siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Sidirect 809   2715  
Biltr, Rnaxs, Sidirect 1212   1503   1683   1985   2413   2423   2936   3862   4141   5225   5410   5411   5555   5565   7289   7954   8417   8805   8958   9582  
9583   10058  
Biltr, Ernai, Rnaxs 949  
Biltr, Sidirect 127   146   147   167   169   212   215   228   239   275   277   447   497   503   506   511   518   554   601   602  
667   691   694   722   732   736   752   789   798   808   812   822   831   833   835   842   844   850   855   857  
866   871   874   876   893   898   924   925   951   960   995   1023   1033   1068   1078   1085   1090   1127   1136   1155  
1164   1213   1219   1234   1266   1287   1294   1299   1302   1340   1346   1350   1352   1354   1359   1361   1402   1452   1461   1462  
1501   1504   1557   1561   1567   1587   1756   1759   1837   1850   1862   1877   1930   1937   1938   1941   1950   1951   1982   1987  
2010   2020   2040   2064   2066   2068   2083   2128   2153   2162   2201   2202   2255   2264   2265   2308   2354   2355   2357   2415  
2418   2475   2478   2518   2534   2540   2543   2544   2549   2590   2591   2634   2689   2742   2751   2752   2777   2780   2845   2856  
2857   2864   2919   2927   2928   2938   2967   3051   3094   3137   3138   3140   3146   3198   3201   3204   3228   3231   3268   3272  
3303   3319   3369   3380   3395   3442   3449   3476   3479   3491   3600   3656   3703   3735   3747   3758   3798   3840   3863   3866  
3955   3984   3997   4007   4008   4014   4027   4042   4050   4138   4142   4181   4183   4189   4198   4220   4230   4236   4264   4265  
4266   4271   4311   4314   4334   4400   4439   4483   4535   4560   4611   4614   4619   4804   4861   4901   4905   4909   4915   4974  
4976   4984   5055   5117   5122   5130   5133   5145   5156   5172   5185   5194   5195   5197   5221   5229   5232   5246   5251   5255  
5257   5270   5274   5277   5294   5303   5323   5332   5334   5363   5386   5387   5389   5400   5402   5413   5421   5423   5448   5467  
5475   5476   5529   5546   5551   5556   5566   5575   5577   5620   5629   5633   5639   5641   5642   5654   5681   5692   5701   5703  
5748   5779   5780   5782   5787   5788   5804   5808   5813   5816   5821   5828   5838   5848   5855   5864   5865   5869   5877   5886  
5901   5912   5913   5925   5952   5953   5960   5965   5974   5977   5981   5994   6008   6023   6033   6107   6112   6170   6172   6176  
6196   6197   6203   6209   6258   6262   6287   6294   6295   6297   6301   6303   6306   6344   6345   6349   6379   6385   6387   6406  
6410   6414   6420   6464   6475   6477   6486   6510   6512   6520   6523   6525   6580   6581   6583   6607   6633   6653   6677   6683  
6687   6688   6691   6712   6717   6738   6741   6772   6786   6792   6793   6816   6826   6832   6841   6842   6846   6856   6857   6863  
6872   6882   6908   6911   6960   6988   7021   7072   7093   7094   7108   7161   7165   7291   7453   7457   7473   7483   7484   7488  
7518   7675   7686   7695   7705   7718   7747   7749   7802   7818   7821   7843   7853   7889   7940   7941   7949   7956   7968   7983  
8006   8009   8056   8063   8066   8087   8088   8089   8093   8099   8103   8112   8123   8131   8136   8147   8157   8167   8198   8201  
8202   8214   8236   8237   8279   8290   8298   8302   8360   8361   8369   8370   8418   8421   8424   8466   8479   8492   8512   8514  
8524   8538   8540   8543   8549   8551   8564   8574   8577   8579   8615   8617   8688   8714   8735   8739   8754   8756   8819   8825  
8827   8830   8833   8838   8840   8847   8881   8883   8892   8909   8939   8944   8947   8949   8952   8959   8992   9012   9019   9022  
9051   9093   9103   9106   9113   9114   9125   9128   9134   9137   9159   9241   9264   9268   9273   9277   9278   9287   9297   9307  
9308   9310   9371   9404   9414   9447   9449   9453   9455   9479   9505   9506   9549   9552   9558   9575   9621   9622   9625   9629  
9631   9641   9644   9674   9678   9681   9683   9686   9689   9698   9706   9711   9719   9723   9731   9735   9747   9752   9772   9774  
9775   9791   9799   9801   9804   9843   9845   9851   9860   9885   9886   9942   9957   10016   10044   10051  
Biltr, Ernai 136   166   297   1057   1448   6604   9008  
Biltr, Rnaxs 385   388   389   897   948   955   958   1208   1209   1326   1511   1580   1586   1671   1679   1681   1682   1979   1984   2294  
2295   2296   2414   2472   2473   2474   2937   3114   3115   3267   3700   3865   3925   3931   4135   4250   4256   4257   4481   4482  
4798   4799   4800   4899   4968   4973   4982   5103   5219   5224   5401   5412   5444   6202   6524   6736   6812   7282   7283   7284  
7288   7290   7574   7575   7740   7742   7745   7746   7798   7799   7800   7921   8029   8033   8043   8062   8159   8409   8410   8411  
8639   8943   8957   9797   9800   10071   10072  


