTGCCTTCGAAGGCAGGCTATAAGAGT0.187700.125900.534500.500001.000001.00000


Target Position: 1970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1970AUAACAAAAAUACUACUAA88.3389274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8871988ATAACAAAAATACTACTAATTAGTAGTATTTTTGTTAT0.844000.746500.508600.500001.000001.00000


Target Position: 79, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
79CCAGUCAUGGAUAAAAAUG69.86841635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
99597CCAGTCATGGATAAAAATGCATTTTTATCCATGACTGG0.073900.001000.689700.750000.989100.62500


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050GAUGUGGAAUUUUUAUACA94.588270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9561068GATGTGGAATTTTTATACATGTATAAAAATTCCACATC0.088900.004800.474100.500001.000001.00000


Target Position: 1776, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1776CGUGUAUUAAAUUCAUGUA95.382856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8421794CGTGTATTAAATTCATGTATACATGAATTTAATACACG0.051800.020200.594801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1774-1796CACGTGTATTAAATTCATGTAAGUACAUGAAUUUAAUACACGUGCGUGUAUUAAAUUCAUGUAAGU20.514.602


Target Position: 2244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2244UUAUAGCCUGCCUUCAAUU69.43441677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7582262TTATAGCCTGCCTTCAATTAATTGAAGGCAGGCTATAA0.320300.140700.525900.500001.000001.00000


Target Position: 1743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1743UCAUGAACAAUCCAAGCAU76.53991099

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8371761TCATGAACAATCCAAGCATATGCTTGGATTGTTCATGA0.178300.004400.569000.750001.000001.00000


Target Position: 379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
379UCUCUUUUGGAAAAGUUCU63.77892099

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
865397TCTCTTTTGGAAAAGTTCTAGAACTTTTCCAAAAGAGA0.204700.003700.500000.500000.967400.62500


Target Position: 2768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2768AUGCUCAAUAAAUAUUGAU74.17361293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9602786ATGCTCAATAAATATTGATATCAATATTTATTGAGCAT0.053400.004300.474100.500000.918500.62500


Target Position: 1713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1713GCUAGCUUUGUUUAAUGUC67.87061818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8901731GCTAGCTTTGTTTAATGTCGACATTAAACAAAGCTAGC0.043400.012300.534500.750001.000001.00000


Target Position: 2176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2176GGGUAGCAUUAACUGUAAG81.6505700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9202194GGGTAGCATTAACTGTAAGCTTACAGTTAATGCTACCC0.071300.002300.853400.750000.989101.00000


Target Position: 1407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1407GGUUCACAUUCCAUUAUUU95.562951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4221425GGTTCACATTCCATTATTTAAATAATGGAATGTGAACC0.374900.043000.853401.000001.000001.00000


Target Position: 1745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1745AUGAACAAUCCAAGCAUAA79.3886852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7321763ATGAACAATCCAAGCATAATTATGCTTGGATTGTTCAT0.082900.010500.620700.500001.000001.00000


Target Position: 378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
378GUCUCUUUUGGAAAAGUUC67.92921810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
823396GTCTCTTTTGGAAAAGTTCGAACTTTTCCAAAAGAGAC0.189900.004700.646600.500000.967400.62500


Target Position: 1672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1672UGCUGUAAAAAUAGUUAAC64.74832037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8731690TGCTGTAAAAATAGTTAACGTTAACTATTTTTACAGCA0.078300.005400.706900.500001.000001.00000


Target Position: 945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
945GAAUUUCUAUAUUUCCCAU93.1035101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
793963GAATTTCTATATTTCCCATATGGGAAATATAGAAATTC0.063500.039800.517200.750001.000001.00000


Target Position: 2076, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2076GGAUUGAUUAGAAAAAAAU90.5184185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4292094GGATTGATTAGAAAAAAATATTTTTTTCTAATCAATCC0.285600.041000.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2074-2096GGGGATTGATTAGAAAAAAATGTAUUUUUUUCUAAUCAAUCCCCGGAUUGAUUAGAAAAAAAUGUU-11.316.212


Target Position: 784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784GGAGACGAAGCUGAAGCAG67.46521843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
790802GGAGACGAAGCTGAAGCAGCTGCTTCAGCTTCGTCTCC0.062000.011100.586200.750001.000001.00000


Target Position: 1354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1354GUGUUCCUUUAGACAAAGU76.25581121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7091372GTGTTCCTTTAGACAAAGTACTTTGTCTAAAGGAACAC0.124000.030500.586200.500000.972800.62500


Target Position: 2464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2464CAGCAAAUCUCUCCUUAGU82.0888652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7742482CAGCAAATCTCTCCTTAGTACTAAGGAGAGATTTGCTG0.197800.043100.577600.500001.000001.00000


Target Position: 1159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159GCCUACAUACUGGUUUGUC66.44491924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9751177GCCTACATACTGGTTTGTCGACAAACCAGTATGTAGGC0.019300.021200.681000.750000.978300.75000


Target Position: 60, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
60UAGGAGAUAAAAAGAACAU75.38191184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
89778TAGGAGATAAAAAGAACATATGTTCTTTTTATCTCCTA0.197500.029900.517200.500001.000001.00000


Target Position: 32, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
32GACUACGACGUCCCUCAAA87.7938305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
89650GACTACGACGTCCCTCAAATTTGAGGGACGTCGTAGTC0.040500.007600.819000.750000.918500.62500


Target Position: 2016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2016UCCCCUCUCUUCCUCCCCA66.17671940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7612034TCCCCTCTCTTCCTCCCCATGGGGAGGAAGAGAGGGGA0.627200.530200.525900.500001.000001.00000


Target Position: 839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
839UGUCUGCCUCAUUCUAAAA84.1869513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
251857TGTCTGCCTCATTCTAAAATTTTAGAATGAGGCAGACA0.935800.285900.706900.750001.000001.00000


Target Position: 1798, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1798GGAAUAAAAGUUUUAUGAA99.084518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9871816GGAATAAAAGTTTTATGAATTCATAAAACTTTTATTCC0.015600.002000.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1796-1818GTGGAATAAAAGTTTTATGAATGUUCAUAAAACUUUUAUUCCACGGAAUAAAAGUUUUAUGAAUGU8.92.102


Target Position: 1605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1605CUUUUUUUUAGGAUUUUUG64.50362047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9111623CTTTTTTTTAGGATTTTTGCAAAAATCCTAAAAAAAAG0.051300.028700.491400.500001.000001.00000


Target Position: 1714, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1714CUAGCUUUGUUUAAUGUCU78.8142900

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1712-1734GGCTAGCTTTGTTTAATGTCTTAAGACAUUAAACAAAGCUAGCCCUAGCUUUGUUUAAUGUCUUAU16.118.303


Target Position: 2769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2769UGCUCAAUAAAUAUUGAUG69.23531699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8612787TGCTCAATAAATATTGATGCATCAATATTTATTGAGCA0.048400.005100.698300.500000.918500.62500


Target Position: 2495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2495GUUUAUCUCCCUUUAAAAC71.92821493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8522513GTTTATCTCCCTTTAAAACGTTTTAAAGGGAGATAAAC0.660700.453600.500000.500001.000001.00000


Target Position: 738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
738GCAAUUACUGAGAGACAAC77.7873991

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
493756GCAATTACTGAGAGACAACGTTGTCTCTCAGTAATTGC0.262200.107600.706900.750001.000001.00000


Target Position: 2548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2548UUUAAAAUCCUUCCUCUUU64.87732031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9362566TTTAAAATCCTTCCTCTTTAAAGAGGAAGGATTTTAAA0.891100.651400.500000.500001.000001.00000


Target Position: 892, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892CCACAAAUAGUUUUUUGUU82.5195618

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
890-912TCCCACAAATAGTTTTTTGTTTAAACAAAAAACUAUUUGUGGGACCACAAAUAGUUUUUUGUUUAU5.612.102


Target Position: 1454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1454AUUUUUGCUACACUCAUUU68.68081746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8131472ATTTTTGCTACACTCATTTAAATGAGTGTAGCAAAAAT0.392100.171100.508600.500001.000001.00000


Target Position: 458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
458ACUACCGUUACUUGGCUGA68.12681793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
993476ACTACCGTTACTTGGCTGATCAGCCAAGTAACGGTAGT0.012800.003800.482800.500000.902200.75000


Target Position: 549, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
549CAGCAAAAAGGAAAUGCAA91.5566144

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
547-569ATCAGCAAAAAGGAAATGCAACCUUGCAUUUCCUUUUUGCUGAUCAGCAAAAAGGAAAUGCAACCU20.018.602


Target Position: 2524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2524CUGAAUGGUCUGUCAUUGU77.65851001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7682542CTGAATGGTCTGTCATTGTACAATGACAGACCATTCAG0.387900.015400.577600.500000.983700.62500


Target Position: 1053, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053GUGGAAUUUUUAUACAAGU80.5579762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9381071GTGGAATTTTTATACAAGTACTTGTATAAAAATTCCAC0.069700.015300.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1051-1073ATGTGGAATTTTTATACAAGTTAACUUGUAUAAAAAUUCCACAUGUGGAAUUUUUAUACAAGUUAU11.620.122


Target Position: 2648, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2648CAGAAAACACCAAACAAAA94.340773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2842666CAGAAAACACCAAACAAAATTTTGTTTGGTGTTTTCTG0.550900.249400.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2646-2668TGCAGAAAACACCAAACAAAAATUUUUGUUUGGUGUUUUCUGCACAGAAAACACCAAACAAAAAUU5.613.301


Target Position: 1563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1563GUAUAUCAAGCACAGCAGU78.1315962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531581GTATATCAAGCACAGCAGTACTGCTGTGCTTGATATAC0.235200.063400.474100.500001.000001.00000


Target Position: 1779, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1779GUAUUAAAUUCAUGUAAGU85.7148421

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1777-1799GTGTATTAAATTCATGTAAGTGGACUUACAUGAAUUUAAUACACGUAUUAAAUUCAUGUAAGUGGU11.6-7.503


Target Position: 2094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2094UGUAGUGUGUUCCAUUUAA87.865303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6382112TGTAGTGTGTTCCATTTAATTAAATGGAACACACTACA0.135700.016200.672400.750001.000001.00000


Target Position: 2757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2757GUACACUGUAAAUGCUCAA88.1142286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7382775GTACACTGTAAATGCTCAATTGAGCATTTACAGTGTAC0.080100.064400.534500.750000.934800.75000


Target Position: 2017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2017CCCCUCUCUUCCUCCCCAC57.60032433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2392035CCCCTCTCTTCCTCCCCACGTGGGGAGGAAGAGAGGGG0.560600.450400.698300.750001.000001.00000


Target Position: 1946, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1946CCAAGUUUAAACACAAAAU82.3483627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1781964CCAAGTTTAAACACAAAATATTTTGTGTTTAAACTTGG0.832700.167700.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1944-1966TACCAAGTTTAAACACAAAATTTAUUUUGUGUUUAAACUUGGUACCAAGUUUAAACACAAAAUUUU12.210.311


Target Position: 420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420AGAGAGCAAAGUCUUCUAU81.63701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
969438AGAGAGCAAAGTCTTCTATATAGAAGACTTTGCTCTCT0.058200.001500.681000.750001.000001.00000


Target Position: 882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
882CCAUGCUGUCCCACAAAUA91.1895159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
846900CCATGCTGTCCCACAAATATATTTGTGGGACAGCATGG0.103700.004200.801701.000000.967400.75000


Target Position: 2061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2061UUCUGGGAGAGGGGGGGAU48.53962709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732079TTCTGGGAGAGGGGGGGATATCCCCCCCTCTCCCAGAA0.072500.010700.491400.500001.000001.00000


Target Position: 998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
998CAGUUAACAUUUAGGGAGU80.0891795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8871016CAGTTAACATTTAGGGAGTACTCCCTAAATGTTAACTG0.043700.028300.577600.500001.000001.00000


Target Position: 2672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2672AUUUUAAAAAAGGUGUAUU69.6381654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772690ATTTTAAAAAAGGTGTATTAATACACCTTTTTTAAAAT0.042000.001300.500000.500001.000001.00000


Target Position: 1816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1816AUGGACUUUUCAACUACUU70.09471620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7851834ATGGACTTTTCAACTACTTAAGTAGTTGAAAAGTCCAT0.157000.035900.517200.500001.000001.00000


Target Position: 1958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1958ACAAAAUUUAUCAUAACAA88.0505290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6611976ACAAAATTTATCATAACAATTGTTATGATAAATTTTGT0.887500.761700.560300.750001.000001.00000


Target Position: 930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
930AUGUUACUUCUAUUUGAAU79.9041812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
663948ATGTTACTTCTATTTGAATATTCAAATAGAAGTAACAT0.297600.082600.646600.500001.000001.00000


Target Position: 223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
223GCUUAUAAAAAUGUUGUAG71.78061503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
663241GCTTATAAAAATGTTGTAGCTACAACATTTTTATAAGC0.097200.019300.681000.750001.000001.00000


Target Position: 2647, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2647GCAGAAAACACCAAACAAA95.717349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1532665GCAGAAAACACCAAACAAATTTGTTTGGTGTTTTCTGC0.508600.207200.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2645-2667TTGCAGAAAACACCAAACAAAAAUUUGUUUGGUGUUUUCUGCAAGCAGAAAACACCAAACAAAAAU12.212.202


Target Position: 858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
858UUUACACAGUAGACCAUUU75.57431169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
871876TTTACACAGTAGACCATTTAAATGGTCTACTGTGTAAA0.094000.004500.500000.500001.000001.00000


Target Position: 2440, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2440CUAUUUCCCUCAUCCUAUU82.3384629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3632458CTATTTCCCTCATCCTATTAATAGGATGAGGGAAATAG0.789300.729600.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2438-2460GACTATTTCCCTCATCCTATTTAAAUAGGAUGAGGGAAAUAGUCCUAUUUCCCUCAUCCUAUUUAU19.915.503


Target Position: 673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
673GAUGAAGCCAUUGCUGAAC66.18841939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
933691GATGAAGCCATTGCTGAACGTTCAGCAATGGCTTCATC0.031000.003600.534500.500000.923901.00000


Target Position: 2522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2522UCCUGAAUGGUCUGUCAUU75.51931174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6742540TCCTGAATGGTCTGTCATTAATGACAGACCATTCAGGA0.345100.014500.862100.750000.989100.75000


Target Position: 2023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2023UCUUCCUCCCCACCCUGAA67.28631858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6762041TCTTCCTCCCCACCCTGAATTCAGGGTGGGGAGGAAGA0.372200.399500.551700.750001.000001.00000


Target Position: 426, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
426CAAAGUCUUCUAUUUGAAA95.431855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
581444CAAAGTCTTCTATTTGAAATTTCAAATAGAAGACTTTG0.178400.020000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
424-446AGCAAAGTCTTCTATTTGAAAATUUUCAAAUAGAAGACUUUGCUCAAAGUCUUCUAUUUGAAAAUU7.417.702


Target Position: 1918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1918UUCCCUCUUGGCAGCUAAU64.43192050

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9321936TTCCCTCTTGGCAGCTAATATTAGCTGCCAAGAGGGAA0.031000.007100.663800.500000.940200.75000


Target Position: 2807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2807GAUGAUAAGGGUGAGAAAC72.1291476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7462825GATGATAAGGGTGAGAAACGTTTCTCACCCTTATCATC0.183100.020500.534500.500001.000001.00000


Target Position: 2330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2330UCACCAACCAUUCUUACUU70.57091582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152348TCACCAACCATTCTTACTTAAGTAAGAATGGTTGGTGA0.083900.028200.586200.750001.000001.00000


Target Position: 1968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1968UCAUAACAAAAAUACUACU74.94611230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7821986TCATAACAAAAATACTACTAGTAGTATTTTTGTTATGA0.858200.770900.517200.500001.000001.00000


Target Position: 1615, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1615GGAUUUUUGCUUUUGUGAU85.2567444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3301633GGATTTTTGCTTTTGTGATATCACAAAAGCAAAAATCC0.491100.062100.689701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1613-1635TAGGATTTTTGCTTTTGTGATTTAUCACAAAAGCAAAAAUCCUAGGAUUUUUGCUUUUGUGAUUUU20.50.412


Target Position: 2681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2681AAGGUGUAUUUUUUCUUUU76.49041105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8822699AAGGTGTATTTTTTCTTTTAAAAGAAAAAATACACCTT0.097500.009000.637900.500001.000001.00000


Target Position: 2268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2268CCUUUAUUCUUUCUAUUUG75.03231218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2892286CCTTTATTCTTTCTATTTGCAAATAGAAAGAATAAAGG0.309400.240500.698300.750001.000001.00000


Target Position: 323, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
323GAGAAUACAGAGAGAAAAU92.6351111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
329341GAGAATACAGAGAGAAAATATTTTCTCTCTGTATTCTC0.534300.406200.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
321-343TCGAGAATACAGAGAGAAAATTGAUUUUCUCUCUGUAUUCUCGAGAGAAUACAGAGAGAAAAUUGU14.814.512


Target Position: 43, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
43CCCUCAAACCUUGCUUCUA83.336566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
71661CCCTCAAACCTTGCTTCTATAGAAGCAAGGTTTGAGGG0.083800.016400.819001.000001.000001.00000


Target Position: 2199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2199GUGCUUCCAAAUCACUUUU73.62471344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4582217GTGCTTCCAAATCACTTTTAAAAGTGATTTGGAAGCAC0.378400.036000.793100.750001.000001.00000


Target Position: 1850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1850AUGUAAAUUAGUCUUGGUU74.06571304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8801868ATGTAAATTAGTCTTGGTTAACCAAGACTAATTTACAT0.247600.015700.508600.500001.000001.00000


Target Position: 2038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2038UGAAAAAAAUGAGUUCCUA84.2611509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7342056TGAAAAAAATGAGTTCCTATAGGAACTCATTTTTTTCA0.078800.015100.551700.750001.000001.00000


Target Position: 52, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
52CUUGCUUCUAGGAGAUAAA89.1297236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
47570CTTGCTTCTAGGAGATAAATTTATCTCCTAGAAGCAAG0.271300.043400.637900.750001.000001.00000


Target Position: 58, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
58UCUAGGAGAUAAAAAGAAC69.32771690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
76176TCTAGGAGATAAAAAGAACGTTCTTTTTATCTCCTAGA0.626600.159500.577600.500001.000001.00000


Target Position: 1055, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055GGAAUUUUUAUACAAGUUA90.9852166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7481073GGAATTTTTATACAAGTTATAACTTGTATAAAAATTCC0.072900.030900.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1053-1075GTGGAATTTTTATACAAGTTATAUAACUUGUAUAAAAAUUCCACGGAAUUUUUAUACAAGUUAUAU17.80.412


Target Position: 1056, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1056GAAUUUUUAUACAAGUUAU95.766347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7281074GAATTTTTATACAAGTTATATAACTTGTATAAAAATTC0.079700.031600.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1054-1076TGGAATTTTTATACAAGTTATAAAUAACUUGUAUAAAAAUUCCAGAAUUUUUAUACAAGUUAUAAU11.8-12.012


Target Position: 2727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2727CAAUGUUUUCUGUAUGUUC79.5996836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482745CAATGTTTTCTGTATGTTCGAACATACAGAAAACATTG0.242300.014300.474100.500001.000001.00000


Target Position: 1919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1919UCCCUCUUGGCAGCUAAUG43.87192772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9911937TCCCTCTTGGCAGCTAATGCATTAGCTGCCAAGAGGGA0.012900.003600.715500.500000.967400.75000


Target Position: 2664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2664AAAAUGCCAUUUUAAAAAA83.4181562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9262682AAAATGCCATTTTAAAAAATTTTTTAAAATGGCATTTT0.110900.080600.500000.500001.000001.00000


Target Position: 2562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2562UCUUUCUUCCUCCUCUAUU67.21681863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2092580TCTTTCTTCCTCCTCTATTAATAGAGGAGGAAGAAAGA0.430400.409600.715500.750001.000001.00000


Target Position: 2067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2067GAGAGGGGGGGAUUGAUUA89.0274244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5802085GAGAGGGGGGGATTGATTATAATCAATCCCCCCCTCTC0.122400.057600.775900.750001.000001.00000


Target Position: 563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
563UGCAACCAACACAUCCUAU74.01471309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
449581TGCAACCAACACATCCTATATAGGATGTGTTGGTTGCA0.176000.125800.810300.750001.000001.00000


Target Position: 2741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2741UGUUCUAUUGUGCCUAGUA86.7008358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7722759TGTTCTATTGTGCCTAGTATACTAGGCACAATAGAACA0.146900.054700.525900.750001.000001.00000


Target Position: 1157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1157CUGCCUACAUACUGGUUUG74.52711262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9611175CTGCCTACATACTGGTTTGCAAACCAGTATGTAGGCAG0.037900.001600.637900.500000.978300.87500


Target Position: 2378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2378UGAUCUUUCUGGCUCCACU77.44821022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7782396TGATCTTTCTGGCTCCACTAGTGGAGCCAGAAAGATCA0.153200.036400.517200.500001.000001.00000


Target Position: 1625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1625UUUUGUGAUUUUUUUUUUU66.10561945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8351643TTTTGTGATTTTTTTTTTTAAAAAAAAAAATCACAAAA0.725000.426700.500000.500001.000001.00000


Target Position: 2317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2317GCCUUCUGUCUUGUCACCA78.1277965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8022335GCCTTCTGTCTTGTCACCATGGTGACAAGACAGAAGGC0.060500.010100.655200.750001.000001.00000


Target Position: 2211, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2211CACUUUUUGGUUUUUAAGA80.051798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9172229CACTTTTTGGTTTTTAAGATCTTAAAAACCAAAAAGTG0.079200.002300.569000.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2209-2231ATCACTTTTTGGTTTTTAAGAATUCUUAAAAACCAAAAAGUGAUCACUUUUUGGUUUUUAAGAAUU-3.83.202


Target Position: 399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
399GAUCCCCAAUGCUUCACAA94.866463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
986417GATCCCCAATGCTTCACAATTGTGAAGCATTGGGGATC0.015600.003300.534500.750001.000001.00000


Target Position: 1690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1690CAGGGAAAUAACUUGAGAU91.1173161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8391708CAGGGAAATAACTTGAGATATCTCAAGTTATTTCCCTG0.052600.016500.603400.750001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781CAAGGAGACGAAGCUGAAG72.11781480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
800799CAAGGAGACGAAGCTGAAGCTTCAGCTTCGTCTCCTTG0.334600.116400.508600.500001.000001.00000


Target Position: 1551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1551UCAUUACUUCAUGUAUAUC66.34641933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9801569TCATTACTTCATGTATATCGATATACATGAAGTAATGA0.058800.001200.543100.500000.978300.62500


Target Position: 1998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1998UGUUUCCAUGUCCCAUGAU69.74041644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7522016TGTTTCCATGTCCCATGATATCATGGGACATGGAAACA0.159700.055300.525900.750000.923900.75000


Target Position: 184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
184GCUGAAUUAUCCAAUGAGG73.01041402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997202GCTGAATTATCCAATGAGGCCTCATTGGATAATTCAGC0.012400.001800.508600.500000.956500.75000


Target Position: 1240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240AGGUUUGGAGCACUUACAA85.6578425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9671258AGGTTTGGAGCACTTACAATTGTAAGTGCTCCAAACCT0.048400.001500.698300.750001.000001.00000


Target Position: 381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
381UCUUUUGGAAAAGUUCUUG53.35152589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
919399TCTTTTGGAAAAGTTCTTGCAAGAACTTTTCCAAAAGA0.191000.036200.577600.500001.000001.00000


Target Position: 1679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679AAAAUAGUUAACAGGGAAA83.9036527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8551697AAAATAGTTAACAGGGAAATTTCCCTGTTAACTATTTT0.075200.015600.500000.500001.000001.00000


Target Position: 156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
156CUGCAUGAAGUCUGUAACU78.3516941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
870174CTGCATGAAGTCTGTAACTAGTTACAGACTTCATGCAG0.094800.004500.577600.500001.000001.00000


Target Position: 2265, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2265GAUCCUUUAUUCUUUCUAU96.023843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4472283GATCCTTTATTCTTTCTATATAGAAAGAATAAAGGATC0.474600.337500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2263-2285TTGATCCTTTATTCTTTCTATTTAUAGAAAGAAUAAAGGAUCAAGAUCCUUUAUUCUUUCUAUUUU11.718.701


Target Position: 2432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2432CCCACAGACUAUUUCCCUC71.6191511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2822450CCCACAGACTATTTCCCTCGAGGGAAATAGTCTGTGGG0.908800.371100.681000.750000.972800.62500


Target Position: 2673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2673UUUUAAAAAAGGUGUAUUU69.01641718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9212691TTTTAAAAAAGGTGTATTTAAATACACCTTTTTTAAAA0.084600.002300.500000.500001.000001.00000


Target Position: 517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
517UCACAACAAGCAUACCAAG67.51441835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
804535TCACAACAAGCATACCAAGCTTGGTATGCTTGTTGTGA0.563900.074400.586200.500001.000001.00000


Target Position: 1228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1228GUGGGUACUUUAAGGUUUG70.44391592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8681246GTGGGTACTTTAAGGTTTGCAAACCTTAAAGTACCCAC0.047500.005300.646600.500001.000001.00000


Target Position: 888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
888UGUCCCACAAAUAGUUUUU66.93051886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
800906TGTCCCACAAATAGTTTTTAAAAACTATTTGTGGGACA0.060700.022400.706900.750001.000001.00000


Target Position: 1889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1889AUUGUACAUUUUUUGAAAU76.50421103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8901907ATTGTACATTTTTTGAAATATTTCAAAAAATGTACAAT0.252300.172500.500000.500001.000001.00000


Target Position: 1620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1620UUUGCUUUUGUGAUUUUUU64.13172071

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8651638TTTGCTTTTGTGATTTTTTAAAAAATCACAAAAGCAAA0.556900.099000.500000.500001.000001.00000


Target Position: 2461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2461CUGCAGCAAAUCUCUCCUU75.50061176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6172479CTGCAGCAAATCTCTCCTTAAGGAGAGATTTGCTGCAG0.112800.037400.646600.750000.983700.75000


Target Position: 2502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2502UCCCUUUAAAACCCUACCU56.4422483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7552520TCCCTTTAAAACCCTACCTAGGTAGGGTTTTAAAGGGA0.581800.454500.525900.500001.000001.00000


Target Position: 1704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1704GAGAUGAUGGCUAGCUUUG72.88761417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9821722GAGATGATGGCTAGCTTTGCAAAGCTAGCCATCATCTC0.103900.034300.663800.500001.000001.00000


Target Position: 2546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2546CCUUUAAAAUCCUUCCUCU84.6065480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5372564CCTTTAAAATCCTTCCTCTAGAGGAAGGATTTTAAAGG0.895300.577400.620700.750001.000001.00000


Target Position: 592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
592CUGGCCCUUAACUUCUCUG62.05212211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
862610CTGGCCCTTAACTTCTCTGCAGAGAAGTTAAGGGCCAG0.079600.032100.500000.500001.000001.00000


Target Position: 41, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
41GUCCCUCAAACCUUGCUUC63.98672080

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
91559GTCCCTCAAACCTTGCTTCGAAGCAAGGTTTGAGGGAC0.115000.003200.646600.500001.000001.00000


Target Position: 129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
129GGCUGAGCGAUAUGAUGAC77.01031057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
937147GGCTGAGCGATATGATGACGTCATCATATCGCTCAGCC0.444700.002100.681000.750001.000001.00000


Target Position: 1851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1851UGUAAAUUAGUCUUGGUUC64.47162048

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9251869TGTAAATTAGTCTTGGTTCGAACCAAGACTAATTTACA0.117300.018800.534500.500001.000001.00000


Target Position: 960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
960CCAUGUGGUUUUUAUGUUU85.3782435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
357978CCATGTGGTTTTTATGTTTAAACATAAAAACCACATGG0.478000.055700.844801.000001.000001.00000


Target Position: 2726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2726ACAAUGUUUUCUGUAUGUU74.38551274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7372744ACAATGTTTTCTGTATGTTAACATACAGAAAACATTGT0.263900.010300.560300.750001.000001.00000


Target Position: 1458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1458UUGCUACACUCAUUUUAUU74.43781271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7281476TTGCTACACTCATTTTATTAATAAAATGAGTGTAGCAA0.355200.089400.637900.500001.000001.00000


Target Position: 2101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2101UGUUCCAUUUAAAAUUUUG64.69672038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8132119TGTTCCATTTAAAATTTTGCAAAATTTTAAATGGAACA0.227900.052900.560300.500001.000001.00000


Target Position: 2063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2063CUGGGAGAGGGGGGGAUUG53.28812591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6192081CTGGGAGAGGGGGGGATTGCAATCCCCCCCTCTCCCAG0.138200.032700.637900.500001.000001.00000


Target Position: 1411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1411CACAUUCCAUUAUUUGUAA93.127298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101429CACATTCCATTATTTGTAATTACAAATAATGGAATGTG0.198200.198100.758600.750001.000001.00000


Target Position: 2093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2093AUGUAGUGUGUUCCAUUUA82.1718644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7222111ATGTAGTGTGTTCCATTTATAAATGGAACACACTACAT0.082200.015800.620700.500001.000001.00000


Target Position: 1773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1773ACACGUGUAUUAAAUUCAU83.4836555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6901791ACACGTGTATTAAATTCATATGAATTTAATACACGTGT0.138000.013500.551700.750001.000001.00000


Target Position: 899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899UAGUUUUUUGUUUACGAUU69.61181658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
962917TAGTTTTTTGTTTACGATTAATCGTAAACAAAAAACTA0.445800.048100.663800.500001.000001.00000


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049GGAUGUGGAAUUUUUAUAC79.9482806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8701067GGATGTGGAATTTTTATACGTATAAAAATTCCACATCC0.100900.003600.689700.750001.000001.00000


Target Position: 822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
822ACCGGCCUUCCAACUUUUG51.67342638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
956840ACCGGCCTTCCAACTTTTGCAAAAGTTGGAAGGCCGGT0.069300.001700.706900.500000.945700.62500


Target Position: 2181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181GCAUUAACUGUAAGUUUUG75.63261163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482199GCATTAACTGTAAGTTTTGCAAAACTTACAGTTAATGC0.028200.006500.706900.750001.000001.00000


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737UGCAAUUACUGAGAGACAA82.3477628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
447755TGCAATTACTGAGAGACAATTGTCTCTCAGTAATTGCA0.277200.093600.706900.750001.000001.00000


Target Position: 299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
299CUGAGAAAAAACAGCAGAU83.4836554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
776317CTGAGAAAAAACAGCAGATATCTGCTGTTTTTTCTCAG0.065800.008300.603400.750000.972800.62500


Target Position: 157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
157UGCAUGAAGUCUGUAACUG63.55282119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
961175TGCATGAAGTCTGTAACTGCAGTTACAGACTTCATGCA0.098500.073300.569000.500001.000001.00000


Target Position: 1751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1751AAUCCAAGCAUAAUUGUUA88.7975250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9451769AATCCAAGCATAATTGTTATAACAATTATGCTTGGATT0.114400.018200.474100.500001.000001.00000


Target Position: 2096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2096UAGUGUGUUCCAUUUAAAA87.414320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6462114TAGTGTGTTCCATTTAAAATTTTAAATGGAACACACTA0.304800.015600.672400.500001.000001.00000


Target Position: 2561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2561CUCUUUCUUCCUCCUCUAU77.7759993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2052579CTCTTTCTTCCTCCTCTATATAGAGGAGGAAGAAAGAG0.443600.427100.767200.750001.000001.00000


Target Position: 1768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1768UAAGAACACGUGUAUUAAA89.1128239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7081786TAAGAACACGTGTATTAAATTTAATACACGTGTTCTTA0.120300.037400.534500.500001.000001.00000


Target Position: 1882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1882AAAGGAAAUUGUACAUUUU85.1796447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531900AAAGGAAATTGTACATTTTAAAATGTACAATTTCCTTT0.294500.033000.500000.500001.000001.00000


Target Position: 1819, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1819GACUUUUCAACUACUUUCU78.3162943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6591837GACTTTTCAACTACTTTCTAGAAAGTAGTTGAAAAGTC0.219200.060900.594800.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1817-1839TGGACTTTTCAACTACTTTCTCTAGAAAGUAGUUGAAAAGUCCAGACUUUUCAACUACUUUCUCUU14.613.302


Target Position: 825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
825GGCCUUCCAACUUUUGUCU73.00221405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
732843GGCCTTCCAACTTTTGTCTAGACAAAAGTTGGAAGGCC0.079100.034200.775900.750001.000001.00000


Target Position: 606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
606CUCUGUGUUCUAUUAUGAG78.4102937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
923624CTCTGTGTTCTATTATGAGCTCATAATAGAACACAGAG0.453100.002300.500000.500001.000001.00000


Target Position: 913, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
913CGAUUUAUGACAGGUUUAU81.0674730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801931CGATTTATGACAGGTTTATATAAACCTGTCATAAATCG0.060500.014700.750001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
911-933TACGATTTATGACAGGTTTATGTAUAAACCUGUCAUAAAUCGUACGAUUUAUGACAGGUUUAUGUU18.61.813


Target Position: 1971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1971UAACAAAAAUACUACUAAU89.7455209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7501989TAACAAAAATACTACTAATATTAGTAGTATTTTTGTTA0.853600.747200.525900.500001.000001.00000


Target Position: 1594, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1594CAUGUAUUUAACUUUUUUU84.9532464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3891612CATGTATTTAACTTTTTTTAAAAAAAGTTAAATACATG0.644300.483100.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1592-1614CCCATGTATTTAACTTTTTTTTAAAAAAAAGUUAAAUACAUGGGCAUGUAUUUAACUUUUUUUUAU-5.96.702


Target Position: 1755, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1755CAAGCAUAAUUGUUAAGAA103.8125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9491773CAAGCATAATTGTTAAGAATTCTTAACAATTATGCTTG0.145500.022100.474100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1753-1775TCCAAGCATAATTGTTAAGAACAUUCUUAACAAUUAUGCUUGGACAAGCAUAAUUGUUAAGAACAU14.619.703


Target Position: 1712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1712GGCUAGCUUUGUUUAAUGU84.0607518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9441730GGCTAGCTTTGTTTAATGTACATTAAACAAAGCTAGCC0.029100.011600.793100.750001.000001.00000


Target Position: 410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410CUUCACAAGCAGAGAGCAA86.638367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
919428CTTCACAAGCAGAGAGCAATTGCTCTCTGCTTGTGAAG0.096900.012400.491400.750000.945700.75000


Target Position: 993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
993AGAGCCAGUUAACAUUUAG74.30271280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6621011AGAGCCAGTTAACATTTAGCTAAATGTTAACTGGCTCT0.141100.061900.551700.500001.000001.00000


Target Position: 996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
996GCCAGUUAACAUUUAGGGA83.9599524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011014GCCAGTTAACATTTAGGGATCCCTAAATGTTAACTGGC0.436500.043700.629300.750001.000001.00000


Target Position: 503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
503GGAUUGUCGAUCAGUCACA92.452119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
906521GGATTGTCGATCAGTCACATGTGACTGATCGACAATCC0.071300.002600.663800.750001.000001.00000


Target Position: 1193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1193AGGGAUCAUUGGUUCCAGU76.6531090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9641211AGGGATCATTGGTTCCAGTACTGGAACCAATGATCCCT0.047700.001500.637900.500000.929300.62500


Target Position: 2119, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2119GGCAUAUGGCAUUUUCUAA96.862735

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2117-2139TTGGCATATGGCATTTTCTAACTUUAGAAAAUGCCAUAUGCCAAGGCAUAUGGCAUUUUCUAACUU7.121.103


Target Position: 1818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1818GGACUUUUCAACUACUUUC76.80021071

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3861836GGACTTTTCAACTACTTTCGAAAGTAGTTGAAAAGTCC0.214700.054100.698300.750001.000001.00000


Target Position: 1584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1584AACAAAAACCCAUGUAUUU76.74341078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7261602AACAAAAACCCATGTATTTAAATACATGGGTTTTTGTT0.454100.080100.646600.500001.000001.00000


Target Position: 2008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2008UCCCAUGAUCCCCUCUCUU64.99262024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1842026TCCCATGATCCCCTCTCTTAAGAGAGGGGATCATGGGA0.810900.157900.732800.750001.000001.00000


Target Position: 1410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1410UCACAUUCCAUUAUUUGUA78.8564895

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7061428TCACATTCCATTATTTGTATACAAATAATGGAATGTGA0.235500.027700.543100.750001.000001.00000


Target Position: 2077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2077GAUUGAUUAGAAAAAAAUG82.4263623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7542095GATTGATTAGAAAAAAATGCATTTTTTTCTAATCAATC0.255200.044100.525900.500001.000001.00000


Target Position: 1883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1883AAGGAAAUUGUACAUUUUU76.83891066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6831901AAGGAAATTGTACATTTTTAAAAATGTACAATTTCCTT0.321700.037500.637900.500001.000001.00000


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832CAACUUUUGUCUGCCUCAU79.558841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
924850CAACTTTTGTCTGCCTCATATGAGGCAGACAAAAGTTG0.370400.050600.491400.750001.000001.00000


Target Position: 2700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2700AGAAUGUAAGCUCCUCAAG68.07731798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9172718AGAATGTAAGCTCCTCAAGCTTGAGGAGCTTACATTCT0.054800.007300.586200.500001.000001.00000


Target Position: 423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
423GAGCAAAGUCUUCUAUUUG80.8573743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
910441GAGCAAAGTCTTCTATTTGCAAATAGAAGACTTTGCTC0.040300.002500.663800.500001.000001.00000


Target Position: 1566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1566UAUCAAGCACAGCAGUAAA87.5188316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8191584TATCAAGCACAGCAGTAAATTTACTGCTGTGCTTGATA0.516300.086800.543100.500001.000001.00000


Target Position: 823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
823CCGGCCUUCCAACUUUUGU62.79692167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
884841CCGGCCTTCCAACTTTTGTACAAAAGTTGGAAGGCCGG0.071500.003200.706900.750000.951100.62500


Target Position: 1725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1725UAAUGUCUUAUGAAAUUUU78.266950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681743TAATGTCTTATGAAATTTTAAAATTTCATAAGACATTA0.061600.002400.534500.500001.000001.00000


Target Position: 841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
841UCUGCCUCAUUCUAAAAUU72.11741481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
371859TCTGCCTCATTCTAAAATTAATTTTAGAATGAGGCAGA0.933000.282500.715500.750001.000001.00000


Target Position: 452, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
452GAGAUUACUACCGUUACUU81.8267684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
589470GAGATTACTACCGTTACTTAAGTAACGGTAGTAATCTC0.119900.020600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
450-472AGGAGATTACTACCGTTACTTGGAAGUAACGGUAGUAAUCUCCUGAGAUUACUACCGUUACUUGGU19.614.503


Target Position: 1627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1627UUGUGAUUUUUUUUUUUUU68.27291778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7121645TTGTGATTTTTTTTTTTTTAAAAAAAAAAAAATCACAA0.659200.392900.646600.500001.000001.00000


Target Position: 1580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1580GUAAAACAAAAACCCAUGU70.11931616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9471598GTAAAACAAAAACCCATGTACATGGGTTTTTGTTTTAC0.130300.098100.474100.500001.000001.00000


Target Position: 1821, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1821CUUUUCAACUACUUUCUCU80.9523734

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1819-1841GACTTTTCAACTACTTTCTCTACAGAGAAAGUAGUUGAAAAGUCCUUUUCAACUACUUUCUCUACU19.17.702


Target Position: 1417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1417CCAUUAUUUGUAAAGUUAC74.491264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6881435CCATTATTTGTAAAGTTACGTAACTTTACAAATAATGG0.090900.066100.663800.750000.994600.62500


Target Position: 246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
246CCGUAGGUCAUCUUGGAGG60.74962273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997264CCGTAGGTCATCTTGGAGGCCTCCAAGATGACCTACGG0.029200.001000.569000.500001.000001.00000


Target Position: 1775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1775ACGUGUAUUAAAUUCAUGU75.57271170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6261793ACGTGTATTAAATTCATGTACATGAATTTAATACACGT0.147100.038000.569000.500001.000001.00000


Target Position: 1876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1876UUCUCUAAAGGAAAUUGUA79.5371843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9121894TTCTCTAAAGGAAATTGTATACAATTTCCTTTAGAGAA0.097200.015800.491400.500001.000001.00000


Target Position: 2441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2441UAUUUCCCUCAUCCUAUUU67.2691859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7822459TATTTCCCTCATCCTATTTAAATAGGATGAGGGAAATA0.786000.721800.543100.500001.000001.00000


Target Position: 529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
529UACCAAGAAGCUUUUGAAA79.8242818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
814547TACCAAGAAGCTTTTGAAATTTCAAAAGCTTCTTGGTA0.057100.013600.681000.500000.978300.62500


Target Position: 1155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1155AACUGCCUACAUACUGGUU74.21521289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681173AACTGCCTACATACTGGTTAACCAGTATGTAGGCAGTT0.546800.001500.500000.500000.978300.75000


Target Position: 1077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1077GUGUUUGGCAUAGUACUUU76.29621120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7941095GTGTTTGGCATAGTACTTTAAAGTACTATGCCAAACAC0.150700.006000.793100.750001.000001.00000


Target Position: 1456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1456UUUUGCUACACUCAUUUUA71.11091547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9661474TTTTGCTACACTCATTTTATAAAATGAGTGTAGCAAAA0.411300.097600.465500.500001.000001.00000


Target Position: 1231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1231GGUACUUUAAGGUUUGGAG76.15321126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941249GGTACTTTAAGGTTTGGAGCTCCAAACCTTAAAGTACC0.012800.005500.543100.750001.000001.00000


Target Position: 793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
793GCUGAAGCAGGAGAAGGAG69.15291707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
690811GCTGAAGCAGGAGAAGGAGCTCCTTCTCCTGCTTCAGC0.135300.020100.543100.750001.000001.00000


Target Position: 2010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2010CCAUGAUCCCCUCUCUUCC66.38491930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9442028CCATGATCCCCTCTCTTCCGGAAGAGAGGGGATCATGG0.805900.177000.474100.500001.000001.00000


Target Position: 1973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1973ACAAAAAUACUACUAAUAU85.9593406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541991ACAAAAATACTACTAATATATATTAGTAGTATTTTTGT0.862200.788600.663800.750001.000001.00000


Target Position: 1872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1872AAACUUCUCUAAAGGAAAU80.3509777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9091890AAACTTCTCTAAAGGAAATATTTCCTTTAGAGAAGTTT0.037400.015300.491400.500001.000001.00000


Target Position: 2003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2003CCAUGUCCCAUGAUCCCCU74.37421275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8832021CCATGTCCCATGATCCCCTAGGGGATCATGGGACATGG0.202800.090800.500000.750000.923900.62500


Target Position: 1955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1955AACACAAAAUUUAUCAUAA93.495492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6811973AACACAAAATTTATCATAATTATGATAAATTTTGTGTT0.816700.752500.612100.500001.000001.00000