Target Position: 789, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
789CAGAAGAAACUACAUUUCA90.5551791

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
787-809TCCAGAAGAAACTACATTTCACCUGAAAUGUAGUUUCUUCUGGACAGAAGAAACUACAUUUCACCU14.819.123


Target Position: 1164, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1164GUAACAAGUACCUCAAUGA91.7645626

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1162-1184TGGTAACAAGTACCTCAATGAAGUCAUUGAGGUACUUGUUACCAGUAACAAGUACCUCAAUGAAGU18.111.833


Target Position: 1979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1979CGUGUAGACAUAAACAAAA95.078304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7051997CGTGTAGACATAAACAAAATTTTGTTTATGTCTACACG0.808200.095900.775901.000001.000001.00000


Target Position: 389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
389GCAGAAGACAAAAUUAAAA93.6721424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
136407GCAGAAGACAAAATTAAAATTTTAATTTTGTCTTCTGC0.964000.350500.853401.000001.000001.00000


Target Position: 7705, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7705GUUGAUAGACCUGGAAUUU78.08523816

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7703-7725CTGTTGATAGACCTGGAATTTAGAAAUUCCAGGUCUAUCAACAGGUUGAUAGACCUGGAAUUUAGU20.113.423


Target Position: 1587, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1587CUUUUAAGCCAUUUGAACA87.23591364

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1585-1607ACCTTTTAAGCCATTTGAACAGCUGUUCAAAUGGCUUAAAAGGUCUUUUAAGCCAUUUGAACAGCU14.9-3.821


Target Position: 7108, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7108GGAUACUUGACCAAUAUUU85.9791664

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7106-7128AAGGATACTTGACCAATATTTGAAAAUAUUGGUCAAGUAUCCUUGGAUACUUGACCAAUAUUUGAU-1.814.533


Target Position: 1759, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1759GUUAAUCCCUUUUAUUGAU82.55152507

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1757-1779GTGTTAATCCCTTTTATTGATGAAUCAAUAAAAGGGAUUAACACGUUAAUCCCUUUUAUUGAUGAU8.915.522


Target Position: 2153, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2153GCAGAAUCAGAUGAACUUA93.9762392

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2151-2173ATGCAGAATCAGATGAACTTACCUAAGUUCAUCUGAUUCUGCAUGCAGAAUCAGAUGAACUUACCU19.220.422


Target Position: 9137, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9137GUAUAAAAUAGUUUUAGUA98.7126106

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9135-9157ATGTATAAAATAGTTTTAGTAGTUACUAAAACUAUUUUAUACAUGUAUAAAAUAGUUUUAGUAGUU4.9-7.522


Target Position: 1504, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1504GUAUUAUCCUUAUCAUUAU94.5973336

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1502-1524TGGTATTATCCTTATCATTATGCAUAAUGAUAAGGAUAAUACCAGUAUUAUCCUUAUCAUUAUGCU8.73.523


Target Position: 3115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3115GCCUGGAGAAAAUGAGAAU83.9272144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7453133GCCTGGAGAAAATGAGAATATTCTCATTTTCTCCAGGC0.337200.208000.991401.000001.000001.00000


Target Position: 5974, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5974CUUCUAACAAAAUAAAAUA91.6809633

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5972-5994ATCTTCTAACAAAATAAAATATGUAUUUUAUUUUGUUAGAAGAUCUUCUAACAAAAUAAAAUAUGU-10.314.621


Target Position: 5620, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5620CCAGUAUAACUUACUGAAU87.3351342

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5618-5640CTCCAGTATAACTTACTGAATGTAUUCAGUAAGUUAUACUGGAGCCAGUAUAACUUACUGAAUGUU20.313.122


Target Position: 7818, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7818GCUCAUUCAACUUGAAUCU78.41023723

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7816-7838ATGCTCATTCAACTTGAATCTTCAGAUUCAAGUUGAAUGAGCAUGCUCAUUCAACUUGAAUCUUCU16.320.422


Target Position: 1213, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1213GAACUACAAGGAAAAGAAA97.5838143

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1211-1233AGGAACTACAAGGAAAAGAAAAAUUUCUUUUCCUUGUAGUUCCUGAACUACAAGGAAAAGAAAAAU5.519.012


Target Position: 6303, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6303GUUGAAAUUAUUUUAGAAU83.61582226

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6301-6323CTGTTGAAATTATTTTAGAATTTAUUCUAAAAUAAUUUCAACAGGUUGAAAUUAUUUUAGAAUUUU7.17.421


Target Position: 8411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8411GCAGAUGGAAGAAGAAAAA90.7779767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1398429GCAGATGGAAGAAGAAAAATTTTTCTTCTTCCATCTGC0.711000.548900.853401.000001.000001.00000


Target Position: 8892, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8892CAUUUUGUAAGCUUUGUCA88.29491158