Target Position: 219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
219AGUUGCUUAUAAAAAUGUU81.8527679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
661237AGTTGCTTATAAAAATGTTAACATTTTTATAAGCAACT0.136000.015200.560300.750001.000001.00000


Target Position: 1626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1626UUUGUGAUUUUUUUUUUUU63.89362087

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8381644TTTGTGATTTTTTTTTTTTAAAAAAAAAAAATCACAAA0.689500.402700.500000.500001.000001.00000


Target Position: 1495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1495GCAACCUAAGAACAAAUGU73.81191327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4561513GCAACCTAAGAACAAATGTACATTTGTTCTTAGGTTGC0.232700.041000.646600.750001.000001.00000


Target Position: 2073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2073GGGGGAUUGAUUAGAAAAA90.9075172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3352091GGGGGATTGATTAGAAAAATTTTTCTAATCAATCCCCC0.256700.090200.991401.000001.000001.00000


Target Position: 614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
614UCUAUUAUGAGAUUCUGAA83.7681530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
699632TCTATTATGAGATTCTGAATTCAGAATCTCATAATAGA0.151800.012500.551700.750001.000001.00000


Target Position: 1570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1570AAGCACAGCAGUAAAACAA84.4525493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9091588AAGCACAGCAGTAAAACAATTGTTTTACTGCTGTGCTT0.265700.010700.491400.500001.000001.00000


Target Position: 1230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1230GGGUACUUUAAGGUUUGGA77.8698984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9831248GGGTACTTTAAGGTTTGGATCCAAACCTTAAAGTACCC0.016100.005500.620700.750001.000001.00000


Target Position: 1078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1078UGUUUGGCAUAGUACUUUU80.0126800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7891096TGTTTGGCATAGTACTTTTAAAAGTACTATGCCAAACA0.131200.006200.706900.750001.000001.00000


Target Position: 2035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2035CCCUGAAAAAAAUGAGUUC68.64971752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7192053CCCTGAAAAAAATGAGTTCGAACTCATTTTTTTCAGGG0.082600.019400.819000.750001.000001.00000


Target Position: 2720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2720GCAGGGACAAUGUUUUCUG73.64371342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562738GCAGGGACAATGTTTTCTGCAGAAAACATTGTCCCTGC0.113500.008300.569000.750001.000001.00000


Target Position: 2239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2239UACUCUUAUAGCCUGCCUU71.35131528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9452257TACTCTTATAGCCTGCCTTAAGGCAGGCTATAAGAGTA0.208500.132300.543100.500001.000001.00000


Target Position: 2605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2605UAUACCCAAAGCUCACUUU69.04421716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9232623TATACCCAAAGCTCACTTTAAAGTGAGCTTTGGGTATA0.317500.112900.543100.500001.000001.00000


Target Position: 2427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2427UGCAUCCCACAGACUAUUU69.74411642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4422445TGCATCCCACAGACTATTTAAATAGTCTGTGGGATGCA0.418900.210800.853400.750001.000001.00000


Target Position: 2722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2722AGGGACAAUGUUUUCUGUA83.5433549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7732740AGGGACAATGTTTTCTGTATACAGAAAACATTGTCCCT0.316500.006900.663800.750001.000001.00000


Target Position: 1503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1503AGAACAAAUGUAAAAGUAA94.158177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2661521AGAACAAATGTAAAAGTAATTACTTTTACATTTGTTCT0.513200.180600.689700.750001.000001.00000


Target Position: 2127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2127GCAUUUUCUAACUUAGGAA93.867185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8552145GCATTTTCTAACTTAGGAATTCCTAAGTTAGAAAATGC0.061900.004000.681001.000001.000001.00000


Target Position: 2661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2661ACAAAAAUGCCAUUUUAAA85.141452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5582679ACAAAAATGCCATTTTAAATTTAAAATGGCATTTTTGT0.128600.114700.706900.750000.994600.62500


Target Position: 1807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1807GUUUUAUGAAUGGACUUUU77.44981021

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7991825GTTTTATGAATGGACTTTTAAAAGTCCATTCATAAAAC0.060900.007700.646600.750001.000001.00000


Target Position: 369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
369UGAUGUACUGUCUCUUUUG73.09331396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
844387TGATGTACTGTCTCTTTTGCAAAAGAGACAGTACATCA0.092200.023900.577600.500001.000001.00000


Target Position: 543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
543UGAAAUCAGCAAAAAGGAA82.0065662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
720561TGAAATCAGCAAAAAGGAATTCCTTTTTGCTGATTTCA0.082500.044400.551700.750001.000001.00000


Target Position: 780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
780CCAAGGAGACGAAGCUGAA91.6926140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
352798CCAAGGAGACGAAGCTGAATTCAGCTTCGTCTCCTTGG0.245700.105100.672401.000001.000001.00000


Target Position: 1604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1604ACUUUUUUUUAGGAUUUUU71.62161509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8161622ACTTTTTTTTAGGATTTTTAAAAATCCTAAAAAAAAGT0.056600.042700.706900.750001.000001.00000


Target Position: 1983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1983UACUAAUAUAACUACUGUU83.0376584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8892001TACTAATATAACTACTGTTAACAGTAGTTATATTAGTA0.476600.437400.534500.500001.000001.00000


Target Position: 922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
922ACAGGUUUAUGUUACUUCU80.5669761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
933940ACAGGTTTATGTTACTTCTAGAAGTAACATAAACCTGT0.139600.015200.482800.500001.000001.00000


Target Position: 2534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2534UGUCAUUGUCUGCCUUUAA84.4959489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3242552TGTCATTGTCTGCCTTTAATTAAAGGCAGACAATGACA0.490800.279700.672400.750001.000001.00000


Target Position: 2530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2530GGUCUGUCAUUGUCUGCCU84.5268485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8112548GGTCTGTCATTGTCTGCCTAGGCAGACAATGACAGACC0.445500.187700.508600.750001.000001.00000


Target Position: 2042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2042AAAAAUGAGUUCCUAUUUU78.6052918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9792060AAAAATGAGTTCCTATTTTAAAATAGGAACTCATTTTT0.017100.003900.500000.500001.000001.00000


Target Position: 1722, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1722GUUUAAUGUCUUAUGAAAU88.1272285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9601740GTTTAATGTCTTATGAAATATTTCATAAGACATTAAAC0.024000.001900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1720-1742TTGTTTAATGTCTTATGAAATTTAUUUCAUAAGACAUUAAACAAGUUUAAUGUCUUAUGAAAUUUU8.9-1.402


Target Position: 1046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1046UGGGGAUGUGGAAUUUUUA83.4129564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9441064TGGGGATGTGGAATTTTTATAAAAATTCCACATCCCCA0.085600.001900.810300.750001.000001.00000


Target Position: 1870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1870UGAAACUUCUCUAAAGGAA82.2784634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9581888TGAAACTTCTCTAAAGGAATTCCTTTAGAGAAGTTTCA0.024200.016300.551700.750001.000001.00000


Target Position: 611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
611UGUUCUAUUAUGAGAUUCU77.9945974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
939629TGTTCTATTATGAGATTCTAGAATCTCATAATAGAACA0.449200.008100.482800.500001.000001.00000


Target Position: 1960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1960AAAAUUUAUCAUAACAAAA88.612258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9791978AAAATTTATCATAACAAAATTTTGTTATGATAAATTTT0.852900.749800.500000.500001.000001.00000


Target Position: 885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885UGCUGUCCCACAAAUAGUU72.4631453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
828903TGCTGTCCCACAAATAGTTAACTATTTGTGGGACAGCA0.066500.004600.706900.750001.000001.00000


Target Position: 321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
321UCGAGAAUACAGAGAGAAA89.0363242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
215339TCGAGAATACAGAGAGAAATTTCTCTCTGTATTCTCGA0.609700.369800.793100.750001.000001.00000


Target Position: 1370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1370AGUUGUGACCCAUUUUACU79.9712803

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8421388AGTTGTGACCCATTTTACTAGTAAAATGGGTCACAACT0.054500.018700.500000.500001.000001.00000


Target Position: 2409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2409CACCCUGCUUCCUUUGCUU79.5336844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6082427CACCCTGCTTCCTTTGCTTAAGCAAAGGAAGCAGGGTG0.313400.018400.655200.750000.978300.75000


Target Position: 320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
320CUCGAGAAUACAGAGAGAA84.4563492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
464338CTCGAGAATACAGAGAGAATTCTCTCTGTATTCTCGAG0.552000.341600.637900.750001.000001.00000


Target Position: 2242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2242UCUUAUAGCCUGCCUUCAA80.8658742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6032260TCTTATAGCCTGCCTTCAATTGAAGGCAGGCTATAAGA0.327400.125600.577600.750001.000001.00000


Target Position: 2092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2092AAUGUAGUGUGUUCCAUUU82.1444646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9302110AATGTAGTGTGTTCCATTTAAATGGAACACACTACATT0.049700.015700.508600.500001.000001.00000


Target Position: 1665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1665AUGCAUGUGCUGUAAAAAU77.8996980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9831683ATGCATGTGCTGTAAAAATATTTTTACAGCACATGCAT0.056600.002100.646600.500000.956500.75000


Target Position: 2024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2024CUUCCUCCCCACCCUGAAA79.0917884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4782042CTTCCTCCCCACCCTGAAATTTCAGGGTGGGGAGGAAG0.354400.383300.637900.750001.000001.00000


Target Position: 985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
985AGGGGAGUAGAGCCAGUUA87.2529331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9281003AGGGGAGTAGAGCCAGTTATAACTGGCTCTACTCCCCT0.153300.002200.810300.750001.000001.00000


Target Position: 1398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1398GGCAGAAACGGUUCACAUU87.055341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8381416GGCAGAAACGGTTCACATTAATGTGAACCGTTTCTGCC0.189600.004300.991401.000001.000001.00000


Target Position: 2614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2614AGCUCACUUUACAAAAUAU91.885132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2102632AGCTCACTTTACAAAATATATATTTTGTAAAGTGAGCT0.428600.174300.810300.750001.000001.00000


Target Position: 1693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1693GGAAAUAACUUGAGAUGAU95.547852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6421711GGAAATAACTTGAGATGATATCATCTCAAGTTATTTCC0.103900.030100.689701.000001.000001.00000


Target Position: 2039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2039GAAAAAAAUGAGUUCCUAU94.167776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9452057GAAAAAAATGAGTTCCTATATAGGAACTCATTTTTTTC0.028900.012500.629300.750001.000001.00000


Target Position: 2075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2075GGGAUUGAUUAGAAAAAAA98.979919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4232093GGGATTGATTAGAAAAAAATTTTTTTCTAATCAATCCC0.326000.042800.991401.000001.000001.00000


Target Position: 317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
317UGGCUCGAGAAUACAGAGA69.79531638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
798335TGGCTCGAGAATACAGAGATCTCTGTATTCTCGAGCCA0.484100.005600.620700.500001.000001.00000


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778ACCCAAGGAGACGAAGCUG59.19812354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
839796ACCCAAGGAGACGAAGCTGCAGCTTCGTCTCCTTGGGT0.184300.066100.569000.500001.000001.00000


Target Position: 1917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1917AUUCCCUCUUGGCAGCUAA77.9706975

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9711935ATTCCCTCTTGGCAGCTAATTAGCTGCCAAGAGGGAAT0.020000.010900.474100.500000.940200.87500


Target Position: 1629, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1629GUGAUUUUUUUUUUUUUUU73.43721370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3961647GTGATTTTTTTTTTTTTTTAAAAAAAAAAAAAAATCAC0.604900.418900.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1627-1649TTGTGATTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAUCACAAGUGAUUUUUUUUUUUUUUUUUU-11.37.400


Target Position: 1412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1412ACAUUCCAUUAUUUGUAAA86.0993396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5501430ACATTCCATTATTTGTAAATTTACAAATAATGGAATGT0.130500.132200.706900.750001.000001.00000


Target Position: 372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
372UGUACUGUCUCUUUUGGAA86.7152356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
728390TGTACTGTCTCTTTTGGAATTCCAAAAGAGACAGTACA0.211700.053200.534500.750001.000001.00000


Target Position: 864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
864CAGUAGACCAUUUGUCAUC73.58471350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
767882CAGTAGACCATTTGTCATCGATGACAAATGGTCTACTG0.335700.007200.603400.500000.918500.87500


Target Position: 2388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2388GGCUCCACUCAGUGUCUAA98.083525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922406GGCTCCACTCAGTGTCTAATTAGACACTGAGTGGAGCC0.012800.003700.965501.000000.972801.00000


Target Position: 1311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1311UGUGGAAUACUCAAUGUGU78.2374952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9751329TGTGGAATACTCAATGTGTACACATTGAGTATTCCACA0.085100.001300.500000.500001.000001.00000


Target Position: 1590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1590AACCCAUGUAUUUAACUUU78.781904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771608AACCCATGTATTTAACTTTAAAGTTAAATACATGGGTT0.675500.081800.646600.500001.000001.00000


Target Position: 2659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2659AAACAAAAAUGCCAUUUUA90.2525190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9882677AAACAAAAATGCCATTTTATAAAATGGCATTTTTGTTT0.128500.135800.465500.500000.962000.62500


Target Position: 2249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2249GCCUGCCUUCAAUUUUGAU79.236867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3882267GCCTGCCTTCAATTTTGATATCAAAATTGAAGGCAGGC0.212000.187900.819001.000001.000001.00000


Target Position: 1805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1805AAGUUUUAUGAAUGGACUU76.02921134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9331823AAGTTTTATGAATGGACTTAAGTCCATTCATAAAACTT0.039500.003900.500000.500001.000001.00000


Target Position: 2307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2307UCCUGUUUUAGCCUUCUGU63.00082156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6422325TCCTGTTTTAGCCTTCTGTACAGAAGGCTAAAACAGGA0.226900.146100.663800.500001.000001.00000


Target Position: 2269, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2269CUUUAUUCUUUCUAUUUGU79.6587832

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2267-2289TCCTTTATTCTTTCTATTTGTCAACAAAUAGAAAGAAUAAAGGACUUUAUUCUUUCUAUUUGUCAU3.52.102


Target Position: 2408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2408GCACCCUGCUUCCUUUGCU73.92441316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8932426GCACCCTGCTTCCTTTGCTAGCAAAGGAAGCAGGGTGC0.350600.007700.500000.750000.978300.75000


Target Position: 2099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2099UGUGUUCCAUUUAAAAUUU73.74951332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4522117TGTGTTCCATTTAAAATTTAAATTTTAAATGGAACACA0.774600.036600.706900.750001.000001.00000


Target Position: 1602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1602UAACUUUUUUUUAGGAUUU69.95471626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7481620TAACTTTTTTTTAGGATTTAAATCCTAAAAAAAAGTTA0.121600.075900.534500.500001.000001.00000


Target Position: 368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
368AUGAUGUACUGUCUCUUUU76.41881110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
948386ATGATGTACTGTCTCTTTTAAAAGAGACAGTACATCAT0.094900.021900.655200.500001.000001.00000


Target Position: 1440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1440UGUUAGCUUUCAUUAUUUU79.2565865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8791458TGTTAGCTTTCATTATTTTAAAATAATGAAAGCTAACA0.626900.003300.706900.750001.000001.00000


Target Position: 951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951CUAUAUUUCCCAUGUGGUU79.2619864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
779969CTATATTTCCCATGTGGTTAACCACATGGGAAATATAG0.065100.006600.525900.750000.956500.75000


Target Position: 155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
155CCUGCAUGAAGUCUGUAAC72.171474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
780173CCTGCATGAAGTCTGTAACGTTACAGACTTCATGCAGG0.142700.006500.698300.750001.000001.00000


Target Position: 1864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1864UGGUUCUGAAACUUCUCUA81.4351715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571882TGGTTCTGAAACTTCTCTATAGAGAAGTTTCAGAACCA0.284800.089300.672400.750001.000001.00000


Target Position: 2327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2327UUGUCACCAACCAUUCUUA79.7021827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9412345TTGTCACCAACCATTCTTATAAGAATGGTTGGTGACAA0.596400.027400.612100.500001.000001.00000


Target Position: 1630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1630UGAUUUUUUUUUUUUUUUU69.34341687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051648TGATTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAATCA0.597400.503900.724100.750001.000001.00000


Target Position: 2445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2445UCCCUCAUCCUAUUUACUG57.79572421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7332463TCCCTCATCCTATTTACTGCAGTAAATAGGATGAGGGA0.232400.236100.586200.500001.000001.00000


Target Position: 2649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2649AGAAAACACCAAACAAAAA89.1945235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4532667AGAAAACACCAAACAAAAATTTTTGTTTGGTGTTTTCT0.544400.299400.724100.750001.000001.00000


Target Position: 1784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1784AAAUUCAUGUAAGUGGAAU75.34681192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9331802AAATTCATGTAAGTGGAATATTCCACTTACATGAATTT0.078500.002100.491400.500001.000001.00000


Target Position: 1350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1350AGAAGUGUUCCUUUAGACA87.9364296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8061368AGAAGTGTTCCTTTAGACATGTCTAAAGGAACACTTCT0.091500.018200.517200.500001.000001.00000


Target Position: 512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512AUCAGUCACAACAAGCAUA83.938526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
971530ATCAGTCACAACAAGCATATATGCTTGTTGTGACTGAT0.182200.013000.637900.500001.000001.00000


Target Position: 1013, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1013GAGUUAUCUGUUUUCAUCU87.4093321

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1011-1033GGGAGTTATCTGTTTTCATCTTGAGAUGAAAACAGAUAACUCCCGAGUUAUCUGUUUUCAUCUUGU16.314.512


Target Position: 846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
846CUCAUUCUAAAAUUUACAC66.05981949

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
985864CTCATTCTAAAATTTACACGTGTAAATTTTAGAATGAG0.461100.494600.517200.500001.000001.00000


Target Position: 678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
678AGCCAUUGCUGAACUUGAU81.6607699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
560696AGCCATTGCTGAACTTGATATCAAGTTCAGCAATGGCT0.211100.021500.672400.750000.940200.62500


Target Position: 395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
395UCUUGAUCCCCAAUGCUUC61.12242255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
989413TCTTGATCCCCAATGCTTCGAAGCATTGGGGATCAAGA0.013800.004000.551700.500001.000001.00000


Target Position: 838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
838UUGUCUGCCUCAUUCUAAA82.7588599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
841856TTGTCTGCCTCATTCTAAATTTAGAATGAGGCAGACAA0.928800.279100.646600.500001.000001.00000


Target Position: 2095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2095GUAGUGUGUUCCAUUUAAA96.963732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6342113GTAGTGTGTTCCATTTAAATTTAAATGGAACACACTAC0.153400.016300.681000.750001.000001.00000


Target Position: 2411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2411CCCUGCUUCCUUUGCUUGC51.50262641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7422429CCCTGCTTCCTTTGCTTGCGCAAGCAAAGGAAGCAGGG0.087400.014900.637900.500000.978301.00000


Target Position: 177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
177GCAAGGAGCUGAAUUAUCC75.06151217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
951195GCAAGGAGCTGAATTATCCGGATAATTCAGCTCCTTGC0.055000.001800.482800.500000.956500.62500


Target Position: 1944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1944UACCAAGUUUAAACACAAA86.252387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7911962TACCAAGTTTAAACACAAATTTGTGTTTAAACTTGGTA0.806400.089400.681000.500001.000001.00000


Target Position: 729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
729GCUAAUAAUGCAAUUACUG75.47661179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
640747GCTAATAATGCAATTACTGCAGTAATTGCATTATTAGC0.202000.018900.569000.750001.000001.00000


Target Position: 1948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1948AAGUUUAAACACAAAAUUU82.0302660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9351966AAGTTTAAACACAAAATTTAAATTTTGTGTTTAAACTT0.826700.657400.637900.500001.000001.00000


Target Position: 1406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1406CGGUUCACAUUCCAUUAUU83.2011572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541424CGGTTCACATTCCATTATTAATAATGGAATGTGAACCG0.576100.056100.905201.000000.978300.75000


Target Position: 366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
366CAAUGAUGUACUGUCUCUU87.1276336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801384CAATGATGTACTGTCTCTTAAGAGACAGTACATCATTG0.092900.019400.508600.750001.000001.00000


Target Position: 992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
992UAGAGCCAGUUAACAUUUA80.6553754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7271010TAGAGCCAGTTAACATTTATAAATGTTAACTGGCTCTA0.177200.074800.637900.500001.000001.00000


Target Position: 1468, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1468CAUUUUAUUUGUAUUUAAA98.488423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571486CATTTTATTTGTATTTAAATTTAAATACAAATAAAATG0.172000.129500.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1466-1488CTCATTTTATTTGTATTTAAATGUUUAAAUACAAAUAAAAUGAGCAUUUUAUUUGUAUUUAAAUGU-7.5-10.301


Target Position: 1814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1814GAAUGGACUUUUCAACUAC82.6704607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9071832GAATGGACTTTTCAACTACGTAGTTGAAAAGTCCATTC0.111400.024500.491400.500001.000001.00000


Target Position: 1565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1565AUAUCAAGCACAGCAGUAA85.1077453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9181583ATATCAAGCACAGCAGTAATTACTGCTGTGCTTGATAT0.491300.078500.508600.500001.000001.00000


Target Position: 870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
870ACCAUUUGUCAUCCAUGCU68.49821763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
872888ACCATTTGTCATCCATGCTAGCATGGATGACAAATGGT0.105300.057800.500000.500001.000001.00000


Target Position: 1324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1324AUGUGUACACCUUUGACUA87.9479295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9271342ATGTGTACACCTTTGACTATAGTCAAAGGTGTACACAT0.064300.005000.482800.500001.000001.00000


Target Position: 610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
610GUGUUCUAUUAUGAGAUUC68.45971765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
772628GTGTTCTATTATGAGATTCGAATCTCATAATAGAACAC0.453200.006900.620700.500001.000001.00000


Target Position: 959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
959CCCAUGUGGUUUUUAUGUU78.1887956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364977CCCATGTGGTTTTTATGTTAACATAAAAACCACATGGG0.460100.054000.844801.000000.956500.75000


Target Position: 1574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1574ACAGCAGUAAAACAAAAAC65.88411963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8331592ACAGCAGTAAAACAAAAACGTTTTTGTTTTACTGCTGT0.218800.186800.560300.500001.000001.00000


Target Position: 2074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2074GGGGAUUGAUUAGAAAAAA92.555115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3452092GGGGATTGATTAGAAAAAATTTTTTCTAATCAATCCCC0.345400.057700.991401.000001.000001.00000


Target Position: 774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
774GGAUACCCAAGGAGACGAA90.2823188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
431792GGATACCCAAGGAGACGAATTCGTCTCCTTGGGTATCC0.261700.040500.698301.000001.000001.00000


Target Position: 1203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1203GGUUCCAGUCACAGGUGUA96.427440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3841221GGTTCCAGTCACAGGTGTATACACCTGTGACTGGAACC0.385500.048400.672401.000000.972801.00000


Target Position: 1351, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1351GAAGUGUUCCUUUAGACAA95.534253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7461369GAAGTGTTCCTTTAGACAATTGTCTAAAGGAACACTTC0.098300.020100.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1349-1371CAGAAGTGTTCCTTTAGACAAAGUUGUCUAAAGGAACACUUCUGGAAGUGUUCCUUUAGACAAAGU20.317.812


Target Position: 53, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
53UUGCUUCUAGGAGAUAAAA73.23761385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86871TTGCTTCTAGGAGATAAAATTTTATCTCCTAGAAGCAA0.530600.047300.646600.500001.000001.00000


Target Position: 827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
827CCUUCCAACUUUUGUCUGC60.83812267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
915845CCTTCCAACTTTTGTCTGCGCAGACAAAAGTTGGAAGG0.062000.015300.491400.500001.000001.00000


Target Position: 1134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1134CUUCCAUGUCUAAGCAAAG73.35781377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8661152CTTCCATGTCTAAGCAAAGCTTTGCTTAGACATGGAAG0.103400.021100.500000.500001.000001.00000


Target Position: 1886, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1886GAAAUUGUACAUUUUUUGA88.6086259

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1884-1906AGGAAATTGTACATTTTTTGAAAUCAAAAAAUGUACAAUUUCCUGAAAUUGUACAUUUUUUGAAAU-2.95.312


Target Position: 886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
886GCUGUCCCACAAAUAGUUU77.7562994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
816904GCTGTCCCACAAATAGTTTAAACTATTTGTGGGACAGC0.064700.004900.853401.000001.000001.00000


Target Position: 831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831CCAACUUUUGUCUGCCUCA84.367500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
540849CCAACTTTTGTCTGCCTCATGAGGCAGACAAAAGTTGG0.370600.045700.620700.750001.000001.00000


Target Position: 2500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2500UCUCCCUUUAAAACCCUAC51.68312636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7222518TCTCCCTTTAAAACCCTACGTAGGGTTTTAAAGGGAGA0.577000.421700.543100.500001.000001.00000


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682AUAGUUAACAGGGAAAUAA82.8058597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8071700ATAGTTAACAGGGAAATAATTATTTCCCTGTTAACTAT0.180500.020500.508600.500001.000001.00000


Target Position: 2435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2435ACAGACUAUUUCCCUCAUC63.82942094

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7782453ACAGACTATTTCCCTCATCGATGAGGGAAATAGTCTGT0.887800.411900.525900.500001.000001.00000


Target Position: 183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
183AGCUGAAUUAUCCAAUGAG75.35291190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
935201AGCTGAATTATCCAATGAGCTCATTGGATAATTCAGCT0.038300.002100.543100.500001.000001.00000


Target Position: 2256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2256UUCAAUUUUGAUCCUUUAU63.32852138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9602274TTCAATTTTGATCCTTTATATAAAGGATCAAAATTGAA0.836600.165200.629300.500001.000001.00000


Target Position: 2513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2513CCCUACCUAUCCUGAAUGG62.67772174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9682531CCCTACCTATCCTGAATGGCCATTCAGGATAGGTAGGG0.021800.021500.646600.500000.989100.75000


Target Position: 2751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2751UGCCUAGUACACUGUAAAU81.4784711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9132769TGCCTAGTACACTGTAAATATTTACAGTGTACTAGGCA0.204200.002400.844800.750001.000001.00000


Target Position: 1975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1975AAAAAUACUACUAAUAUAA92.8518105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9701993AAAAATACTACTAATATAATTATATTAGTAGTATTTTT0.605500.539000.465500.500001.000001.00000


Target Position: 1894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1894ACAUUUUUUGAAAUUUAUU74.75871248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3541912ACATTTTTTGAAATTTATTAATAAATTTCAAAAAATGT0.242900.127800.698300.750001.000001.00000


Target Position: 1497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1497AACCUAAGAACAAAUGUAA88.1315284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9951515AACCTAAGAACAAATGTAATTACATTTGTTCTTAGGTT0.310200.074800.612100.500001.000001.00000


Target Position: 1962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1962AAUUUAUCAUAACAAAAAU85.3383439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8391980AATTTATCATAACAAAAATATTTTTGTTATGATAAATT0.845500.744800.500000.500001.000001.00000


Target Position: 2467, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2467CAAAUCUCUCCUUAGUUGA83.2449570

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2465-2487AGCAAATCTCTCCTTAGTTGATGUCAACUAAGGAGAGAUUUGCUCAAAUCUCUCCUUAGUUGAUGU11.814.802


Target Position: 1982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1982CUACUAAUAUAACUACUGU88.3645270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9832000CTACTAATATAACTACTGTACAGTAGTTATATTAGTAG0.474300.440900.465500.500001.000001.00000


Target Position: 718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
718AAAGACAGCACGCUAAUAA85.6706424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
985736AAAGACAGCACGCTAATAATTATTAGCGTGCTGTCTTT0.200200.021800.465500.500001.000001.00000


Target Position: 441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
441GAAAAUGAAAGGAGAUUAC75.6951158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
898459GAAAATGAAAGGAGATTACGTAATCTCCTTTCATTTTC0.043600.015300.491400.500001.000001.00000


Target Position: 2447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2447CCUCAUCCUAUUUACUGCA84.1412514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9012465CCTCATCCTATTTACTGCATGCAGTAAATAGGATGAGG0.157000.152800.491400.750001.000001.00000


Target Position: 2106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2106CAUUUAAAAUUUUGGCAUA93.330996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5472124CATTTAAAATTTTGGCATATATGCCAAAATTTTAAATG0.131500.098000.612100.750001.000001.00000


Target Position: 1875, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1875CUUCUCUAAAGGAAAUUGU69.88161634

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1873-1895AACTTCTCTAAAGGAAATTGTACACAAUUUCCUUUAGAGAAGUUCUUCUCUAAAGGAAAUUGUACU7.420.202


Target Position: 1184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1184GGGAAUAAAAGGGAUCAUU80.484768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7061202GGGAATAAAAGGGATCATTAATGATCCCTTTTATTCCC0.085900.059100.982801.000001.000001.00000


Target Position: 1680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1680AAAUAGUUAACAGGGAAAU71.57891515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9061698AAATAGTTAACAGGGAAATATTTCCCTGTTAACTATTT0.062700.027600.491400.500001.000001.00000


Target Position: 1493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1493AGGCAACCUAAGAACAAAU81.2302722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6031511AGGCAACCTAAGAACAAATATTTGTTCTTAGGTTGCCT0.161900.018600.836200.750001.000001.00000


Target Position: 1346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1346CUGCAGAAGUGUUCCUUUA90.2433191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8641364CTGCAGAAGTGTTCCTTTATAAAGGAACACTTCTGCAG0.048100.011900.750000.750000.978300.87500


Target Position: 394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
394UUCUUGAUCCCCAAUGCUU65.36622002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
985412TTCTTGATCCCCAATGCTTAAGCATTGGGGATCAAGAA0.015700.003600.534500.500001.000001.00000


Target Position: 1902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1902UGAAAUUUAUUCCUUAUUC65.71581976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6661920TGAAATTTATTCCTTATTCGAATAAGGAATAAATTTCA0.303700.210100.551700.500000.989100.62500


Target Position: 2483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2483UGAUGAGACUGUGUUUAUC71.89441494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9342501TGATGAGACTGTGTTTATCGATAAACACAGTCTCATCA0.109800.002100.543100.500001.000001.00000


Target Position: 2064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2064UGGGAGAGGGGGGGAUUGA62.10042206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9322082TGGGAGAGGGGGGGATTGATCAATCCCCCCCTCTCCCA0.119800.043800.620700.500001.000001.00000


Target Position: 2080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2080UGAUUAGAAAAAAAUGUAG69.46931673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6632098TGATTAGAAAAAAATGTAGCTACATTTTTTTCTAATCA0.135800.044400.551700.500001.000001.00000


Target Position: 1469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1469AUUUUAUUUGUAUUUAAAU77.31791030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9541487ATTTTATTTGTATTTAAATATTTAAATACAAATAAAAT0.276400.046700.500000.500001.000001.00000


Target Position: 1577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1577GCAGUAAAACAAAAACCCA90.5253183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8101595GCAGTAAAACAAAAACCCATGGGTTTTTGTTTTACTGC0.411400.173500.508600.750001.000001.00000


Target Position: 887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
887CUGUCCCACAAAUAGUUUU74.10571299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
749905CTGTCCCACAAATAGTTTTAAAACTATTTGTGGGACAG0.096300.009100.784500.750001.000001.00000


Target Position: 1746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1746UGAACAAUCCAAGCAUAAU77.9533978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8081764TGAACAATCCAAGCATAATATTATGCTTGGATTGTTCA0.058900.018300.715500.750001.000001.00000


Target Position: 318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
318GGCUCGAGAAUACAGAGAG78.0725970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
652336GGCTCGAGAATACAGAGAGCTCTCTGTATTCTCGAGCC0.522100.015300.689700.750001.000001.00000


Target Position: 2571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2571CUCCUCUAUUCUCUAAAUA87.6922309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3282589CTCCTCTATTCTCTAAATATATTTAGAGAATAGAGGAG0.557400.270800.767200.750001.000001.00000


Target Position: 312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
312GCAGAUGGCUCGAGAAUAC79.1971872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
711330GCAGATGGCTCGAGAATACGTATTCTCGAGCCATCTGC0.535600.012000.672400.750001.000001.00000


Target Position: 1124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1124UGUAAAACUGCUUCCAUGU69.69451649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9701142TGTAAAACTGCTTCCATGTACATGGAAGCAGTTTTACA0.046300.006800.500000.500001.000001.00000


Target Position: 2660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2660AACAAAAAUGCCAUUUUAA85.8829410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9132678AACAAAAATGCCATTTTAATTAAAATGGCATTTTTGTT0.125100.125300.612100.500000.978300.62500


Target Position: 2657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2657CCAAACAAAAAUGCCAUUU65.46091997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5142675CCAAACAAAAATGCCATTTAAATGGCATTTTTGTTTGG0.144100.158200.844801.000000.962000.87500


Target Position: 821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
821AACCGGCCUUCCAACUUUU72.11951478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
967839AACCGGCCTTCCAACTTTTAAAAGTTGGAAGGCCGGTT0.189300.004900.646600.500000.945700.75000


Target Position: 1999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1999GUUUCCAUGUCCCAUGAUC68.87221726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9862017GTTTCCATGTCCCATGATCGATCATGGGACATGGAAAC0.169600.076400.465500.500000.923900.87500


Target Position: 2675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2675UUAAAAAAGGUGUAUUUUU69.50861666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8972693TTAAAAAAGGTGTATTTTTAAAAATACACCTTTTTTAA0.165300.002900.534500.500001.000001.00000


Target Position: 324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
324AGAAUACAGAGAGAAAAUU78.1294964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
178342AGAATACAGAGAGAAAATTAATTTTCTCTCTGTATTCT0.529700.416900.715500.750001.000001.00000


Target Position: 2761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2761ACUGUAAAUGCUCAAUAAA87.9545294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7982779ACTGTAAATGCTCAATAAATTTATTGAGCATTTACAGT0.061000.043800.706900.750001.000001.00000


Target Position: 300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
300UGAGAAAAAACAGCAGAUG61.32222250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
953318TGAGAAAAAACAGCAGATGCATCTGCTGTTTTTTCTCA0.026800.004500.569000.500001.000001.00000


Target Position: 1771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1771GAACACGUGUAUUAAAUUC76.61161093

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8411789GAACACGTGTATTAAATTCGAATTTAATACACGTGTTC0.135200.019000.500000.500001.000001.00000


Target Position: 1792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1792GUAAGUGGAAUAAAAGUUU80.3928774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9251810GTAAGTGGAATAAAAGTTTAAACTTTTATTCCACTTAC0.033000.016900.681000.750001.000001.00000


Target Position: 50, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
50ACCUUGCUUCUAGGAGAUA76.68911085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
50468ACCTTGCTTCTAGGAGATATATCTCCTAGAAGCAAGGT0.244100.029700.810300.750000.967400.62500


Target Position: 2414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2414UGCUUCCUUUGCUUGCAUC59.11122359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8312432TGCTTCCTTTGCTTGCATCGATGCAAGCAAAGGAAGCA0.114200.035400.672400.500000.978300.75000


Target Position: 1496, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1496CAACCUAAGAACAAAUGUA97.388731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9911514CAACCTAAGAACAAATGTATACATTTGTTCTTAGGTTG0.240700.064200.465500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1494-1516GGCAACCTAAGAACAAATGTAAAUACAUUUGUUCUUAGGUUGCCCAACCUAAGAACAAAUGUAAAU12.118.602


Target Position: 1871, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1871GAAACUUCUCUAAAGGAAA94.082280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9591889GAAACTTCTCTAAAGGAAATTTCCTTTAGAGAAGTTTC0.024200.015800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1869-1891CTGAAACTTCTCTAAAGGAAATTUUUCCUUUAGAGAAGUUUCAGGAAACUUCUCUAAAGGAAAUUU18.713.302


Target Position: 2419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2419CCUUUGCUUGCAUCCCACA80.4188771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4522437CCTTTGCTTGCATCCCACATGTGGGATGCAAGCAAAGG0.233700.069300.637900.750001.000001.00000


Target Position: 376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
376CUGUCUCUUUUGGAAAAGU73.59551349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
848394CTGTCTCTTTTGGAAAAGTACTTTTCCAAAAGAGACAG0.094500.004100.577600.500000.967400.62500


Target Position: 2258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2258CAAUUUUGAUCCUUUAUUC79.3032859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9462276CAATTTTGATCCTTTATTCGAATAAAGGATCAAAATTG0.670100.212900.474100.500001.000001.00000


Target Position: 989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
989GAGUAGAGCCAGUUAACAU98.199624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7901007GAGTAGAGCCAGTTAACATATGTTAACTGGCTCTACTC0.220100.006200.655200.750001.000001.00000


Target Position: 804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
804AGAAGGAGGGGAAAAUUAA89.0454241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
813822AGAAGGAGGGGAAAATTAATTAATTTTCCCCTCCTTCT0.954200.005000.689700.750001.000001.00000


Target Position: 2326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2326CUUGUCACCAACCAUUCUU71.58821514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8952344CTTGTCACCAACCATTCTTAAGAATGGTTGGTGACAAG0.600500.029100.500000.750000.989100.62500


Target Position: 890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
890UCCCACAAAUAGUUUUUUG60.21452300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
754908TCCCACAAATAGTTTTTTGCAAAAAACTATTTGTGGGA0.072200.016400.724100.500001.000001.00000


Target Position: 1735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1735UGAAAUUUUCAUGAACAAU73.92071317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8471753TGAAATTTTCATGAACAATATTGTTCATGAAAATTTCA0.050300.015000.715500.750001.000001.00000


Target Position: 44, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
44CCUCAAACCUUGCUUCUAG77.23161038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
66962CCTCAAACCTTGCTTCTAGCTAGAAGCAAGGTTTGAGG0.107600.014700.672400.750001.000001.00000


Target Position: 2190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2190GUAAGUUUUGUGCUUCCAA88.5809261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9302208GTAAGTTTTGTGCTTCCAATTGGAAGCACAAAACTTAC0.031300.003600.534500.750000.978300.62500


Target Position: 2680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2680AAAGGUGUAUUUUUUCUUU80.0996794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992698AAAGGTGTATTTTTTCTTTAAAGAAAAAATACACCTTT0.086000.006600.500000.500001.000001.00000


Target Position: 843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
843UGCCUCAUUCUAAAAUUUA79.1579876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
83861TGCCTCATTCTAAAATTTATAAATTTTAGAATGAGGCA0.917100.673400.819000.750001.000001.00000


Target Position: 2806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2806UGAUGAUAAGGGUGAGAAA92.0951126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5492824TGATGATAAGGGTGAGAAATTTCTCACCCTTATCATCA0.207200.022400.724100.750001.000001.00000


Target Position: 605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
605UCUCUGUGUUCUAUUAUGA81.6699698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
833623TCTCTGTGTTCTATTATGATCATAATAGAACACAGAGA0.459100.004900.500000.500001.000001.00000


Target Position: 1832, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1832CUUUCUCUACAGCUUUUCA87.6621311

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1830-1852TACTTTCTCTACAGCTTTTCATGUGAAAAGCUGUAGAGAAAGUACUUUCUCUACAGCUUUUCAUGU21.019.101


Target Position: 1614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1614AGGAUUUUUGCUUUUGUGA75.16651206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7291632AGGATTTTTGCTTTTGTGATCACAAAAGCAAAAATCCT0.473400.053000.620700.500001.000001.00000


Target Position: 217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
217UCAGUUGCUUAUAAAAAUG65.58111988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
630235TCAGTTGCTTATAAAAATGCATTTTTATAAGCAACTGA0.166600.043500.569000.500001.000001.00000


Target Position: 33, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
33ACUACGACGUCCCUCAAAC66.76581904

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95051ACTACGACGTCCCTCAAACGTTTGAGGGACGTCGTAGT0.027300.004200.560300.500001.000001.00000


Target Position: 1027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1027CAUCUUGAGGUGGCCAAUA83.7943529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8931045CATCTTGAGGTGGCCAATATATTGGCCACCTCAAGATG0.043500.002900.612100.750001.000001.00000


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779CCCAAGGAGACGAAGCUGA75.61811165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
397797CCCAAGGAGACGAAGCTGATCAGCTTCGTCTCCTTGGG0.209400.094300.767200.750001.000001.00000


Target Position: 1663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1663ACAUGCAUGUGCUGUAAAA91.0049163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9521681ACATGCATGTGCTGTAAAATTTTACAGCACATGCATGT0.040100.001800.706900.750000.913000.62500


Target Position: 1757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1757AGCAUAAUUGUUAAGAACA84.5587483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8671775AGCATAATTGTTAAGAACATGTTCTTAACAATTATGCT0.061800.013100.646600.500001.000001.00000


Target Position: 845, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
845CCUCAUUCUAAAAUUUACA85.6474427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487863CCTCATTCTAAAATTTACATGTAAATTTTAGAATGAGG0.547300.569300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
843-865TGCCTCATTCTAAAATTTACACAUGUAAAUUUUAGAAUGAGGCACCUCAUUCUAAAAUUUACACAU-0.320.402


Target Position: 2503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2503CCCUUUAAAACCCUACCUA83.4901553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
912521CCCTTTAAAACCCTACCTATAGGTAGGGTTTTAAAGGG0.617900.447600.819001.000001.000001.00000


Target Position: 2760, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2760CACUGUAAAUGCUCAAUAA104.6424

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2758-2780TACACTGTAAATGCTCAATAAATUUAUUGAGCAUUUACAGUGUACACUGUAAAUGCUCAAUAAAUU13.419.001


Target Position: 502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
502GGGAUUGUCGAUCAGUCAC72.60741447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
972520GGGATTGTCGATCAGTCACGTGACTGATCGACAATCCC0.065800.001400.698300.750001.000001.00000


Target Position: 702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
702AAGUGAAGAGUCAUACAAA99.974714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
931720AAGTGAAGAGTCATACAAATTTGTATGACTCTTCACTT0.115400.002100.637900.500001.000001.00000


Target Position: 1785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1785AAUUCAUGUAAGUGGAAUA92.3504123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941803AATTCATGTAAGTGGAATATATTCCACTTACATGAATT0.060500.001600.465500.500001.000001.00000


Target Position: 862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
862CACAGUAGACCAUUUGUCA94.120179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
821880CACAGTAGACCATTTGTCATGACAAATGGTCTACTGTG0.329100.004800.569000.500000.918500.62500


Target Position: 1945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1945ACCAAGUUUAAACACAAAA77.45031020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2251963ACCAAGTTTAAACACAAAATTTTGTGTTTAAACTTGGT0.826400.117900.853400.750001.000001.00000


Target Position: 1137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1137CCAUGUCUAAGCAAAGAAA94.179475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5251155CCATGTCTAAGCAAAGAAATTTCTTTGCTTAGACATGG0.138900.058100.844801.000000.989100.75000


Target Position: 2431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2431UCCCACAGACUAUUUCCCU63.05532152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7472449TCCCACAGACTATTTCCCTAGGGAAATAGTCTGTGGGA0.913600.364600.525900.500001.000001.00000