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8890-8912TACATTTTGTAAGCTTTGTCAGTUGACAAAGCUUACAAAAUGUACAUUUUGUAAGCUUUGUCAGUU19.25.323


Target Position: 511, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
511GUAUUUUGUAAAUAUGAAA93.2365472

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
509-531AAGTATTTTGTAAATATGAAAATUUUCAUAUUUACAAAAUACUUGUAUUUUGUAAAUAUGAAAAUU8.7-1.421


Target Position: 8492, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8492GGAAAUAGAUAAACUGUAA103.9519

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8490-8512AAGGAAATAGATAAACTGTAAGGUUACAGUUUAUCUAUUUCCUUGGAAAUAGAUAAACUGUAAGGU19.06.922


Target Position: 8564, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8564GUUUAUAGUGGUUGUCUAA95.7092254

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8562-8584CTGTTTATAGTGGTTGTCTAATTUUAGACAACCACUAUAAACAGGUUUAUAGUGGUUGUCUAAUUU20.3-2.333


Target Position: 2068, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2068CAAAUUUUUUUUGAAGAAA84.24932077

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2066-2088CACAAATTTTTTTTGAAGAAAAGUUUCUUCAAAAAAAAUUUGUGCAAAUUUUUUUUGAAGAAAAGU20.4-12.021


Target Position: 6107, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6107CUGAAGAAAUUCUAAUUGU80.79413003

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6105-6127GACTGAAGAAATTCTAATTGTTGACAAUUAGAAUUUCUUCAGUCCUGAAGAAAUUCUAAUUGUUGU3.520.412


Target Position: 6301, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6301CUGUUGAAAUUAUUUUAGA87.20451371

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6299-6321AACTGTTGAAATTATTTTAGAATUCUAAAAUAAUUUCAACAGUUCUGUUGAAAUUAUUUUAGAAUU-4.320.522


Target Position: 3476, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3476GAUGUACUAUUUGAAGUAU90.9023743

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3474-3496CCGATGTACTATTTGAAGTATTAAUACUUCAAAUAGUACAUCGGGAUGUACUAUUUGAAGUAUUAU20.319.022


Target Position: 7718, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7718GAAUUUAGAGUAUAUCUGA98.859595

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7716-7738TGGAATTTAGAGTATATCTGAAAUCAGAUAUACUCUAAAUUCCAGAAUUUAGAGUAUAUCUGAAAU13.3-4.322


Target Position: 9799, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9799GAGAAGUAUUUUAUUAAAA98.6247111

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9797-9819CAGAGAAGTATTTTATTAAAAATUUUUAAUAAAAUACUUCUCUGGAGAAGUAUUUUAUUAAAAAUU-7.518.922


Target Position: 2415, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2415GAAGAAAAGGAAUAAUAAU94.4446350

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2413-2435GAGAAGAAAAGGAATAATAATAAAUUAUUAUUCCUUUUCUUCUCGAAGAAAAGGAAUAAUAAUAAU-8.05.502


Target Position: 2777, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2777CAGCAUAAAUAUUCUAUAA103.64923

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2775-2797ACCAGCATAAATATTCTATAAAGUUAUAGAAUAUUUAUGCUGGUCAGCAUAAAUAUUCUAUAAAGU8.419.732


Target Position: 5952, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5952GGUACAAUGAUUACAAAUU88.25021166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5950-5972AGGGTACAATGATTACAAATTAAAAUUUGUAAUCAUUGUACCCUGGUACAAUGAUUACAAAUUAAU6.914.632


Target Position: 2418, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2418GAAAAGGAAUAAUAAUAAA101.82840

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2416-2438AAGAAAAGGAATAATAATAAATGUUUAUUAUUAUUCCUUUUCUUGAAAAGGAAUAAUAAUAAAUGU-8.018.711


Target Position: 9453, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9453CUCAUUAAAAAGAAUGAGA81.1292901

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9451-9473TTCTCATTAAAAAGAATGAGAATUCUCAUUCUUUUUAAUGAGAACUCAUUAAAAAGAAUGAGAAUU20.48.922


Target Position: 554, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
554GGAGUUACCAUCUACUUCU87.50511309

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
552-574AAGGAGTTACCATCTACTTCTCAAGAAGUAGAUGGUAACUCCUUGGAGUUACCAUCUACUUCUCAU18.921.433


Target Position: 6523, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6523GUCUUACUUGUUUUUUAAA89.0341028

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6521-6543TAGTCTTACTTGTTTTTTAAAATUUUAAAAAACAAGUAAGACUAGUCUUACUUGUUUUUUAAAAUU-9.118.922


Target Position: 6717, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6717GUUCAGAUGUUUAUCAGUU86.13271627

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6715-6737AAGTTCAGATGTTTATCAGTTCCAACUGAUAAACAUCUGAACUUGUUCAGAUGUUUAUCAGUUCCU20.320.423


Target Position: 6464, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6464GCUUGUUAUAUCUGAUUUU86.57351518

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6462-6484CAGCTTGTTATATCTGATTTTCAAAAAUCAGAUAUAACAAGCUGGCUUGUUAUAUCUGAUUUUCAU12.011.812