Target Position: 1416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1416UCCAUUAUUUGUAAAGUUA81.818687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7021434TCCATTATTTGTAAAGTTATAACTTTACAAATAATGGA0.087000.074500.836200.750001.000001.00000


Target Position: 2448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2448CUCAUCCUAUUUACUGCAG64.3662054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7532466CTCATCCTATTTACTGCAGCTGCAGTAAATAGGATGAG0.127500.123600.525900.500001.000001.00000


Target Position: 1500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1500CUAAGAACAAAUGUAAAAG71.11931544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8751518CTAAGAACAAATGTAAAAGCTTTTACATTTGTTCTTAG0.349700.097200.534500.500001.000001.00000


Target Position: 2576, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2576CUAUUCUCUAAAUAAUGAU83.4486558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992594CTATTCTCTAAATAATGATATCATTATTTAGAGAATAG0.117600.100300.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2574-2596CTCTATTCTCTAAATAATGATGGAUCAUUAUUUAGAGAAUAGAGCUAUUCUCUAAAUAAUGAUGGU8.716.003


Target Position: 1047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1047GGGGAUGUGGAAUUUUUAU84.69478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9141065GGGGATGTGGAATTTTTATATAAAAATTCCACATCCCC0.104000.002400.948301.000001.000001.00000


Target Position: 132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
132UGAGCGAUAUGAUGACAUG75.99731136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
898150TGAGCGATATGATGACATGCATGTCATCATATCGCTCA0.072700.047800.569000.500001.000001.00000


Target Position: 1939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1939GCUCUUACCAAGUUUAAAC74.03761307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341957GCTCTTACCAAGTTTAAACGTTTAAACTTGGTAAGAGC0.186000.044800.706900.750001.000001.00000


Target Position: 958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958UCCCAUGUGGUUUUUAUGU60.18452301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
927976TCCCATGTGGTTTTTATGTACATAAAAACCACATGGGA0.399400.003700.663800.500000.956500.75000


Target Position: 2763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2763UGUAAAUGCUCAAUAAAUA91.4925150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7862781TGTAAATGCTCAATAAATATATTTATTGAGCATTTACA0.063200.031100.663800.750001.000001.00000


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675UGAAGCCAUUGCUGAACUU74.2881282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
906693TGAAGCCATTGCTGAACTTAAGTTCAGCAATGGCTTCA0.037900.010500.586200.750000.923900.87500


Target Position: 2298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2298AGAUUACCUUCCUGUUUUA93.662191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4142316AGATTACCTTCCTGTTTTATAAAACAGGAAGGTAATCT0.284300.048300.689700.750001.000001.00000


Target Position: 2310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2310UGUUUUAGCCUUCUGUCUU72.68111438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6222328TGTTTTAGCCTTCTGTCTTAAGACAGAAGGCTAAAACA0.339100.181500.569000.750001.000001.00000


Target Position: 2729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2729AUGUUUUCUGUAUGUUCUA81.2275723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9382747ATGTTTTCTGTATGTTCTATAGAACATACAGAAAACAT0.050000.014100.482800.500001.000001.00000


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204GUUCCAGUCACAGGUGUAG67.45781844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9641222GTTCCAGTCACAGGTGTAGCTACACCTGTGACTGGAAC0.238400.036500.474100.500000.972800.87500


Target Position: 2126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2126GGCAUUUUCUAACUUAGGA86.7244355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8852144GGCATTTTCTAACTTAGGATCCTAAGTTAGAAAATGCC0.054200.003200.629300.750001.000001.00000


Target Position: 49, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
49AACCUUGCUUCUAGGAGAU75.75781152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
98267AACCTTGCTTCTAGGAGATATCTCCTAGAAGCAAGGTT0.165100.024100.465500.500000.967400.75000


Target Position: 2642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2642ACUUUGCAGAAAACACCAA80.0799796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6582660ACTTTGCAGAAAACACCAATTGGTGTTTTCTGCAAAGT0.512400.064600.560300.750000.994601.00000


Target Position: 1438, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1438GCUGUUAGCUUUCAUUAUU85.2742443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9121456GCTGTTAGCTTTCATTATTAATAATGAAAGCTAACAGC0.532700.002400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1436-1458CTGCTGTTAGCTTTCATTATTTTAAUAAUGAAAGCUAACAGCAGGCUGUUAGCUUUCAUUAUUUUU8.716.412


Target Position: 2542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2542UCUGCCUUUAAAAUCCUUC51.62422639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6702560TCTGCCTTTAAAATCCTTCGAAGGATTTTAAAGGCAGA0.921000.469800.551700.500001.000001.00000


Target Position: 991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
991GUAGAGCCAGUUAACAUUU80.9286736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4171009GTAGAGCCAGTTAACATTTAAATGTTAACTGGCTCTAC0.197700.088900.681000.750001.000001.00000


Target Position: 1617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1617AUUUUUGCUUUUGUGAUUU64.87742030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8761635ATTTTTGCTTTTGTGATTTAAATCACAAAAGCAAAAAT0.494900.071100.508600.500001.000001.00000


Target Position: 2690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2690UUUUUCUUUUAGAAUGUAA77.7458995

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9902708TTTTTCTTTTAGAATGTAATTACATTCTAAAAGAAAAA0.265400.082700.465500.500001.000001.00000


Target Position: 608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
608CUGUGUUCUAUUAUGAGAU84.3063505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
836626CTGTGTTCTATTATGAGATATCTCATAATAGAACACAG0.463100.004400.603400.750001.000001.00000


Target Position: 1396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1396AGGGCAGAAACGGUUCACA77.49221018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9891414AGGGCAGAAACGGTTCACATGTGAACCGTTTCTGCCCT0.024400.001100.637900.500001.000001.00000


Target Position: 347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
347CGGAGCUAAGAGAUAUCUG76.63331091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
988365CGGAGCTAAGAGATATCTGCAGATATCTCTTAGCTCCG0.054300.001100.629300.750001.000001.00000


Target Position: 2220, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2220GUUUUUAAGAAUUUCUUGA81.6866697

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2218-2240TGGTTTTTAAGAATTTCTTGATAUCAAGAAAUUCUUAAAAACCAGUUUUUAAGAAUUUCUUGAUAU12.2-9.101


Target Position: 1724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1724UUAAUGUCUUAUGAAAUUU68.12871792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8951742TTAATGTCTTATGAAATTTAAATTTCATAAGACATTAA0.065100.002900.534500.500001.000001.00000


Target Position: 390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
390AAAGUUCUUGAUCCCCAAU73.26461382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
908408AAAGTTCTTGATCCCCAATATTGGGGATCAAGAACTTT0.049300.008500.491400.500001.000001.00000


Target Position: 1891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1891UGUACAUUUUUUGAAAUUU72.84481426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3261909TGTACATTTTTTGAAATTTAAATTTCAAAAAATGTACA0.264300.181200.706900.750001.000001.00000


Target Position: 2523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2523CCUGAAUGGUCUGUCAUUG72.40871457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6752541CCTGAATGGTCTGTCATTGCAATGACAGACCATTCAGG0.376700.014300.698300.750000.983700.62500


Target Position: 889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
889GUCCCACAAAUAGUUUUUU72.14011475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
731907GTCCCACAAATAGTTTTTTAAAAAACTATTTGTGGGAC0.079200.019900.819000.750001.000001.00000


Target Position: 1835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1835UCUCUACAGCUUUUCAUGU68.98691721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9491853TCTCTACAGCTTTTCATGTACATGAAAAGCTGTAGAGA0.100900.036600.517200.500001.000001.00000


Target Position: 1995, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1995UACUGUUUCCAUGUCCCAU71.97121488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562013TACTGTTTCCATGTCCCATATGGGACATGGAAACAGTA0.117600.052900.525900.500000.994600.62500


Target Position: 2066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2066GGAGAGGGGGGGAUUGAUU79.3837853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6242084GGAGAGGGGGGGATTGATTAATCAATCCCCCCCTCTCC0.110500.055300.862101.000001.000001.00000


Target Position: 2764, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2764GUAAAUGCUCAAUAAAUAU88.8112249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5672782GTAAATGCTCAATAAATATATATTTATTGAGCATTTAC0.126500.025200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2762-2784CTGTAAATGCTCAATAAATATTGAUAUUUAUUGAGCAUUUACAGGUAAAUGCUCAAUAAAUAUUGU-8.015.301


Target Position: 760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
760ACAUUGUGGACAUCGGAUA81.9149671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
905778ACATTGTGGACATCGGATATATCCGATGTCCACAATGT0.050100.002600.663800.750001.000001.00000


Target Position: 680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
680CCAUUGCUGAACUUGAUAC73.15231392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
774698CCATTGCTGAACTTGATACGTATCAAGTTCAGCAATGG0.129000.006900.663800.750001.000001.00000


Target Position: 1669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1669AUGUGCUGUAAAAAUAGUU72.73931434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8881687ATGTGCTGTAAAAATAGTTAACTATTTTTACAGCACAT0.118200.003100.508600.500001.000001.00000


Target Position: 2797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2797AGUGAGUCUUGAUGAUAAG78.1704959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7882815AGTGAGTCTTGATGATAAGCTTATCATCAAGACTCACT0.105600.006200.569000.500001.000001.00000


Target Position: 1969, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1969CAUAACAAAAAUACUACUA89.7825207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9301987CATAACAAAAATACTACTATAGTAGTATTTTTGTTATG0.849200.763100.482800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1967-1989ATCATAACAAAAATACTACTAATUAGUAGUAUUUUUGUUAUGAUCAUAACAAAAAUACUACUAAUU18.86.922


Target Position: 271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
271UCAAGUAUUGAACAAAAGA77.27211033

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
924289TCAAGTATTGAACAAAAGATCTTTTGTTCAATACTTGA0.225700.039400.500000.500001.000001.00000


Target Position: 2243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2243CUUAUAGCCUGCCUUCAAU82.6998606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4982261CTTATAGCCTGCCTTCAATATTGAAGGCAGGCTATAAG0.324900.124800.629300.750001.000001.00000


Target Position: 1799, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1799GAAUAAAAGUUUUAUGAAU94.991561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941817GAATAAAAGTTTTATGAATATTCATAAAACTTTTATTC0.068300.001100.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1797-1819TGGAATAAAAGTTTTATGAATGGAUUCAUAAAACUUUUAUUCCAGAAUAAAAGUUUUAUGAAUGGU8.9-9.701


Target Position: 602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
602ACUUCUCUGUGUUCUAUUA91.6384141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
595620ACTTCTCTGTGTTCTATTATAATAGAACACAGAGAAGT0.143700.019000.672400.750001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051AUGUGGAAUUUUUAUACAA89.7654208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8051069ATGTGGAATTTTTATACAATTGTATAAAAATTCCACAT0.082500.018900.508600.500001.000001.00000


Target Position: 1744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1744CAUGAACAAUCCAAGCAUA99.566417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7871762CATGAACAATCCAAGCATATATGCTTGGATTGTTCATG0.177600.006200.612100.750001.000001.00000


Target Position: 1462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1462UACACUCAUUUUAUUUGUA84.4902490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8321480TACACTCATTTTATTTGTATACAAATAAAATGAGTGTA0.314800.126800.500000.500001.000001.00000


Target Position: 1723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1723UUUAAUGUCUUAUGAAAUU70.19441607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9411741TTTAATGTCTTATGAAATTAATTTCATAAGACATTAAA0.033600.002000.491400.500001.000001.00000


Target Position: 987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
987GGGAGUAGAGCCAGUUAAC78.4252935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9271005GGGAGTAGAGCCAGTTAACGTTAACTGGCTCTACTCCC0.132900.002200.844800.750001.000001.00000


Target Position: 1750, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1750CAAUCCAAGCAUAAUUGUU84.4756491

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1748-1770AACAATCCAAGCATAATTGTTAAAACAAUUAUGCUUGGAUUGUUCAAUCCAAGCAUAAUUGUUAAU6.920.102


Target Position: 1961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1961AAAUUUAUCAUAACAAAAA87.356326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8571979AAATTTATCATAACAAAAATTTTTGTTATGATAAATTT0.843300.742500.500000.500001.000001.00000


Target Position: 1631, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1631GAUUUUUUUUUUUUUUUUU78.5418921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041649GATTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAATC0.584400.490400.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1629-1651GTGATTTTTTTTTTTTTTTTTTGAAAAAAAAAAAAAAAAAUCACGAUUUUUUUUUUUUUUUUUUGU-11.3-12.000


Target Position: 2433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2433CCACAGACUAUUUCCCUCA85.1049454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5282451CCACAGACTATTTCCCTCATGAGGGAAATAGTCTGTGG0.911300.382800.620700.750000.972800.75000


Target Position: 2018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2018CCCUCUCUUCCUCCCCACC53.95782572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7542036CCCTCTCTTCCTCCCCACCGGTGGGGAGGAAGAGAGGG0.537500.430900.637900.500001.000001.00000


Target Position: 1572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1572GCACAGCAGUAAAACAAAA95.998445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3311590GCACAGCAGTAAAACAAAATTTTGTTTTACTGCTGTGC0.261500.200700.853401.000001.000001.00000


Target Position: 754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
754AACUUGACAUUGUGGACAU82.3257631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
996772AACTTGACATTGTGGACATATGTCCACAATGTCAAGTT0.012700.003900.491400.500001.000001.00000


Target Position: 3, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3CCACUCCCACCGCCAGCUG56.52412479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
93821CCACTCCCACCGCCAGCTGCAGCTGGCGGTGGGAGTGG0.029700.006300.560300.750000.967400.62500


Target Position: 2572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2572UCCUCUAUUCUCUAAAUAA90.7971174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1862590TCCTCTATTCTCTAAATAATTATTTAGAGAATAGAGGA0.543700.277600.836200.750001.000001.00000


Target Position: 1079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1079GUUUGGCAUAGUACUUUUG70.08251622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8731097GTTTGGCATAGTACTTTTGCAAAAGTACTATGCCAAAC0.120400.006400.500000.500001.000001.00000


Target Position: 1280, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1280CAUGGAUACCACAUAUUAA105.7363

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1278-1300CCCATGGATACCACATATTAAACUUAAUAUGUGGUAUCCAUGGGCAUGGAUACCACAUAUUAAACU0.021.213


Target Position: 2719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2719AGCAGGGACAAUGUUUUCU66.52571920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7472737AGCAGGGACAATGTTTTCTAGAAAACATTGTCCCTGCT0.117600.009400.629300.500001.000001.00000


Target Position: 1753, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1753UCCAAGCAUAAUUGUUAAG56.92782466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9031771TCCAAGCATAATTGTTAAGCTTAACAATTATGCTTGGA0.130000.019100.732800.500001.000001.00000


Target Position: 564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
564GCAACCAACACAUCCUAUC68.10831795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
736582GCAACCAACACATCCTATCGATAGGATGTGTTGGTTGC0.078600.059400.672400.750001.000001.00000


Target Position: 2518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2518CCUAUCCUGAAUGGUCUGU61.20742251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9662536CCTATCCTGAATGGTCTGTACAGACCATTCAGGATAGG0.021900.016300.637900.750000.989101.00000


Target Position: 912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
912ACGAUUUAUGACAGGUUUA82.1951640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
920930ACGATTTATGACAGGTTTATAAACCTGTCATAAATCGT0.034400.018300.741400.750001.000001.00000


Target Position: 1813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1813UGAAUGGACUUUUCAACUA84.3039507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6791831TGAATGGACTTTTCAACTATAGTTGAAAAGTCCATTCA0.100600.019200.551700.750001.000001.00000


Target Position: 1621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1621UUGCUUUUGUGAUUUUUUU65.52291993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8291639TTGCTTTTGTGATTTTTTTAAAAAAATCACAAAAGCAA0.613800.396900.646600.500001.000001.00000


Target Position: 1628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1628UGUGAUUUUUUUUUUUUUU69.63271656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1991646TGTGATTTTTTTTTTTTTTAAAAAAAAAAAAAATCACA0.612900.395100.706900.750001.000001.00000


Target Position: 513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
513UCAGUCACAACAAGCAUAC57.57132436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
740531TCAGTCACAACAAGCATACGTATGCTTGTTGTGACTGA0.167500.014500.543100.500001.000001.00000


Target Position: 364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
364UGCAAUGAUGUACUGUCUC60.40062296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
753382TGCAATGATGTACTGTCTCGAGACAGTACATCATTGCA0.072200.012100.543100.500001.000001.00000


Target Position: 676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676GAAGCCAUUGCUGAACUUG68.9711723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
885694GAAGCCATTGCTGAACTTGCAAGTTCAGCAATGGCTTC0.095400.011100.525900.500000.923900.75000


Target Position: 2724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2724GGACAAUGUUUUCUGUAUG82.2162637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7912742GGACAATGTTTTCTGTATGCATACAGAAAACATTGTCC0.260600.006200.715500.750001.000001.00000


Target Position: 1413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413CAUUCCAUUAUUUGUAAAG71.47461519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7841431CATTCCATTATTTGTAAAGCTTTACAAATAATGGAATG0.103900.105400.517200.500001.000001.00000


Target Position: 1583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1583AAACAAAAACCCAUGUAUU82.0761653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811601AAACAAAAACCCATGTATTAATACATGGGTTTTTGTTT0.185700.079200.491400.500001.000001.00000


Target Position: 1257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257AAGGCUGUGGUAGAAUCAU73.84851325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9841275AAGGCTGTGGTAGAATCATATGATTCTACCACAGCCTT0.054600.001500.482800.500001.000001.00000


Target Position: 726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
726CACGCUAAUAAUGCAAUUA86.6117369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
677744CACGCTAATAATGCAATTATAATTGCATTATTAGCGTG0.093800.034800.758600.750000.978300.87500


Target Position: 857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
857AUUUACACAGUAGACCAUU68.5851758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
995875ATTTACACAGTAGACCATTAATGGTCTACTGTGTAAAT0.012700.004700.500000.500001.000001.00000


Target Position: 2663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2663AAAAAUGCCAUUUUAAAAA79.2917860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8472681AAAAATGCCATTTTAAAAATTTTTAAAATGGCATTTTT0.126100.093700.500000.500001.000001.00000


Target Position: 921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
921GACAGGUUUAUGUUACUUC76.20531123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
836939GACAGGTTTATGTTACTTCGAAGTAACATAAACCTGTC0.131900.011700.646600.500001.000001.00000


Target Position: 1691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1691AGGGAAAUAACUUGAGAUG69.1281712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8791709AGGGAAATAACTTGAGATGCATCTCAAGTTATTTCCCT0.073300.014900.689700.500001.000001.00000


Target Position: 322, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
322CGAGAAUACAGAGAGAAAA93.688190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
122340CGAGAATACAGAGAGAAAATTTTCTCTCTGTATTCTCG0.790900.477500.793101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
320-342CTCGAGAATACAGAGAGAAAATTUUUUCUCUCUGUAUUCUCGAGCGAGAAUACAGAGAGAAAAUUU19.116.012


Target Position: 2638, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2638CAGUACUUUGCAGAAAACA82.103650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8612656CAGTACTTTGCAGAAAACATGTTTTCTGCAAAGTACTG0.210600.043500.577600.500000.994600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2636-2658CTCAGTACTTTGCAGAAAACACCUGUUUUCUGCAAAGUACUGAGCAGUACUUUGCAGAAAACACCU13.317.603


Target Position: 2105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2105CCAUUUAAAAUUUUGGCAU75.58941167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5462123CCATTTAAAATTTTGGCATATGCCAAAATTTTAAATGG0.131500.091200.689701.000001.000001.00000


Target Position: 182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
182GAGCUGAAUUAUCCAAUGA92.3821122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
981200GAGCTGAATTATCCAATGATCATTGGATAATTCAGCTC0.029400.001200.586200.500001.000001.00000


Target Position: 2802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2802GUCUUGAUGAUAAGGGUGA78.1019966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9402820GTCTTGATGATAAGGGTGATCACCCTTATCATCAAGAC0.126000.027800.594800.500001.000001.00000


Target Position: 2424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2424GCUUGCAUCCCACAGACUA89.2905231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2942442GCTTGCATCCCACAGACTATAGTCTGTGGGATGCAAGC0.376500.126100.681001.000001.000001.00000


Target Position: 373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
373GUACUGUCUCUUUUGGAAA89.48221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
458391GTACTGTCTCTTTTGGAAATTTCCAAAAGAGACAGTAC0.272000.065600.681000.750001.000001.00000


Target Position: 216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
216CUCAGUUGCUUAUAAAAAU85.4495431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482234CTCAGTTGCTTATAAAAATATTTTTATAAGCAACTGAG0.159700.039300.801700.750001.000001.00000


Target Position: 937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
937UUCUAUUUGAAUUUCUAUA77.45321019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
908955TTCTATTTGAATTTCTATATATAGAAATTCAAATAGAA0.151100.065100.629300.500001.000001.00000


Target Position: 430, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
430GUCUUCUAUUUGAAAAUGA85.0296459

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
428-450AAGTCTTCTATTTGAAAATGAAAUCAUUUUCAAAUAGAAGACUUGUCUUCUAUUUGAAAAUGAAAU7.420.202


Target Position: 955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
955AUUUCCCAUGUGGUUUUUA71.11811545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
957973ATTTCCCATGTGGTTTTTATAAAAACCACATGGGAAAT0.251900.004300.474100.500000.956501.00000


Target Position: 36, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
36ACGACGUCCCUCAAACCUU72.66931440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95054ACGACGTCCCTCAAACCTTAAGGTTTGAGGGACGTCGT0.126800.001800.637900.750001.000001.00000