Target Position: 6512, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6512CUCUUAAAGUAGUCUUACU86.60931509

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6510-6532GACTCTTAAAGTAGTCTTACTTGAGUAAGACUACUUUAAGAGUCCUCUUAAAGUAGUCUUACUUGU21.47.132


Target Position: 1155, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1155GCAAAGUUGGUAACAAGUA88.93591047

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1153-1175AAGCAAAGTTGGTAACAAGTACCUACUUGUUACCAACUUUGCUUGCAAAGUUGGUAACAAGUACCU17.810.322


Target Position: 3204, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3204CUUGUGAUUUACAAAUUCU83.47332256

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3202-3224TTCTTGTGATTTACAAATTCTGGAGAAUUUGUAAAUCACAAGAACUUGUGAUUUACAAAUUCUGGU7.420.523


Target Position: 228, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
228GAAUUUCAGAUGAUAAAAU90.4223806

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
226-248TAGAATTTCAGATGATAAAATCTAUUUUAUCAUCUGAAAUUCUAGAAUUUCAGAUGAUAAAAUCUU2.17.422


Target Position: 9310, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9310GUAAAAAGUCUUUUUUUUU81.58572781

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9308-9330CTGTAAAAAGTCTTTTTTTTTTTAAAAAAAAAGACUUUUUACAGGUAAAAAGUCUUUUUUUUUUUU-11.3-3.811


Target Position: 9287, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9287CAUUUUUUUACAAAGUUAA88.85481059

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9285-9307TACATTTTTTTACAAAGTTAAACUUAACUUUGUAAAAAAAUGUACAUUUUUUUACAAAGUUAAACU4.9-12.021


Target Position: 6414, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6414GUUAUAGCAUACUUUUUUA97.1058168

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6412-6434AAGTTATAGCATACTTTTTTAAAUAAAAAAGUAUGCUAUAACUUGUUAUAGCAUACUUUUUUAAAU-5.914.922


Target Position: 925, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
925GUUUCUUGUUGGUAAUGAU92.1579586

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
923-945GGGTTTCTTGTTGGTAATGATTTAUCAUUACCAACAAGAAACCCGUUUCUUGUUGGUAAUGAUUUU16.112.222


Target Position: 1361, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1361CAAUAUAAAAGAACAUAUU89.7094922

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1359-1381GACAATATAAAAGAACATATTACAAUAUGUUCUUUUAUAUUGUCCAAUAUAAAAGAACAUAUUACU6.7-8.022


Target Position: 1234, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1234GUUAAAGGGCCAGGAAAAU71.72445723

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1232-1254AAGTTAAAGGGCCAGGAAAATTCAUUUUCCUGGCCCUUUAACUUGUUAAAGGGCCAGGAAAAUUCU18.711.023


Target Position: 3369, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3369CAGAAUUUUGUCUUUUUGA84.98641903

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3367-3389TGCAGAATTTTGTCTTTTTGACCUCAAAAAGACAAAAUUCUGCACAGAAUUUUGUCUUUUUGACCU2.15.322


Target Position: 9479, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9479CCAUAGUUAGCUUUAAGUU84.92961911

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9477-9499GTCCATAGTTAGCTTTAAGTTCTAACUUAAAGCUAACUAUGGACCCAUAGUUAGCUUUAAGUUCUU4.911.622


Target Position: 7949, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7949CCUAACUGAAACAUUAUUU78.85593601

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7947-7969CTCCTAACTGAAACATTATTTCTAAAUAAUGUUUCAGUUAGGAGCCUAACUGAAACAUUAUUUCUU-1.816.421


Target Position: 4042, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4042GAAUAUCUCCAAAGAAAAU91.2107693

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4040-4062TTGAATATCTCCAAAGAAAATGAAUUUUCUUUGGAGAUAUUCAAGAAUAUCUCCAAAGAAAAUGAU5.56.621


Target Position: 809, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
809CUUCUACACUUGUCUUUAA95.7652250

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_380919CTTCTACACTTGTCTTTAA1/1/0/0100.00XRN1NM_019001.3+NM_001042604.11+1NANANA3:142141715..142141733(-)00XRN1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
807-829ACCTTCTACACTTGTCTTTAATGUUAAAGACAAGUGUAGAAGGUCUUCUACACUUGUCUUUAAUGU14.620.321


Target Position: 8056, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8056CAUUUUCCUGCAUUACCUA91.5445656

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8054-8076CACATTTTCCTGCATTACCTAATUAGGUAAUGCAGGAAAAUGUGCAUUUUCCUGCAUUACCUAAUU18.514.212


Target Position: 4138, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4138GAUGCUUAAAGAAAUUCUA94.2503371

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4136-4158CGGATGCTTAAAGAAATTCTAAAUAGAAUUUCUUUAAGCAUCCGGAUGCUUAAAGAAAUUCUAAAU5.319.722


Target Position: 9277, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9277CCAAAAGAUACAUUUUUUU79.46433420

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9275-9297TTCCAAAAGATACATTTTTTTACAAAAAAAUGUAUCUUUUGGAACCAAAAGAUACAUUUUUUUACU-12.012.222