Target Position: 1777, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1777GUGUAUUAAAUUCAUGUAA89.4538223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9841795GTGTATTAAATTCATGTAATTACATGAATTTAATACAC0.016000.010100.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1775-1797ACGTGTATTAAATTCATGTAAGTUUACAUGAAUUUAAUACACGUGUGUAUUAAAUUCAUGUAAGUU21.58.502


Target Position: 2815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2815GGGUGAGAAACUGAAAUCC68.85471727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8302833GGGTGAGAAACTGAAATCCGGATTTCAGTTTCTCACCC0.091400.030800.620700.500001.000001.00000


Target Position: 2081, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2081GAUUAGAAAAAAAUGUAGU82.0657654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9582099GATTAGAAAAAAATGTAGTACTACATTTTTTTCTAATC0.110700.048200.474100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2079-2101TTGATTAGAAAAAAATGTAGTGTACUACAUUUUUUUCUAAUCAAGAUUAGAAAAAAAUGUAGUGUU11.66.911


Target Position: 1624, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1624CUUUUGUGAUUUUUUUUUU76.55161097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4891642CTTTTGTGATTTTTTTTTTAAAAAAAAAATCACAAAAG0.754200.442200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1622-1644TGCTTTTGTGATTTTTTTTTTTTAAAAAAAAAAUCACAAAAGCACUUUUGUGAUUUUUUUUUUUUU-11.312.210


Target Position: 999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
999AGUUAACAUUUAGGGAGUU76.92181061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9031017AGTTAACATTTAGGGAGTTAACTCCCTAAATGTTAACT0.038900.023500.560300.750001.000001.00000


Target Position: 40, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
40CGUCCCUCAAACCUUGCUU72.00691486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
92558CGTCCCTCAAACCTTGCTTAAGCAAGGTTTGAGGGACG0.126400.002200.637901.000001.000001.00000


Target Position: 1667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1667GCAUGUGCUGUAAAAAUAG79.7615823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9381685GCATGTGCTGTAAAAATAGCTATTTTTACAGCACATGC0.107900.002100.681000.750001.000001.00000


Target Position: 1182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1182CGGGGAAUAAAAGGGAUCA79.2679862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861200CGGGGAATAAAAGGGATCATGATCCCTTTTATTCCCCG0.157100.076100.689700.750001.000001.00000


Target Position: 2765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2765UAAAUGCUCAAUAAAUAUU73.84741326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7492783TAAATGCTCAATAAATATTAATATTTATTGAGCATTTA0.075100.017000.525900.500001.000001.00000


Target Position: 2218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2218UGGUUUUUAAGAAUUUCUU69.77011639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8322236TGGTTTTTAAGAATTTCTTAAGAAATTCTTAAAAACCA0.054200.012300.706900.750001.000001.00000


Target Position: 2463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2463GCAGCAAAUCUCUCCUUAG81.9575667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6372481GCAGCAAATCTCTCCTTAGCTAAGGAGAGATTTGCTGC0.106700.030800.681000.750001.000001.00000


Target Position: 965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
965UGGUUUUUAUGUUUAAUAU81.8518680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
467983TGGTTTTTATGTTTAATATATATTAAACATAAAAACCA0.165400.084300.801700.750001.000001.00000


Target Position: 2246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2246AUAGCCUGCCUUCAAUUUU66.87981890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6872264ATAGCCTGCCTTCAATTTTAAAATTGAAGGCAGGCTAT0.308000.135800.543100.500001.000001.00000


Target Position: 538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538GCUUUUGAAAUCAGCAAAA86.5975371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
392556GCTTTTGAAATCAGCAAAATTTTGCTGATTTCAAAAGC0.358500.047000.853401.000000.967400.62500


Target Position: 2674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2674UUUAAAAAAGGUGUAUUUU63.47522125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9052692TTTAAAAAAGGTGTATTTTAAAATACACCTTTTTTAAA0.183900.003300.500000.500001.000001.00000


Target Position: 787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
787GACGAAGCUGAAGCAGGAG69.42961678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
865805GACGAAGCTGAAGCAGGAGCTCCTGCTTCAGCTTCGTC0.069700.009900.508600.500001.000001.00000


Target Position: 1585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1585ACAAAAACCCAUGUAUUUA83.6044543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811603ACAAAAACCCATGTATTTATAAATACATGGGTTTTTGT0.483000.079500.672400.750001.000001.00000


Target Position: 703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
703AGUGAAGAGUCAUACAAAG79.7863822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
717721AGTGAAGAGTCATACAAAGCTTTGTATGACTCTTCACT0.127600.011500.569000.500001.000001.00000


Target Position: 1787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1787UUCAUGUAAGUGGAAUAAA73.06981401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9871805TTCATGTAAGTGGAATAAATTTATTCCACTTACATGAA0.133700.001100.672400.500001.000001.00000


Target Position: 2446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2446CCCUCAUCCUAUUUACUGC70.67991575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7712464CCCTCATCCTATTTACTGCGCAGTAAATAGGATGAGGG0.193900.185900.637900.500001.000001.00000


Target Position: 962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
962AUGUGGUUUUUAUGUUUAA85.3328440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
850980ATGTGGTTTTTATGTTTAATTAAACATAAAAACCACAT0.192700.069000.620700.500001.000001.00000


Target Position: 2574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2574CUCUAUUCUCUAAAUAAUG74.93971231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7452592CTCTATTCTCTAAATAATGCATTATTTAGAGAATAGAG0.227400.190600.655200.500001.000001.00000


Target Position: 2442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2442AUUUCCCUCAUCCUAUUUA76.60741094

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9522460ATTTCCCTCATCCTATTTATAAATAGGATGAGGGAAAT0.714000.661900.474100.500001.000001.00000


Target Position: 1444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1444AGCUUUCAUUAUUUUUGCU75.9541137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8511462AGCTTTCATTATTTTTGCTAGCAAAAATAATGAAAGCT0.255800.032200.500000.500001.000001.00000


Target Position: 803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
803GAGAAGGAGGGGAAAAUUA91.7179139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
808821GAGAAGGAGGGGAAAATTATAATTTTCCCCTCCTTCTC0.872500.005300.775900.750001.000001.00000


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773CGGAUACCCAAGGAGACGA77.19951041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
536791CGGATACCCAAGGAGACGATCGTCTCCTTGGGTATCCG0.228900.032800.620700.750000.962000.75000


Target Position: 214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
214CUCUCAGUUGCUUAUAAAA92.8005106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
552232CTCTCAGTTGCTTATAAAATTTTATAAGCAACTGAGAG0.166900.022300.810300.750001.000001.00000


Target Position: 211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
211CUUCUCUCAGUUGCUUAUA77.42751023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
851229CTTCTCTCAGTTGCTTATATATAAGCAACTGAGAGAAG0.059200.004100.594800.750001.000001.00000


Target Position: 1195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1195GGAUCAUUGGUUCCAGUCA91.3431153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8331213GGATCATTGGTTCCAGTCATGACTGGAACCAATGATCC0.054000.004600.646600.750000.972800.62500


Target Position: 953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
953AUAUUUCCCAUGUGGUUUU68.01251804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
901971ATATTTCCCATGTGGTTTTAAAACCACATGGGAAATAT0.063200.005600.543100.500000.956501.00000


Target Position: 1319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1319ACUCAAUGUGUACACCUUU78.483927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7451337ACTCAATGTGTACACCTTTAAAGGTGTACACATTGAGT0.120500.009700.706900.750001.000001.00000


Target Position: 844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844GCCUCAUUCUAAAAUUUAC79.5091845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
404862GCCTCATTCTAAAATTTACGTAAATTTTAGAATGAGGC0.916600.881500.819000.750001.000001.00000


Target Position: 2555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2555UCCUUCCUCUUUCUUCCUC50.25622676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6412573TCCTTCCTCTTTCTTCCTCGAGGAAGAAAGAGGAAGGA0.558200.540500.560300.500001.000001.00000


Target Position: 990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
990AGUAGAGCCAGUUAACAUU83.5768546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6371008AGTAGAGCCAGTTAACATTAATGTTAACTGGCTCTACT0.215900.016300.698300.750001.000001.00000


Target Position: 1593, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593CCAUGUAUUUAACUUUUUU87.1274337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801611CCATGTATTTAACTTTTTTAAAAAAGTTAAATACATGG0.657600.479300.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1591-1613ACCCATGTATTTAACTTTTTTTTAAAAAAGUUAAAUACAUGGGUCCAUGUAUUUAACUUUUUUUUU3.213.302


Target Position: 1098, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1098GUACAUUGUGGCUUCAAAA94.559571

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1096-1118TGGTACATTGTGGCTTCAAAAGGUUUUGAAGCCACAAUGUACCAGUACAUUGUGGCUUCAAAAGGU12.213.512


Target Position: 2573, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2573CCUCUAUUCUCUAAAUAAU92.6501110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1272591CCTCTATTCTCTAAATAATATTATTTAGAGAATAGAGG0.557800.226100.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2571-2593CTCCTCTATTCTCTAAATAATGAAUUAUUUAGAGAAUAGAGGAGCCUCUAUUCUCUAAAUAAUGAU-7.511.603


Target Position: 1758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1758GCAUAAUUGUUAAGAACAC78.7997902

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6931776GCATAATTGTTAAGAACACGTGTTCTTAACAATTATGC0.089100.016100.560300.750001.000001.00000


Target Position: 2624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2624ACAAAAUAUUUCCUCAGUA89.8811201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7632642ACAAAATATTTCCTCAGTATACTGAGGAAATATTTTGT0.126600.111500.525900.750001.000001.00000


Target Position: 1158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1158UGCCUACAUACUGGUUUGU60.1232308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9541176TGCCTACATACTGGTTTGTACAAACCAGTATGTAGGCA0.025600.002700.646600.500000.978300.75000


Target Position: 154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
154GCCUGCAUGAAGUCUGUAA90.4233187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
887172GCCTGCATGAAGTCTGTAATTACAGACTTCATGCAGGC0.161800.003200.965501.000001.000001.00000


Target Position: 1692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1692GGGAAAUAACUUGAGAUGA86.3302383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6461710GGGAAATAACTTGAGATGATCATCTCAAGTTATTTCCC0.103600.030800.767200.750001.000001.00000


Target Position: 2531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2531GUCUGUCAUUGUCUGCCUU82.9973586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3982549GTCTGTCATTGTCTGCCTTAAGGCAGACAATGACAGAC0.474300.196700.681000.750001.000001.00000


Target Position: 2805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2805UUGAUGAUAAGGGUGAGAA73.3341379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9612823TTGATGATAAGGGTGAGAATTCTCACCCTTATCATCAA0.140400.024900.474100.500001.000001.00000


Target Position: 2613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2613AAGCUCACUUUACAAAAUA84.8767468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5732631AAGCTCACTTTACAAAATATATTTTGTAAAGTGAGCTT0.644300.257900.594800.500001.000001.00000


Target Position: 847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
847UCAUUCUAAAAUUUACACA75.19681203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
777865TCATTCTAAAATTTACACATGTGTAAATTTTAGAATGA0.435700.469000.517200.500001.000001.00000


Target Position: 1949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1949AGUUUAAACACAAAAUUUA89.67213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3251967AGTTTAAACACAAAATTTATAAATTTTGTGTTTAAACT0.839600.691000.672400.750001.000001.00000


Target Position: 2178, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2178GUAGCAUUAACUGUAAGUU80.8292744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8072196GTAGCATTAACTGTAAGTTAACTTACAGTTAATGCTAC0.059000.014700.534500.750000.989100.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2176-2198GGGTAGCATTAACTGTAAGTTTTAACUUACAGUUAAUGCUACCCGUAGCAUUAACUGUAAGUUUUU19.019.703


Target Position: 1706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1706GAUGAUGGCUAGCUUUGUU89.368226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7341724GATGATGGCTAGCTTTGTTAACAAAGCTAGCCATCATC0.156500.043900.534500.750001.000001.00000


Target Position: 422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
422AGAGCAAAGUCUUCUAUUU87.4745318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
908440AGAGCAAAGTCTTCTATTTAAATAGAAGACTTTGCTCT0.053700.002500.724100.750001.000001.00000


Target Position: 1026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1026UCAUCUUGAGGUGGCCAAU67.40891849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9031044TCATCTTGAGGTGGCCAATATTGGCCACCTCAAGATGA0.042600.002600.715500.750001.000001.00000


Target Position: 51, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
51CCUUGCUUCUAGGAGAUAA90.1642194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
46569CCTTGCTTCTAGGAGATAATTATCTCCTAGAAGCAAGG0.254300.034800.810301.000001.000001.00000


Target Position: 2230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2230AUUUCUUGAUACUCUUAUA93.887183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9892248ATTTCTTGATACTCTTATATATAAGAGTATCAAGAAAT0.360800.082700.465500.500001.000001.00000


Target Position: 1507, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1507CAAAUGUAAAAGUAAAGAU88.2624277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9961525CAAATGTAAAAGTAAAGATATCTTTACTTTTACATTTG0.411900.232900.465500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1505-1527AACAAATGTAAAAGTAAAGATGCAUCUUUACUUUUACAUUUGUUCAAAUGUAAAAGUAAAGAUGCU14.66.901


Target Position: 1206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1206UCCAGUCACAGGUGUAGUA80.3823776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2641224TCCAGTCACAGGTGTAGTATACTACACCTGTGACTGGA0.471600.151900.689700.750000.972800.75000


Target Position: 2684, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2684GUGUAUUUUUUCUUUUAGA88.4678266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7992702GTGTATTTTTTCTTTTAGATCTAAAAGAAAAAATACAC0.174700.020800.569000.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2682-2704AGGTGTATTTTTTCTTTTAGAATUCUAAAAGAAAAAAUACACCUGUGUAUUUUUUCUUUUAGAAUU1.36.901


Target Position: 2758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2758UACACUGUAAAUGCUCAAU68.70881745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7802776TACACTGTAAATGCTCAATATTGAGCATTTACAGTGTA0.071600.058200.672400.500000.934800.62500


Target Position: 1710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1710AUGGCUAGCUUUGUUUAAU73.20991387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9931728ATGGCTAGCTTTGTTTAATATTAAACAAAGCTAGCCAT0.074200.023300.646600.500001.000001.00000


Target Position: 1664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1664CAUGCAUGUGCUGUAAAAA93.0012104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9401682CATGCATGTGCTGTAAAAATTTTTACAGCACATGCATG0.061000.002000.655200.750000.956500.87500


Target Position: 596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
596CCCUUAACUUCUCUGUGUU82.1754643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
876614CCCTTAACTTCTCTGTGTTAACACAGAGAAGTTAAGGG0.046000.046700.844801.000001.000001.00000


Target Position: 336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
336GAAAAUUGAGACGGAGCUA88.1542283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
980354GAAAATTGAGACGGAGCTATAGCTCCGTCTCAATTTTC0.017100.005300.500000.750001.000001.00000


Target Position: 601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
601AACUUCUCUGUGUUCUAUU76.3161119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
921619AACTTCTCTGTGTTCTATTAATAGAACACAGAGAAGTT0.130000.023200.637900.500001.000001.00000


Target Position: 162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
162GAAGUCUGUAACUGAGCAA93.0265103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
815180GAAGTCTGTAACTGAGCAATTGCTCAGTTACAGACTTC0.057100.020800.525900.750001.000001.00000


Target Position: 2229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2229AAUUUCUUGAUACUCUUAU74.15481294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9812247AATTTCTTGATACTCTTATATAAGAGTATCAAGAAATT0.350600.066300.465500.500001.000001.00000


Target Position: 1645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1645UUUUUUGAUACUUGCCUAA72.67791439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9971663TTTTTTGATACTTGCCTAATTAGGCAAGTATCAAAAAA0.089600.081900.465500.500001.000001.00000


Target Position: 209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
209AUCUUCUCUCAGUUGCUUA81.8724676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
886227ATCTTCTCTCAGTTGCTTATAAGCAACTGAGAGAAGAT0.044400.003800.646600.500001.000001.00000


Target Position: 2070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2070AGGGGGGGAUUGAUUAGAA88.4155268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4022088AGGGGGGGATTGATTAGAATTCTAATCAATCCCCCCCT0.204000.094200.672400.750001.000001.00000


Target Position: 2069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2069GAGGGGGGGAUUGAUUAGA75.6811159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9652087GAGGGGGGGATTGATTAGATCTAATCAATCCCCCCCTC0.162900.059900.586200.500001.000001.00000


Target Position: 2499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2499AUCUCCCUUUAAAACCCUA77.34841028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7972517ATCTCCCTTTAAAACCCTATAGGGTTTTAAAGGGAGAT0.565200.435400.508600.500001.000001.00000


Target Position: 932, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
932GUUACUUCUAUUUGAAUUU78.1017967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513950GTTACTTCTATTTGAATTTAAATTCAAATAGAAGTAAC0.312800.126900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
930-952ATGTTACTTCTATTTGAATTTCTAAAUUCAAAUAGAAGUAACAUGUUACUUCUAUUUGAAUUUCUU7.414.612


Target Position: 2071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2071GGGGGGGAUUGAUUAGAAA94.813964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3792089GGGGGGGATTGATTAGAAATTTCTAATCAATCCCCCCC0.219400.092800.991401.000001.000001.00000


Target Position: 1522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1522AGAUGCAGGAAAAAUGAAU79.3702854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2051540AGATGCAGGAAAAATGAATATTCATTTTTCCTGCATCT0.541000.236700.715500.750001.000001.00000


Target Position: 519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
519ACAACAAGCAUACCAAGAA86.202391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
719537ACAACAAGCATACCAAGAATTCTTGGTATGCTTGTTGT0.570700.078900.534500.750001.000001.00000


Target Position: 824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
824CGGCCUUCCAACUUUUGUC67.71061826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
818842CGGCCTTCCAACTTTTGTCGACAAAAGTTGGAAGGCCG0.075000.004800.594800.750000.972800.75000


Target Position: 1890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1890UUGUACAUUUUUUGAAAUU65.95721955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8721908TTGTACATTTTTTGAAATTAATTTCAAAAAATGTACAA0.259200.182100.637900.500001.000001.00000


Target Position: 1460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1460GCUACACUCAUUUUAUUUG75.18651204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3561478GCTACACTCATTTTATTTGCAAATAAAATGAGTGTAGC0.241800.102500.706900.750001.000001.00000


Target Position: 2266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2266AUCCUUUAUUCUUUCUAUU75.62931164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5842284ATCCTTTATTCTTTCTATTAATAGAAAGAATAAAGGAT0.490700.297600.672400.500001.000001.00000


Target Position: 1547, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1547GUAUUCAUUACUUCAUGUA90.2775189

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1545-1567TGGTATTCATTACTTCATGTATAUACAUGAAGUAAUGAAUACCAGUAUUCAUUACUUCAUGUAUAU20.58.712


Target Position: 2219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2219GGUUUUUAAGAAUUUCUUG76.38961114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7932237GGTTTTTAAGAATTTCTTGCAAGAAATTCTTAAAAACC0.211900.006100.706900.750001.000001.00000


Target Position: 1703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1703UGAGAUGAUGGCUAGCUUU78.6078917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6651721TGAGATGATGGCTAGCTTTAAAGCTAGCCATCATCTCA0.096700.039000.724100.750001.000001.00000


Target Position: 2723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2723GGGACAAUGUUUUCUGUAU91.7503136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8072741GGGACAATGTTTTCTGTATATACAGAAAACATTGTCCC0.286100.005300.948301.000001.000001.00000


Target Position: 2662, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2662CAAAAAUGCCAUUUUAAAA93.484393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5732680CAAAAATGCCATTTTAAAATTTTAAAATGGCATTTTTG0.125900.104100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2660-2682AACAAAAATGCCATTTTAAAAAAUUUUAAAAUGGCAUUUUUGUUCAAAAAUGCCAUUUUAAAAAAU-9.1-3.301


Target Position: 2754, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2754CUAGUACACUGUAAAUGCU83.468556

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2752-2774GCCTAGTACACTGTAAATGCTCAAGCAUUUACAGUGUACUAGGCCUAGUACACUGUAAAUGCUCAU15.320.202


Target Position: 2428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2428GCAUCCCACAGACUAUUUC68.98051722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2892446GCATCCCACAGACTATTTCGAAATAGTCTGTGGGATGC0.582400.346900.681000.750001.000001.00000


Target Position: 2536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2536UCAUUGUCUGCCUUUAAAA81.7623691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4672554TCATTGTCTGCCTTTAAAATTTTAAAGGCAGACAATGA0.515700.303800.724100.750001.000001.00000


Target Position: 1064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1064AUACAAGUUAUAAGUGUUU74.07291303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6961082ATACAAGTTATAAGTGTTTAAACACTTATAACTTGTAT0.088600.025900.543100.500001.000001.00000


Target Position: 382, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382CUUUUGGAAAAGUUCUUGA79.4686847

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
380-402CTCTTTTGGAAAAGTTCTTGATCUCAAGAACUUUUCCAAAAGAGCUUUUGGAAAAGUUCUUGAUCU19.220.102


Target Position: 1717, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1717GCUUUGUUUAAUGUCUUAU79.2138871

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1715-1737TAGCTTTGTTTAATGTCTTATGAAUAAGACAUUAAACAAAGCUAGCUUUGUUUAAUGUCUUAUGAU20.310.303


Target Position: 1054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1054UGGAAUUUUUAUACAAGUU75.8981141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7601072TGGAATTTTTATACAAGTTAACTTGTATAAAAATTCCA0.071500.021500.698300.750001.000001.00000


Target Position: 411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
411UUCACAAGCAGAGAGCAAA74.44941270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
949429TTCACAAGCAGAGAGCAAATTTGCTCTCTGCTTGTGAA0.027600.003500.672400.500000.945700.87500