Target Position: 2475, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2475GUCGUAAAUAUCAAAUAAA93.4448453

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2473-2495AGGTCGTAAATATCAAATAAATCUUUAUUUGAUAUUUACGACCUGUCGUAAAUAUCAAAUAAAUCU-1.416.532


Target Position: 8063, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8063CUGCAUUACCUAAUAAUUA92.2743572

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8061-8083TCCTGCATTACCTAATAATTACCUAAUUAUUAGGUAAUGCAGGACUGCAUUACCUAAUAAUUACCU-10.321.123


Target Position: 7921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7921GCACUUCAAUCUAUUUAAG79.78143303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9987939GCACTTCAATCTATTTAAGCTTAAATAGATTGAAGTGC0.509600.355500.715500.750001.000001.00000


Target Position: 8543, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8543CUAUUUGUGUUAGUCAUAA90.8944744

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8541-8563TTCTATTTGTGTTAGTCATAACTUUAUGACUAACACAAAUAGAACUAUUUGUGUUAGUCAUAACUU20.36.933


Target Position: 1561, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1561CAAAAUCCAUUUUGAACUA91.1833701

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1559-1581CTCAAAATCCATTTTGAACTAGGUAGUUCAAAAUGGAUUUUGAGCAAAAUCCAUUUUGAACUAGGU19.214.222


Target Position: 9686, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9686CAACAUUUUGUUCAUUUAA90.6836777

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9684-9706TTCAACATTTTGTTCATTTAAACUUAAAUGAACAAAAUGUUGAACAACAUUUUGUUCAUUUAAACU8.95.322


Target Position: 5808, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5808CAAAGCAACUUUAGAAUAA93.9319394

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5806-5828ACCAAAGCAACTTTAGAATAATCUUAUUCUAAAGUUGCUUUGGUCAAAGCAACUUUAGAAUAAUCU8.418.622


Target Position: 5566, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5566CAUUUUUUACACUAUCAUU90.6779778

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5564-5586AGCATTTTTTACACTATCATTGAAAUGAUAGUGUAAAAAAUGCUCAUUUUUUACACUAUCAUUGAU13.3-12.032


Target Position: 4614, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4614CACAAGUAUUUGCAAAUUA93.5964439

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4612-4634TTCACAAGTATTTGCAAATTATCUAAUUUGCAAAUACUUGUGAACACAAGUAUUUGCAAAUUAUCU14.019.022


Target Position: 8103, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8103GUAUUAAUUGAUUUAAACA94.3284365

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8101-8123ATGTATTAATTGATTTAAACATCUGUUUAAAUCAAUUAAUACAUGUAUUAAUUGAUUUAAACAUCU0.0-8.022


Target Position: 7686, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7686CAUGUUGAGGAAACAAUCU80.13963200

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7684-7706CCCATGTTGAGGAAACAATCTGTAGAUUGUUUCCUCAACAUGGGCAUGUUGAGGAAACAAUCUGUU14.820.533


Target Position: 5633, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5633CUGAAUGUGGAUUUUAUUU77.73083925

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5631-5653TACTGAATGTGGATTTTATTTCTAAAUAAAAUCCACAUUCAGUACUGAAUGUGGAUUUUAUUUCUU-9.720.521


Target Position: 7574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7574AGGCAUUCUCUAUUCUUUU79.94343252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7047592AGGCATTCTCTATTCTTTTAAAAGAATAGAGAATGCCT0.528200.096000.844800.750001.000001.00000


Target Position: 1756, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1756GGUGUUAAUCCCUUUUAUU88.70931093

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1754-1776GTGGTGTTAATCCCTTTTATTGAAAUAAAAGGGAUUAACACCACGGUGUUAAUCCCUUUUAUUGAU-4.314.723


Target Position: 9273, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9273GUUUCCAAAAGAUACAUUU79.08773531

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9271-9293TGGTTTCCAAAAGATACATTTTTAAAUGUAUCUUUUGGAAACCAGUUUCCAAAAGAUACAUUUUUU6.720.121


Target Position: 6349, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6349GUUUAUAUAUAUAUAUAUA109.5421

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6347-6369ATGTTTATATATATATATATATTUAUAUAUAUAUAUAUAAACAUGUUUAUAUAUAUAUAUAUAUUU-6.4-8.000


Target Position: 7290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7290UCUACUAAAAAUACAAAAA81.20412877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5867308TCTACTAAAAATACAAAAATTTTTGTATTTTTAGTAGA0.923500.796900.724100.750001.000001.00000


Target Position: 6258, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6258CUCUCUUUGCAUGUCAUAU80.60473061

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6256-6278TTCTCTCTTTGCATGTCATATGTAUAUGACAUGCAAAGAGAGAACUCUCUUUGCAUGUCAUAUGUU21.519.122


Target Position: 5219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5219CUCUUUCCAUCUACCUUUU77.19144085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3235237CTCTTTCCATCTACCTTTTAAAAGGTAGATGGAAAGAG0.569500.529000.810300.750001.000001.00000


Target Position: 1462, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1462GAUUUUGCACUAUUACUAU93.0774491

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1460-1482TGGATTTTGCACTATTACTATCAAUAGUAAUAGUGCAAAAUCCAGAUUUUGCACUAUUACUAUCAU6.314.022


Target Position: 5197, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5197CUUAGAAUUAAGUUAAUUU87.11311398

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5195-5217CTCTTAGAATTAAGTTAATTTCTAAAUUAACUUAAUUCUAAGAGCUUAGAAUUAAGUUAAUUUCUU-0.36.922


Target Position: 5122, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5122CUCUUCUUCAAGAAGAAAA83.23062328

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5120-5142ATCTCTTCTTCAAGAAGAAAATCUUUUCUUCUUGAAGAAGAGAUCUCUUCUUCAAGAAGAAAAUCU14.819.112


Target Position: 10044, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10044GUUAAAUGCUCUAUGGAUU84.79021947

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10042-10064ATGTTAAATGCTCTATGGATTTTAAUCCAUAGAGCAUUUAACAUGUUAAAUGCUCUAUGGAUUUUU21.2-1.422


Target Position: 6960, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6960GAAUUUGCCUCACUCAUUA96.7413193

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6958-6980GAGAATTTGCCTCACTCATTACTUAAUGAGUGAGGCAAAUUCUCGAAUUUGCCUCACUCAUUACUU19.214.022


Target Position: 4008, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4008CUAACUCUGGAAUUGAGAA90.1556849

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4006-4028GCCTAACTCTGGAATTGAGAACTUUCUCAAUUCCAGAGUUAGGCCUAACUCUGGAAUUGAGAACUU20.418.922


Target Position: 5780, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5780CAGUUUUGCUUUAUUCUAA96.9579179

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5778-5800GCCAGTTTTGCTTTATTCTAAATUUAGAAUAAAGCAAAACUGGCCAGUUUUGCUUUAUUCUAAAUU8.410.312


Target Position: 9719, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9719CAUACAUAUAUAGAUACAU91.0246718

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9717-9739TTCATACATATATAGATACATATAUGUAUCUAUAUAUGUAUGAACAUACAUAUAUAGAUACAUAUU20.38.221


Target Position: 5332, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5332CACUUUUCAUGCUGUUUAA95.4276276

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5330-5352GGCACTTTTCATGCTGTTTAAAAUUAAACAGCAUGAAAAGUGCCCACUUUUCAUGCUGUUUAAAAU11.813.332


Target Position: 2540, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2540GUUCCUUUUGUUUAUCAAA88.79811075

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2538-2560TTGTTCCTTTTGTTTATCAAACTUUUGAUAAACAAAAGGAACAAGUUCCUUUUGUUUAUCAAACUU8.918.722


Target Position: 5994, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5994GAAAUAUUAGUCAUGUUAA100.98451

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5992-6014ATGAAATATTAGTCATGTTAATTUUAACAUGACUAAUAUUUCAUGAAAUAUUAGUCAUGUUAAUUU13.5-10.322


Target Position: 9278, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9278CAAAAGAUACAUUUUUUUA94.9778309

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9276-9298TCCAAAAGATACATTTTTTTACAUAAAAAAAUGUAUCUUUUGGACAAAAGAUACAUUUUUUUACAU-11.35.322


Target Position: 1359, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1359GACAAUAUAAAAGAACAUA92.5092548

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1357-1379TAGACAATATAAAAGAACATATTUAUGUUCUUUUAUAUUGUCUAGACAAUAUAAAAGAACAUAUUU19.26.722


Target Position: 4984, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4984CAACAUUGUCAAAGUAAGU82.05142649

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4982-5004TCCAACATTGTCAAAGTAAGTCCACUUACUUUGACAAUGUUGGACAACAUUGUCAAAGUAAGUCCU9.812.133


Target Position: 5828, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5828CAGAAUAUUUCAUCUAACU88.01121204

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5826-5848ATCAGAATATTTCATCTAACTGCAGUUAGAUGAAAUAUUCUGAUCAGAAUAUUUCAUCUAACUGCU14.56.612


Target Position: 6379, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6379GUUUUUGUGAUAUGCUUAU79.05463545

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6377-6399TAGTTTTTGTGATATGCTTATATAUAAGCAUAUCACAAAAACUAGUUUUUGUGAUAUGCUUAUAUU19.75.622


Target Position: 6306, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6306GAAAUUAUUUUAGAAUUUA94.3439364

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6304-6326TTGAAATTATTTTAGAATTTATGUAAAUUCUAAAAUAAUUUCAAGAAAUUAUUUUAGAAUUUAUGU5.3-10.321


Target Position: 8514, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8514CUUUUUUACUCACUUUUUA87.29141352

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8512-8534GTCTTTTTTACTCACTTTTTATTUAAAAAGUGAGUAAAAAAGACCUUUUUUACUCACUUUUUAUUU3.2-9.122


Target Position: 5156, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5156GUUAAUUUUGGUGUUUCUA81.22492868

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5154-5176CTGTTAATTTTGGTGTTTCTAAAUAGAAACACCAAAAUUAACAGGUUAAUUUUGGUGUUUCUAAAU19.2-9.722