Target Position: 242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
242GAGCCCGUAGGUCAUCUUG68.89731725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
986260GAGCCCGTAGGTCATCTTGCAAGATGACCTACGGGCTC0.018800.001200.663800.500000.913000.87500


Target Position: 1860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1860GUCUUGGUUCUGAAACUUC71.17111538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941878GTCTTGGTTCTGAAACTTCGAAGTTTCAGAACCAAGAC0.198500.056100.646600.500001.000001.00000


Target Position: 1731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1731CUUAUGAAAUUUUCAUGAA90.6742180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9841749CTTATGAAATTTTCATGAATTCATGAAAATTTCATAAG0.035700.002500.465500.750000.951100.75000


Target Position: 1332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1332ACCUUUGACUACAGCUGCA82.61616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9521350ACCTTTGACTACAGCTGCATGCAGCTGTAGTCAAAGGT0.027000.012400.500000.500001.000001.00000


Target Position: 2567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2567CUUCCUCCUCUAUUCUCUA90.1705193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922585CTTCCTCCTCTATTCTCTATAGAGAATAGAGGAGGAAG0.494300.308200.465500.750001.000001.00000


Target Position: 2512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2512ACCCUACCUAUCCUGAAUG61.32492249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9212530ACCCTACCTATCCTGAATGCATTCAGGATAGGTAGGGT0.033700.034200.698300.500001.000001.00000


Target Position: 2462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2462UGCAGCAAAUCUCUCCUUA80.3003785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5352480TGCAGCAAATCTCTCCTTATAAGGAGAGATTTGCTGCA0.135600.027000.819000.750000.983700.62500


Target Position: 952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
952UAUAUUUCCCAUGUGGUUU64.94612027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
795970TATATTTCCCATGTGGTTTAAACCACATGGGAAATATA0.065600.005900.543100.500000.956500.87500


Target Position: 2466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2466GCAAAUCUCUCCUUAGUUG78.5197923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6782484GCAAATCTCTCCTTAGTTGCAACTAAGGAGAGATTTGC0.126400.014300.706900.750001.000001.00000


Target Position: 1586, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1586CAAAAACCCAUGUAUUUAA93.292797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431604CAAAAACCCATGTATTTAATTAAATACATGGGTTTTTG0.490100.080100.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1584-1606AACAAAAACCCATGTATTTAACTUUAAAUACAUGGGUUUUUGUUCAAAAACCCAUGUAUUUAACUU1.412.602


Target Position: 1194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1194GGGAUCAUUGGUUCCAGUC67.8211823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8941212GGGATCATTGGTTCCAGTCGACTGGAACCAATGATCCC0.050300.002900.672400.750000.929300.62500


Target Position: 59, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
59CUAGGAGAUAAAAAGAACA88.7214253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
96777CTAGGAGATAAAAAGAACATGTTCTTTTTATCTCCTAG0.311700.046000.465500.500001.000001.00000


Target Position: 1291, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1291CAUAUUAAACCAUGUAUAU91.226157

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1289-1311CACATATTAAACCATGTATATCTAUAUACAUGGUUUAAUAUGUGCAUAUUAAACCAUGUAUAUCUU8.2-8.012


Target Position: 935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
935ACUUCUAUUUGAAUUUCUA92.4577118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
714953ACTTCTATTTGAATTTCTATAGAAATTCAAATAGAAGT0.309400.181700.534500.750001.000001.00000


Target Position: 1595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1595AUGUAUUUAACUUUUUUUU70.1491612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9571613ATGTATTTAACTTTTTTTTAAAAAAAAGTTAAATACAT0.570200.465300.655200.500001.000001.00000


Target Position: 2252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2252UGCCUUCAAUUUUGAUCCU66.51381922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8622270TGCCTTCAATTTTGATCCTAGGATCAAAATTGAAGGCA0.254600.173600.508600.500001.000001.00000


Target Position: 997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
997CCAGUUAACAUUUAGGGAG69.28861693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8541015CCAGTTAACATTTAGGGAGCTCCCTAAATGTTAACTGG0.049500.033300.534500.750001.000001.00000


Target Position: 901, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
901GUUUUUUGUUUACGAUUUA86.3284384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
551919GTTTTTTGTTTACGATTTATAAATCGTAAACAAAAAAC0.538700.067800.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
899-921TAGTTTTTTGTTTACGATTTATGUAAAUCGUAAACAAAAAACUAGUUUUUUGUUUACGAUUUAUGU15.2-2.912


Target Position: 1052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1052UGUGGAAUUUUUAUACAAG74.7861242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7511070TGTGGAATTTTTATACAAGCTTGTATAAAAATTCCACA0.072500.016400.569000.500001.000001.00000


Target Position: 2200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2200UGCUUCCAAAUCACUUUUU63.66052108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3782218TGCTTCCAAATCACTTTTTAAAAAGTGATTTGGAAGCA0.379100.049800.853400.750001.000001.00000


Target Position: 1984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1984ACUAAUAUAACUACUGUUU76.73881079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4282002ACTAATATAACTACTGTTTAAACAGTAGTTATATTAGT0.473400.432100.706900.750001.000001.00000


Target Position: 2725, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2725GACAAUGUUUUCUGUAUGU82.9099589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8962743GACAATGTTTTCTGTATGTACATACAGAAAACATTGTC0.262300.007800.612100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2723-2745GGGACAATGTTTTCTGTATGTTCACAUACAGAAAACAUUGUCCCGACAAUGUUUUCUGUAUGUUCU17.919.303


Target Position: 1950, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1950GUUUAAACACAAAAUUUAU87.6511312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5691968GTTTAAACACAAAATTTATATAAATTTTGTGTTTAAAC0.839400.729500.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1948-1970AAGTTTAAACACAAAATTTATCAAUAAAUUUUGUGUUUAAACUUGUUUAAACACAAAAUUUAUCAU-9.70.012


Target Position: 1720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1720UUGUUUAAUGUCUUAUGAA83.3059568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9771738TTGTTTAATGTCTTATGAATTCATAAGACATTAAACAA0.018700.001300.474100.500001.000001.00000


Target Position: 1912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1912UCCUUAUUCCCUCUUGGCA69.29581692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531930TCCTTATTCCCTCTTGGCATGCCAAGAGGGAATAAGGA0.035200.001800.517200.500000.951100.62500


Target Position: 2655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2655CACCAAACAAAAAUGCCAU80.8148747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4672673CACCAAACAAAAATGCCATATGGCATTTTTGTTTGGTG0.173900.130200.637900.750000.962000.75000


Target Position: 1708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1708UGAUGGCUAGCUUUGUUUA84.4135495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4891726TGATGGCTAGCTTTGTTTATAAACAAAGCTAGCCATCA0.157000.052200.689700.750001.000001.00000


Target Position: 2617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2617UCACUUUACAAAAUAUUUC60.5042292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9442635TCACTTTACAAAATATTTCGAAATATTTTGTAAAGTGA0.304500.204500.551700.500001.000001.00000


Target Position: 746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
746UGAGAGACAACUUGACAUU77.01451056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
544764TGAGAGACAACTTGACATTAATGTCAAGTTGTCTCTCA0.253400.022800.715500.750001.000001.00000


Target Position: 1892, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1892GUACAUUUUUUGAAAUUUA94.04881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861910GTACATTTTTTGAAATTTATAAATTTCAAAAAATGTAC0.283100.180600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1890-1912TTGTACATTTTTTGAAATTTATTUAAAUUUCAAAAAAUGUACAAGUACAUUUUUUGAAAUUUAUUU0.46.921


Target Position: 450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
450AGGAGAUUACUACCGUUAC70.13951614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
665468AGGAGATTACTACCGTTACGTAACGGTAGTAATCTCCT0.172300.016600.663800.500000.923900.62500


Target Position: 2138, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2138CUUAGGAAGCCACAAUGUU78.1697960

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2136-2158AACTTAGGAAGCCACAATGTTCTAACAUUGUGGCUUCCUAAGUUCUUAGGAAGCCACAAUGUUCUU19.319.903


Target Position: 511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
511GAUCAGUCACAACAAGCAU89.3487227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
759529GATCAGTCACAACAAGCATATGCTTGTTGTGACTGATC0.192300.010800.525900.750001.000001.00000


Target Position: 1573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1573CACAGCAGUAAAACAAAAA88.3532272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071591CACAGCAGTAAAACAAAAATTTTTGTTTTACTGCTGTG0.232200.186800.793100.750001.000001.00000


Target Position: 2569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2569UCCUCCUCUAUUCUCUAAA73.49321362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4002587TCCTCCTCTATTCTCTAAATTTAGAGAATAGAGGAGGA0.501800.290600.870700.750001.000001.00000


Target Position: 615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
615CUAUUAUGAGAUUCUGAAC76.67451087

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
980633CTATTATGAGATTCTGAACGTTCAGAATCTCATAATAG0.113700.013700.525900.500001.000001.00000


Target Position: 1464, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1464CACUCAUUUUAUUUGUAUU91.2983155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4091482CACTCATTTTATTTGTATTAATACAAATAAAATGAGTG0.395800.152200.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1462-1484TACACTCATTTTATTTGTATTTAAAUACAAAUAAAAUGAGUGUACACUCAUUUUAUUUGUAUUUAU6.919.202


Target Position: 2319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2319CUUCUGUCUUGUCACCAAC70.5111587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8962337CTTCTGTCTTGTCACCAACGTTGGTGACAAGACAGAAG0.057700.018100.491400.500000.967400.62500


Target Position: 206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
206GGAAUCUUCUCUCAGUUGC65.34812003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
942224GGAATCTTCTCTCAGTTGCGCAACTGAGAGAAGATTCC0.029400.003600.517200.500001.000001.00000


Target Position: 830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
830UCCAACUUUUGUCUGCCUC49.93692682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
736848TCCAACTTTTGTCTGCCTCGAGGCAGACAAAAGTTGGA0.365500.040400.560300.500001.000001.00000


Target Position: 2731, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2731GUUUUCUGUAUGUUCUAUU80.1244791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7192749GTTTTCTGTATGTTCTATTAATAGAACATACAGAAAAC0.087500.011200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2729-2751ATGTTTTCTGTATGTTCTATTGTAAUAGAACAUACAGAAAACAUGUUUUCUGUAUGUUCUAUUGUU14.512.202


Target Position: 2493, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2493GUGUUUAUCUCCCUUUAAA93.913982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4842511GTGTTTATCTCCCTTTAAATTTAAAGGGAGATAAACAC0.676500.352700.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2491-2513CTGTGTTTATCTCCCTTTAAAACUUUAAAGGGAGAUAAACACAGGUGUUUAUCUCCCUUUAAAACU11.06.902


Target Position: 2650, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2650GAAAACACCAAACAAAAAU78.8521897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3532668GAAAACACCAAACAAAAATATTTTTGTTTGGTGTTTTC0.409100.234300.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2648-2670CAGAAAACACCAAACAAAAATGCAUUUUUGUUUGGUGUUUUCUGGAAAACACCAAACAAAAAUGCU5.613.301


Target Position: 603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
603CUUCUCUGUGUUCUAUUAU78.8559896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
684621CTTCTCTGTGTTCTATTATATAATAGAACACAGAGAAG0.146700.014000.594800.750001.000001.00000


Target Position: 1609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1609UUUUUAGGAUUUUUGCUUU67.69841827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8601627TTTTTAGGATTTTTGCTTTAAAGCAAAAATCCTAAAAA0.086900.032300.500000.500001.000001.00000


Target Position: 1715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1715UAGCUUUGUUUAAUGUCUU74.52021263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9821733TAGCTTTGTTTAATGTCTTAAGACATTAAACAAAGCTA0.016400.002300.534500.500001.000001.00000


Target Position: 1025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1025UUCAUCUUGAGGUGGCCAA64.13912070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8921043TTCATCTTGAGGTGGCCAATTGGCCACCTCAAGATGAA0.044800.003000.525900.500001.000001.00000


Target Position: 2685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2685UGUAUUUUUUCUUUUAGAA84.5163487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7232703TGTATTTTTTCTTTTAGAATTCTAAAAGAAAAAATACA0.178400.048800.534500.750001.000001.00000


Target Position: 2566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2566UCUUCCUCCUCUAUUCUCU69.63991653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8632584TCTTCCTCCTCTATTCTCTAGAGAATAGAGGAGGAAGA0.499000.320400.500000.500001.000001.00000


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783AGGAGACGAAGCUGAAGCA85.8243415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
897801AGGAGACGAAGCTGAAGCATGCTTCAGCTTCGTCTCCT0.067300.012700.491400.500001.000001.00000


Target Position: 1671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1671GUGCUGUAAAAAUAGUUAA89.8647203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7071689GTGCTGTAAAAATAGTTAATTAACTATTTTTACAGCAC0.101700.012200.758600.750001.000001.00000


Target Position: 1681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1681AAUAGUUAACAGGGAAAUA85.981402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9711699AATAGTTAACAGGGAAATATATTTCCCTGTTAACTATT0.120300.023800.465500.500001.000001.00000


Target Position: 2267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2267UCCUUUAUUCUUUCUAUUU71.23151536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1872285TCCTTTATTCTTTCTATTTAAATAGAAAGAATAAAGGA0.468200.301000.870700.750001.000001.00000


Target Position: 1028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1028AUCUUGAGGUGGCCAAUAU77.01651055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9461046ATCTTGAGGTGGCCAATATATATTGGCCACCTCAAGAT0.028600.003500.637900.500001.000001.00000


Target Position: 1937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1937GGGCUCUUACCAAGUUUAA87.898300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6281955GGGCTCTTACCAAGTTTAATTAAACTTGGTAAGAGCCC0.109200.020800.956901.000000.918500.62500


Target Position: 1537, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1537GAAUUGCUUGGUAUUCAUU86.8666348

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1535-1557ATGAATTGCTTGGTATTCATTACAAUGAAUACCAAGCAAUUCAUGAAUUGCUUGGUAUUCAUUACU8.718.513


Target Position: 1397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1397GGGCAGAAACGGUUCACAU89.5401219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9121415GGGCAGAAACGGTTCACATATGTGAACCGTTTCTGCCC0.036400.004100.836201.000001.000001.00000


Target Position: 2545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2545GCCUUUAAAAUCCUUCCUC64.20432066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2672563GCCTTTAAAATCCTTCCTCGAGGAAGGATTTTAAAGGC0.900300.572600.689700.750001.000001.00000


Target Position: 2491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2491CUGUGUUUAUCUCCCUUUA89.2932230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5002509CTGTGTTTATCTCCCTTTATAAAGGGAGATAAACACAG0.665500.105800.750000.750001.000001.00000


Target Position: 1899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1899UUUUGAAAUUUAUUCCUUA84.2163512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9981917TTTTGAAATTTATTCCTTATAAGGAATAAATTTCAAAA0.290600.175300.465500.500000.989101.00000


Target Position: 1935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1935AUGGGCUCUUACCAAGUUU69.5821660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8571953ATGGGCTCTTACCAAGTTTAAACTTGGTAAGAGCCCAT0.075000.004000.655200.500000.918500.87500


Target Position: 424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
424AGCAAAGUCUUCUAUUUGA87.0935338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
871442AGCAAAGTCTTCTATTTGATCAAATAGAAGACTTTGCT0.053200.025400.629300.500001.000001.00000


Target Position: 2625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2625CAAAAUAUUUCCUCAGUAC80.5532763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932643CAAAATATTTCCTCAGTACGTACTGAGGAAATATTTTG0.116300.094900.465500.500001.000001.00000


Target Position: 920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
920UGACAGGUUUAUGUUACUU75.30391194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
735938TGACAGGTTTATGTTACTTAAGTAACATAAACCTGTCA0.129200.010500.586200.750001.000001.00000


Target Position: 1521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1521AAGAUGCAGGAAAAAUGAA84.2552510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9771539AAGATGCAGGAAAAATGAATTCATTTTTCCTGCATCTT0.615600.242700.465500.500001.000001.00000


Target Position: 1711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1711UGGCUAGCUUUGUUUAAUG68.83011730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9371729TGGCTAGCTTTGTTTAATGCATTAAACAAAGCTAGCCA0.029900.011800.689700.500001.000001.00000


Target Position: 1550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1550UUCAUUACUUCAUGUAUAU75.20791202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9931568TTCATTACTTCATGTATATATATACATGAAGTAATGAA0.050400.001100.629300.500000.978300.75000


Target Position: 1861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1861UCUUGGUUCUGAAACUUCU73.57771352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8751879TCTTGGTTCTGAAACTTCTAGAAGTTTCAGAACCAAGA0.217400.058300.500000.500001.000001.00000


Target Position: 1831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1831ACUUUCUCUACAGCUUUUC52.08882629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8491849ACTTTCTCTACAGCTTTTCGAAAAGCTGTAGAGAAAGT0.117900.038100.534500.500000.978300.62500


Target Position: 805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
805GAAGGAGGGGAAAAUUAAC76.08021131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
937823GAAGGAGGGGAAAATTAACGTTAATTTTCCCCTCCTTC0.675300.003800.525900.500001.000001.00000


Target Position: 158, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
158GCAUGAAGUCUGUAACUGA102.047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
777176GCATGAAGTCTGTAACTGATCAGTTACAGACTTCATGC0.065800.046400.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
156-178CTGCATGAAGTCTGTAACTGAGCUCAGUUACAGACUUCAUGCAGGCAUGAAGUCUGUAACUGAGCU19.018.112


Target Position: 2100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2100GUGUUCCAUUUAAAAUUUU77.12381046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3982118GTGTTCCATTTAAAATTTTAAAATTTTAAATGGAACAC0.358600.046300.793100.750001.000001.00000


Target Position: 2007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2007GUCCCAUGAUCCCCUCUCU78.4461932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6762025GTCCCATGATCCCCTCTCTAGAGAGGGGATCATGGGAC0.815400.148800.594800.500001.000001.00000


Target Position: 842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
842CUGCCUCAUUCUAAAAUUU82.125648

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
302860CTGCCTCATTCTAAAATTTAAATTTTAGAATGAGGCAG0.926400.293900.784500.750001.000001.00000


Target Position: 1632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1632AUUUUUUUUUUUUUUUUUU67.94141809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8031650ATTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAT0.571900.482400.508600.500001.000001.00000


Target Position: 1769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1769AAGAACACGUGUAUUAAAU79.4238850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9101787AAGAACACGTGTATTAAATATTTAATACACGTGTTCTT0.535800.024300.629300.500001.000001.00000


Target Position: 365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
365GCAAUGAUGUACUGUCUCU88.9785245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
697383GCAATGATGTACTGTCTCTAGAGACAGTACATCATTGC0.087900.015300.629300.750001.000001.00000


Target Position: 893, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893CACAAAUAGUUUUUUGUUU82.1812642

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
891-913CCCACAAATAGTTTTTTGTTTACAAACAAAAAACUAUUUGUGGGCACAAAUAGUUUUUUGUUUACU5.66.902


Target Position: 2426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2426UUGCAUCCCACAGACUAUU61.05762258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5332444TTGCATCCCACAGACTATTAATAGTCTGTGGGATGCAA0.403900.157500.637900.500001.000001.00000


Target Position: 2410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2410ACCCUGCUUCCUUUGCUUG57.5782434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8772428ACCCTGCTTCCTTTGCTTGCAAGCAAAGGAAGCAGGGT0.085100.015500.706900.500000.978300.87500


Target Position: 761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
761CAUUGUGGACAUCGGAUAC75.54751172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
959779CATTGTGGACATCGGATACGTATCCGATGTCCACAATG0.031300.001700.474100.500001.000001.00000


Target Position: 789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
789CGAAGCUGAAGCAGGAGAA88.2852275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
822807CGAAGCTGAAGCAGGAGAATTCTCCTGCTTCAGCTTCG0.055500.022600.620701.000001.000001.00000


Target Position: 1123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1123GUGUAAAACUGCUUCCAUG82.033659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8711141GTGTAAAACTGCTTCCATGCATGGAAGCAGTTTTACAC0.046700.004700.637900.500001.000001.00000


Target Position: 2636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2636CUCAGUACUUUGCAGAAAA90.9126170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242654CTCAGTACTTTGCAGAAAATTTTCTGCAAAGTACTGAG0.082100.035100.810300.750001.000001.00000


Target Position: 963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
963UGUGGUUUUUAUGUUUAAU74.78321243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
477981TGTGGTTTTTATGTTTAATATTAAACATAAAAACCACA0.160500.069400.698300.750001.000001.00000


Target Position: 267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
267CGUCUCAAGUAUUGAACAA94.754965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
765285CGTCTCAAGTATTGAACAATTGTTCAATACTTGAGACG0.182900.007600.629301.000000.978300.75000


Target Position: 358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
358GAUAUCUGCAAUGAUGUAC69.14911708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
947376GATATCTGCAATGATGTACGTACATCATTGCAGATATC0.035500.002200.500000.500001.000001.00000


Target Position: 1504, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1504GAACAAAUGUAAAAGUAAA102.5356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3741522GAACAAATGTAAAAGTAAATTTACTTTTACATTTGTTC0.621900.183600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1502-1524AAGAACAAATGTAAAAGTAAAGAUUUACUUUUACAUUUGUUCUUGAACAAAUGUAAAAGUAAAGAU4.95.302


Target Position: 1348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1348GCAGAAGUGUUCCUUUAGA89.8367205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6731366GCAGAAGTGTTCCTTTAGATCTAAAGGAACACTTCTGC0.096200.014500.629300.750000.978300.75000