Target Position: 5323, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5323GUUAUCAGGCACUUUUCAU81.64672769

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5321-5343AAGTTATCAGGCACTTTTCATGCAUGAAAAGUGCCUGAUAACUUGUUAUCAGGCACUUUUCAUGCU12.213.422


Target Position: 2478, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2478GUAAAUAUCAAAUAAAUCA91.6026647

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2476-2498TCGTAAATATCAAATAAATCAAAUGAUUUAUUUGAUAUUUACGAGUAAAUAUCAAAUAAAUCAAAU1.8-8.021


Target Position: 6872, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6872GUUAAAUUGUGACAGUAAU85.93741668

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6870-6892AAGTTAAATTGTGACAGTAATGTAUUACUGUCACAAUUUAACUUGUUAAAUUGUGACAGUAAUGUU19.0-9.732


Target Position: 6633, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6633CAGUAUAAGAGAGAAAUAU89.3399980

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6631-6653TTCAGTATAAGAGAGAAATATTCAUAUUUCUCUCUUAUACUGAACAGUAUAAGAGAGAAAUAUUCU6.96.312


Target Position: 6262, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6262CUUUGCAUGUCAUAUGUGA86.61671504

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6260-6282CTCTTTGCATGTCATATGTGAATUCACAUAUGACAUGCAAAGAGCUUUGCAUGUCAUAUGUGAAUU13.320.022


Target Position: 667, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667CUGUCUUUAUGGUUUAGAU90.4952797

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
665-687CACTGTCTTTATGGTTTAGATGCAUCUAAACCAUAAAGACAGUGCUGUCUUUAUGGUUUAGAUGCU14.619.222


Target Position: 5251, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5251CUAUGUCUCAUAAAAAUUA93.6211434

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5249-5271ATCTATGTCTCATAAAAATTAGAUAAUUUUUAUGAGACAUAGAUCUAUGUCUCAUAAAAAUUAGAU-12.020.322


Target Position: 5782, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5782GUUUUGCUUUAUUCUAAAU83.92392145

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5780-5802CAGTTTTGCTTTATTCTAAATTTAUUUAGAAUAAAGCAAAACUGGUUUUGCUUUAUUCUAAAUUUU7.118.622


Target Position: 6524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6524UCUUACUUGUUUUUUAAAA76.97474148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9936542TCTTACTTGTTTTTTAAAATTTTAAAAAACAAGTAAGA0.543600.060900.724100.750001.000001.00000


Target Position: 3449, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3449GGAAUAAAAGGAGCUAAUA93.4753450

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3447-3469TAGGAATAAAAGGAGCTAATAGAUAUUAGCUCCUUUUAUUCCUAGGAAUAAAAGGAGCUAAUAGAU18.32.123


Target Position: 5816, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5816CUUUAGAAUAAUCAGAAUA90.5764790

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5814-5836AACTTTAGAATAATCAGAATATTUAUUCUGAUUAUUCUAAAGUUCUUUAGAAUAAUCAGAAUAUUU20.47.122


Target Position: 6196, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6196CCUAUUUCAUUCUGAUUCU81.54182793

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6194-6216TGCCTATTTCATTCTGATTCTATAGAAUCAGAAUGAAAUAGGCACCUAUUUCAUUCUGAUUCUAUU20.46.923


Target Position: 9159, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9159CAAAAUGUCAACUAUCUGU82.58982491

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9157-9179TCCAAAATGTCAACTATCTGTAGACAGAUAGUUGACAUUUUGGACAAAAUGUCAACUAUCUGUAGU17.85.322


Target Position: 7473, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7473GUUUUAUUAUCCUUACUUU90.4627800

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7471-7493AAGTTTTATTATCCTTACTTTTTAAAGUAAGGAUAAUAAAACUUGUUUUAUUAUCCUUACUUUUUU9.8-9.722


Target Position: 2543, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2543CCUUUUGUUUAUCAAACUA90.915738

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2541-2563TTCCTTTTGTTTATCAAACTATTUAGUUUGAUAAACAAAAGGAACCUUUUGUUUAUCAAACUAUUU19.210.322


Target Position: 146, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
146CCUGAAUUUGACAACUUGU79.38083449

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
144-166TTCCTGAATTTGACAACTTGTACACAAGUUGUCAAAUUCAGGAACCUGAAUUUGACAACUUGUACU16.712.022


Target Position: 8421, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8421GAAGAAAAACAGUUAAAUA104.43312

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8419-8441AAGAAGAAAAACAGTTAAATAAGUAUUUAACUGUUUUUCUUCUUGAAGAAAAACAGUUAAAUAAGU-0.35.522


Target Position: 5475, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5475GGACUAAACAUUAAAAUGU84.92861912

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5473-5495GTGGACTAAACATTAAAATGTACACAUUUUAAUGUUUAGUCCACGGACUAAACAUUAAAAUGUACU-1.414.622


Target Position: 4799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4799CCCUUCCAUCAUACUUUAU78.50413695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2664817CCCTTCCATCATACTTTATATAAAGTATGATGGAAGGG0.580300.299100.948301.000001.000001.00000