Target Position: 1437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1437UGCUGUUAGCUUUCAUUAU77.9705976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9361455TGCTGTTAGCTTTCATTATATAATGAAAGCTAACAGCA0.495000.002100.810300.750000.940200.62500


Target Position: 717, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
717CAAAGACAGCACGCUAAUA93.0927102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
572735CAAAGACAGCACGCTAATATATTAGCGTGCTGTCTTTG0.197300.022700.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
715-737TACAAAGACAGCACGCTAATAATUAUUAGCGUGCUGUCUUUGUACAAAGACAGCACGCUAAUAAUU20.419.213


Target Position: 2351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2351UGGCCAUGUACUUGGAAAA80.5391764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992369TGGCCATGTACTTGGAAAATTTTCCAAGTACATGGCCA0.241000.002700.844800.750000.956500.87500


Target Position: 2241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2241CUCUUAUAGCCUGCCUUCA77.8633985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9112259CTCTTATAGCCTGCCTTCATGAAGGCAGGCTATAAGAG0.341200.126400.586200.500001.000001.00000


Target Position: 1770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1770AGAACACGUGUAUUAAAUU85.1582448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211788AGAACACGTGTATTAAATTAATTTAATACACGTGTTCT0.567800.026200.715500.750001.000001.00000


Target Position: 2186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2186AACUGUAAGUUUUGUGCUU77.8892982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9042204AACTGTAAGTTTTGTGCTTAAGCACAAAACTTACAGTT0.038700.004200.508600.500001.000001.00000


Target Position: 531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
531CCAAGAAGCUUUUGAAAUC74.45781269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
606549CCAAGAAGCTTTTGAAATCGATTTCAAAAGCTTCTTGG0.372800.018500.663800.750001.000001.00000


Target Position: 516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
516GUCACAACAAGCAUACCAA94.208774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
557534GTCACAACAAGCATACCAATTGGTATGCTTGTTGTGAC0.128700.079300.672400.750001.000001.00000


Target Position: 421, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
421GAGAGCAAAGUCUUCUAUU87.2986329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
902439GAGAGCAAAGTCTTCTATTAATAGAAGACTTTGCTCTC0.049100.002600.801700.750001.000001.00000


Target Position: 2248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2248AGCCUGCCUUCAAUUUUGA77.09731049

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8602266AGCCTGCCTTCAATTTTGATCAAAATTGAAGGCAGGCT0.205700.103400.629300.500001.000001.00000


Target Position: 684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
684UGCUGAACUUGAUACAUUA95.379857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
629702TGCTGAACTTGATACATTATAATGTATCAAGTTCAGCA0.108300.026700.819000.750001.000001.00000


Target Position: 2352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2352GGCCAUGUACUUGGAAAAA85.4865429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6182370GGCCATGTACTTGGAAAAATTTTTCCAAGTACATGGCC0.228200.017401.000001.000000.956500.75000


Target Position: 1972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1972AACAAAAAUACUACUAAUA88.1006288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6041990AACAAAAATACTACTAATATATTAGTAGTATTTTTGTT0.855800.754500.603400.500001.000001.00000


Target Position: 2738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2738GUAUGUUCUAUUGUGCCUA86.3579376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7982756GTATGTTCTATTGTGCCTATAGGCACAATAGAACATAC0.093600.032700.508600.750001.000001.00000


Target Position: 2406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2406AGGCACCCUGCUUCCUUUG55.54512511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672424AGGCACCCTGCTTCCTTTGCAAAGGAAGCAGGGTGCCT0.313200.003700.698300.500000.967400.75000


Target Position: 2492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2492UGUGUUUAUCUCCCUUUAA82.2102638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3632510TGTGTTTATCTCCCTTTAATTAAAGGGAGATAAACACA0.627000.254600.672400.750001.000001.00000


Target Position: 2646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2646UGCAGAAAACACCAAACAA87.1886334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2002664TGCAGAAAACACCAAACAATTGTTTGGTGTTTTCTGCA0.528800.137200.706900.750001.000001.00000


Target Position: 2175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2175UGGGUAGCAUUAACUGUAA85.8054416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9622193TGGGTAGCATTAACTGTAATTACAGTTAATGCTACCCA0.082200.001600.810300.750000.989101.00000


Target Position: 2387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2387UGGCUCCACUCAGUGUCUA75.90181140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9612405TGGCTCCACTCAGTGTCTATAGACACTGAGTGGAGCCA0.023700.004700.672400.750000.972801.00000


Target Position: 2329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2329GUCACCAACCAUUCUUACU74.89261234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9312347GTCACCAACCATTCTTACTAGTAAGAATGGTTGGTGAC0.432200.028000.612100.500001.000001.00000


Target Position: 1058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1058AUUUUUAUACAAGUUAUAA84.9565463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9631076ATTTTTATACAAGTTATAATTATAACTTGTATAAAAAT0.095200.030600.474100.500001.000001.00000


Target Position: 311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
311AGCAGAUGGCUCGAGAAUA85.9819401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
889329AGCAGATGGCTCGAGAATATATTCTCGAGCCATCTGCT0.056100.003100.810300.750000.972800.62500


Target Position: 802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
802GGAGAAGGAGGGGAAAAUU82.3107632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
885820GGAGAAGGAGGGGAAAATTAATTTTCCCCTCCTTCTCC0.044500.005400.862101.000001.000001.00000


Target Position: 270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
270CUCAAGUAUUGAACAAAAG72.70961436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
934288CTCAAGTATTGAACAAAAGCTTTTGTTCAATACTTGAG0.192000.031600.672400.500001.000001.00000


Target Position: 2318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2318CCUUCUGUCUUGUCACCAA96.299241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8522336CCTTCTGTCTTGTCACCAATTGGTGACAAGACAGAAGG0.049800.020900.698301.000000.989100.62500


Target Position: 988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
988GGAGUAGAGCCAGUUAACA90.9674168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8431006GGAGTAGAGCCAGTTAACATGTTAACTGGCTCTACTCC0.198800.004300.663800.750001.000001.00000


Target Position: 2250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2250CCUGCCUUCAAUUUUGAUC60.92992264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3642268CCTGCCTTCAATTTTGATCGATCAAAATTGAAGGCAGG0.254800.180600.663800.750001.000001.00000


Target Position: 1747, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1747GAACAAUCCAAGCAUAAUU87.7148308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8841765GAACAATCCAAGCATAATTAATTATGCTTGGATTGTTC0.044700.012900.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1745-1767ATGAACAATCCAAGCATAATTGTAAUUAUGCUUGGAUUGUUCAUGAACAAUCCAAGCAUAAUUGUU15.214.803


Target Position: 1344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1344AGCUGCAGAAGUGUUCCUU70.64731578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9651362AGCTGCAGAAGTGTTCCTTAAGGAACACTTCTGCAGCT0.022700.003400.715500.750000.978300.62500


Target Position: 593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
593UGGCCCUUAACUUCUCUGU59.91832318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
627611TGGCCCTTAACTTCTCTGTACAGAGAAGTTAAGGGCCA0.109300.060700.637900.500001.000001.00000


Target Position: 1543, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1543CUUGGUAUUCAUUACUUCA90.9927164

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1541-1563TGCTTGGTATTCATTACTTCATGUGAAGUAAUGAAUACCAAGCACUUGGUAUUCAUUACUUCAUGU14.620.011


Target Position: 1057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1057AAUUUUUAUACAAGUUAUA85.7277420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9721075AATTTTTATACAAGTTATATATAACTTGTATAAAAATT0.092400.032200.465500.500001.000001.00000


Target Position: 1938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1938GGCUCUUACCAAGUUUAAA92.0851127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001956GGCTCTTACCAAGTTTAAATTTAAACTTGGTAAGAGCC0.157800.030001.000001.000000.962000.62500


Target Position: 911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
911UACGAUUUAUGACAGGUUU72.11831479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
908929TACGATTTATGACAGGTTTAAACCTGTCATAAATCGTA0.037500.021200.681000.500001.000001.00000


Target Position: 2323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2323UGUCUUGUCACCAACCAUU73.86651321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6002341TGTCTTGTCACCAACCATTAATGGTTGGTGACAAGACA0.116800.019000.698300.750000.983700.62500


Target Position: 1140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1140UGUCUAAGCAAAGAAAACU70.38441595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8531158TGTCTAAGCAAAGAAAACTAGTTTTCTTTGCTTAGACA0.197200.008400.500000.500000.989100.75000


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975GUUUAAUAUUAGGGGAGUA91.5032148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
975993GTTTAATATTAGGGGAGTATACTCCCCTAATATTAAAC0.092900.044600.465500.750001.000001.00000


Target Position: 530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
530ACCAAGAAGCUUUUGAAAU72.23181469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
617548ACCAAGAAGCTTTTGAAATATTTCAAAAGCTTCTTGGT0.315200.017600.844800.750001.000001.00000


Target Position: 1866, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1866GUUCUGAAACUUCUCUAAA90.7708176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8371884GTTCTGAAACTTCTCTAAATTTAGAGAAGTTTCAGAAC0.053100.018600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1864-1886TGGTTCTGAAACTTCTCTAAAGGUUUAGAGAAGUUUCAGAACCAGUUCUGAAACUUCUCUAAAGGU20.220.401


Target Position: 1461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1461CUACACUCAUUUUAUUUGU74.88391235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9731479CTACACTCATTTTATTTGTACAAATAAAATGAGTGTAG0.226600.119000.465500.500001.000001.00000


Target Position: 2091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2091AAAUGUAGUGUGUUCCAUU87.1841335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9022109AAATGTAGTGTGTTCCATTAATGGAACACACTACATTT0.038900.014200.491400.500001.000001.00000


Target Position: 1752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1752AUCCAAGCAUAAUUGUUAA86.7629351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8781770ATCCAAGCATAATTGTTAATTAACAATTATGCTTGGAT0.122100.018500.646600.500001.000001.00000


Target Position: 1318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1318UACUCAAUGUGUACACCUU82.2542636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9561336TACTCAATGTGTACACCTTAAGGTGTACACATTGAGTA0.024500.011000.543100.500001.000001.00000


Target Position: 130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
130GCUGAGCGAUAUGAUGACA89.4779222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
681148GCTGAGCGATATGATGACATGTCATCATATCGCTCAGC0.117300.014000.646600.750001.000001.00000


Target Position: 2210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2210UCACUUUUUGGUUUUUAAG59.70852331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8902228TCACTTTTTGGTTTTTAAGCTTAAAAACCAAAAAGTGA0.078800.003100.586200.500001.000001.00000


Target Position: 1048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048GGGAUGUGGAAUUUUUAUA91.4938149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9071066GGGATGTGGAATTTTTATATATAAAAATTCCACATCCC0.106900.002600.948301.000001.000001.00000


Target Position: 924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
924AGGUUUAUGUUACUUCUAU86.3302382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
399942AGGTTTATGTTACTTCTATATAGAAGTAACATAAACCT0.205300.073700.801700.750001.000001.00000


Target Position: 820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820UAACCGGCCUUCCAACUUU69.9411628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
843838TAACCGGCCTTCCAACTTTAAAGTTGGAAGGCCGGTTA0.107400.004300.534500.500000.945700.87500


Target Position: 2544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2544UGCCUUUAAAAUCCUUCCU58.61332379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7992562TGCCTTTAAAATCCTTCCTAGGAAGGATTTTAAAGGCA0.931700.504700.508600.500001.000001.00000


Target Position: 557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
557AGGAAAUGCAACCAACACA84.365501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
578575AGGAAATGCAACCAACACATGTGTTGGTTGCATTTCCT0.341300.037100.637900.500000.934800.62500


Target Position: 2535, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2535GUCAUUGUCUGCCUUUAAA89.6135214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4212553GTCATTGTCTGCCTTTAAATTTAAAGGCAGACAATGAC0.502000.288500.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2533-2555CTGTCATTGTCTGCCTTTAAAATUUUAAAGGCAGACAAUGACAGGUCAUUGUCUGCCUUUAAAAUU11.020.502


Target Position: 2656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2656ACCAAACAAAAAUGCCAUU67.84021822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4762674ACCAAACAAAAATGCCATTAATGGCATTTTTGTTTGGT0.160900.171300.844800.750000.962000.87500


Target Position: 607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
607UCUGUGUUCUAUUAUGAGA80.3994773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
916625TCTGTGTTCTATTATGAGATCTCATAATAGAACACAGA0.465100.002300.500000.500001.000001.00000


Target Position: 2257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2257UCAAUUUUGAUCCUUUAUU65.60241984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3302275TCAATTTTGATCCTTTATTAATAAAGGATCAAAATTGA0.677300.168000.715500.750001.000001.00000


Target Position: 2556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2556CCUUCCUCUUUCUUCCUCC63.63972111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9542574CCTTCCTCTTTCTTCCTCCGGAGGAAGAAAGAGGAAGG0.509200.492200.474100.500001.000001.00000


Target Position: 1567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1567AUCAAGCACAGCAGUAAAA79.2167870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201585ATCAAGCACAGCAGTAAAATTTTACTGCTGTGCTTGAT0.473900.100000.681000.500001.000001.00000


Target Position: 1141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1141GUCUAAGCAAAGAAAACUG72.97061408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8911159GTCTAAGCAAAGAAAACTGCAGTTTTCTTTGCTTAGAC0.099900.003000.534500.500000.989100.62500


Target Position: 374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
374UACUGUCUCUUUUGGAAAA83.171577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
576392TACTGTCTCTTTTGGAAAATTTTCCAAAAGAGACAGTA0.339900.072700.681000.500001.000001.00000


Target Position: 863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
863ACAGUAGACCAUUUGUCAU82.983587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
796881ACAGTAGACCATTTGTCATATGACAAATGGTCTACTGT0.336100.005800.551700.750000.918500.75000


Target Position: 1623, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623GCUUUUGUGAUUUUUUUUU74.0161308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
631641GCTTTTGTGATTTTTTTTTAAAAAAAAATCACAAAAGC0.754500.442800.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1621-1643TTGCTTTTGTGATTTTTTTTTTTAAAAAAAAAUCACAAAAGCAAGCUUUUGUGAUUUUUUUUUUUU-11.310.301


Target Position: 1947, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1947CAAGUUUAAACACAAAAUU79.3512858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771965CAAGTTTAAACACAAAATTAATTTTGTGTTTAAACTTG0.831600.193600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1945-1967ACCAAGTTTAAACACAAAATTTAAAUUUUGUGUUUAAACUUGGUCAAGUUUAAACACAAAAUUUAU5.34.912


Target Position: 212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
212UUCUCUCAGUUGCUUAUAA82.4566622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
831230TTCTCTCAGTTGCTTATAATTATAAGCAACTGAGAGAA0.121100.004500.637900.500001.000001.00000


Target Position: 1806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1806AGUUUUAUGAAUGGACUUU73.00711404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8551824AGTTTTATGAATGGACTTTAAAGTCCATTCATAAAACT0.049400.005800.706900.750001.000001.00000


Target Position: 2308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2308CCUGUUUUAGCCUUCUGUC67.92451811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7602326CCTGTTTTAGCCTTCTGTCGACAGAAGGCTAAAACAGG0.236900.156600.525900.750001.000001.00000


Target Position: 2683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2683GGUGUAUUUUUUCUUUUAG78.6824910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6592701GGTGTATTTTTTCTTTTAGCTAAAAGAAAAAATACACC0.169000.015200.681000.750001.000001.00000


Target Position: 1498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1498ACCUAAGAACAAAUGUAAA88.643256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2661516ACCTAAGAACAAATGTAAATTTACATTTGTTCTTAGGT0.474800.086000.853400.750001.000001.00000


Target Position: 1156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1156ACUGCCUACAUACUGGUUU66.52911919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9731174ACTGCCTACATACTGGTTTAAACCAGTATGTAGGCAGT0.046600.001400.706900.750000.978300.87500


Target Position: 1148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1148CAAAGAAAACUGCCUACAU88.7579251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9201166CAAAGAAAACTGCCTACATATGTAGGCAGTTTTCTTTG0.048700.039800.491400.750001.000001.00000


Target Position: 2504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2504CCUUUAAAACCCUACCUAU88.6966254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1162522CCTTTAAAACCCTACCTATATAGGTAGGGTTTTAAAGG0.627400.447700.801701.000001.000001.00000


Target Position: 2079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2079UUGAUUAGAAAAAAAUGUA76.77051075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9692097TTGATTAGAAAAAAATGTATACATTTTTTTCTAATCAA0.175900.057300.465500.500001.000001.00000


Target Position: 1843, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1843GCUUUUCAUGUAAAUUAGU77.59661009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8381861GCTTTTCATGTAAATTAGTACTAATTTACATGAAAAGC0.052900.016300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1841-1863CAGCTTTTCATGTAAATTAGTCTACUAAUUUACAUGAAAAGCUGGCUUUUCAUGUAAAUUAGUCUU-4.312.202


Target Position: 1842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1842AGCUUUUCAUGUAAAUUAG74.63251257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8991860AGCTTTTCATGTAAATTAGCTAATTTACATGAAAAGCT0.040100.015300.681000.500001.000001.00000


Target Position: 727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
727ACGCUAAUAAUGCAAUUAC67.10531870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
924745ACGCTAATAATGCAATTACGTAATTGCATTATTAGCGT0.033000.024000.594800.500000.978300.75000


Target Position: 313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
313CAGAUGGCUCGAGAAUACA85.9701404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
728331CAGATGGCTCGAGAATACATGTATTCTCGAGCCATCTG0.568500.010800.577600.500001.000001.00000


Target Position: 2490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2490ACUGUGUUUAUCUCCCUUU72.86131424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4312508ACTGTGTTTATCTCCCTTTAAAGGGAGATAAACACAGT0.593700.075800.706900.750001.000001.00000


Target Position: 1523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1523GAUGCAGGAAAAAUGAAUU85.8043417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581541GATGCAGGAAAAATGAATTAATTCATTTTTCCTGCATC0.169600.072400.672400.750001.000001.00000


Target Position: 728, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
728CGCUAAUAAUGCAAUUACU89.8069206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
678746CGCTAATAATGCAATTACTAGTAATTGCATTATTAGCG0.093800.019800.715500.750000.978300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
726-748CACGCTAATAATGCAATTACTGAAGUAAUUGCAUUAUUAGCGUGCGCUAAUAAUGCAAUUACUGAU6.914.912


Target Position: 2521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2521AUCCUGAAUGGUCUGUCAU72.48821450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7512539ATCCTGAATGGTCTGTCATATGACAGACCATTCAGGAT0.141900.014900.525900.500000.989100.75000


Target Position: 1721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1721UGUUUAAUGUCUUAUGAAA91.3143154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9741739TGTTTAATGTCTTATGAAATTTCATAAGACATTAAACA0.020800.001400.706900.750001.000001.00000


Target Position: 2676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2676UAAAAAAGGUGUAUUUUUU77.13561044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8772694TAAAAAAGGTGTATTTTTTAAAAAATACACCTTTTTTA0.068300.003400.534500.500001.000001.00000


Target Position: 2228, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2228GAAUUUCUUGAUACUCUUA97.871927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4802246GAATTTCTTGATACTCTTATAAGAGTATCAAGAAATTC0.338600.053300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2226-2248AAGAATTTCTTGATACTCTTATAUAAGAGUAUCAAGAAAUUCUUGAAUUUCUUGAUACUCUUAUAU18.95.302


Target Position: 1716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1716AGCUUUGUUUAAUGUCUUA89.5131220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9901734AGCTTTGTTTAATGTCTTATAAGACATTAAACAAAGCT0.013000.001600.819000.750001.000001.00000


Target Position: 268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
268GUCUCAAGUAUUGAACAAA91.1443160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
623286GTCTCAAGTATTGAACAAATTTGTTCAATACTTGAGAC0.200100.016800.819000.750000.978300.75000


Target Position: 2325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2325UCUUGUCACCAACCAUUCU69.61771657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672343TCTTGTCACCAACCATTCTAGAATGGTTGGTGACAAGA0.213100.030800.500000.500000.989100.75000


Target Position: 833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833AACUUUUGUCUGCCUCAUU75.52131173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
840851AACTTTTGTCTGCCTCATTAATGAGGCAGACAAAAGTT0.370000.054900.637900.500001.000001.00000


Target Position: 2635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2635CCUCAGUACUUUGCAGAAA86.6753362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7082653CCTCAGTACTTTGCAGAAATTTCTGCAAAGTACTGAGG0.085400.037100.844801.000001.000001.00000


Target Position: 2559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2559UCCUCUUUCUUCCUCCUCU68.15061790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5812577TCCTCTTTCTTCCTCCTCTAGAGGAGGAAGAAAGAGGA0.456700.444100.646600.500001.000001.00000


Target Position: 759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
759GACAUUGUGGACAUCGGAU84.7647474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
922777GACATTGTGGACATCGGATATCCGATGTCCACAATGTC0.050100.002300.637900.750001.000001.00000


Target Position: 716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
716ACAAAGACAGCACGCUAAU73.67681339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
635734ACAAAGACAGCACGCTAATATTAGCGTGCTGTCTTTGT0.107100.023500.698300.750001.000001.00000


Target Position: 377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
377UGUCUCUUUUGGAAAAGUU73.8881319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
852395TGTCTCTTTTGGAAAAGTTAACTTTTCCAAAAGAGACA0.087900.004100.560300.750000.967400.62500


Target Position: 2686, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2686GUAUUUUUUCUUUUAGAAU83.6536538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4512704GTATTTTTTCTTTTAGAATATTCTAAAAGAAAAAATAC0.175100.048800.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2684-2706GTGTATTTTTTCTTTTAGAATGTAUUCUAAAAGAAAAAAUACACGUAUUUUUUCUUUUAGAAUGUU7.1-9.701


Target Position: 2180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result