Target Position: 9735, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9735CAUAUCUUAAUUGAUUUCU70.9495952

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9733-9755TACATATCTTAATTGATTTCTCAAGAAAUCAAUUAAGAUAUGUACAUAUCUUAAUUGAUUUCUCAU16.36.621


Target Position: 2742, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2742CAUGUGAACCCAAUCUUGA88.41721140

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2740-2762TCCATGTGAACCCAATCTTGATGUCAAGAUUGGGUUCACAUGGACAUGUGAACCCAAUCUUGAUGU12.020.532


Target Position: 8087, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8087GCGUUAGAAUUUGAAUGUA91.755627

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8085-8107CAGCGTTAGAATTTGAATGTATTUACAUUCAAAUUCUAACGCUGGCGUUAGAAUUUGAAUGUAUUU20.520.923


Target Position: 2856, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2856GGUUUACAGGAAGUAUUUU84.30232064

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2854-2876AAGGTTTACAGGAAGTATTTTTAAAAAUACUUCCUGUAAACCUUGGUUUACAGGAAGUAUUUUUAU4.614.722


Target Position: 8112, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8112GAUUUAAACAUCAUGUAGA94.5844337

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8110-8132TTGATTTAAACATCATGTAGACTUCUACAUGAUGUUUAAAUCAAGAUUUAAACAUCAUGUAGACUU17.9-9.722


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682UCACCAAUUAUAGAAUAUU74.17594970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6801700TCACCAATTATAGAATATTAATATTCTATAATTGGTGA0.568800.360800.715500.750001.000001.00000


Target Position: 9106, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9106CAUAGAUCCUUUUCUUAAA98.3221120

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9104-9126ATCATAGATCCTTTTCTTAAAGAUUUAAGAAAAGGAUCUAUGAUCAUAGAUCCUUUUCUUAAAGAU7.115.922


Target Position: 7283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7283CCCUGUCUCUACUAAAAAU91.9435602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2417301CCCTGTCTCTACTAAAAATATTTTTAGTAGAGACAGGG0.873700.252400.982801.000001.000001.00000


Target Position: 3231, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3231CUAUUGUUGAGAAAAUUGA82.85192422

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3229-3251AGCTATTGTTGAGAAAATTGAGGUCAAUUUUCUCAACAAUAGCUCUAUUGUUGAGAAAAUUGAGGU-3.36.922


Target Position: 4973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4973CCAGAUUCUUCCAACAUUG76.28654344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9694991CCAGATTCTTCCAACATTGCAATGTTGGAAGAATCTGG0.294000.155000.698300.750001.000001.00000


Target Position: 2927, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2927GGUUUAAAUCUCAAAUUCA98.7624101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2925-2947TGGGTTTAAATCTCAAATTCAACUGAAUUUGAGAUUUAAACCCAGGUUUAAAUCUCAAAUUCAACU7.40.032


Target Position: 822, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
822CUUUAAUGAGAGAGUAUAU91.6594640

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
820-842GTCTTTAATGAGAGAGTATATTGAUAUACUCUCUCAUUAAAGACCUUUAAUGAGAGAGUAUAUUGU15.8-1.422


Target Position: 5225, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5225CCAUCUACCUUUUUAUAAA98.958894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3295243CCATCTACCTTTTTATAAATTTATAAAAAGGTAGATGG0.538500.491000.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5223-5245TTCCATCTACCTTTTTATAAATAUUUAUAAAAAGGUAGAUGGAACCAUCUACCUUUUUAUAAAUAU-7.520.322


Target Position: 9731, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9731GAUACAUAUCUUAAUUGAU96.2541216

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9729-9751TAGATACATATCTTAATTGATTTAUCAAUUAAGAUAUGUAUCUAGAUACAUAUCUUAAUUGAUUUU8.98.232


Target Position: 167, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
167CUGGAUAUGAAUGGAAUUA82.69812457

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
165-187ACCTGGATATGAATGGAATTATAUAAUUCCAUUCAUAUCCAGGUCUGGAUAUGAAUGGAAUUAUAU20.121.222


Target Position: 4481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4481UGCCAAGUAAAAUUAUCUA83.99042124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9954499TGCCAAGTAAAATTATCTATAGATAATTTTACTTGGCA0.408800.081300.681000.750001.000001.00000


Target Position: 5133, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5133GAAGAAAAUCAAGAAAACU84.83341935

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5131-5153AAGAAGAAAATCAAGAAAACTGGAGUUUUCUUGAUUUUCUUCUUGAAGAAAAUCAAGAAAACUGGU13.35.511


Target Position: 602, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
602CAUAAAAUCAUGGAAUUUA91.3652676

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
600-622AGCATAAAATCATGGAATTTATCUAAAUUCCAUGAUUUUAUGCUCAUAAAAUCAUGGAAUUUAUCU14.2-10.322


Target Position: 8417, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8417GGAAGAAGAAAAACAGUUA98.2796122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7608435GGAAGAAGAAAAACAGTTATAACTGTTTTTCTTCTTCC0.332200.342800.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8415-8437ATGGAAGAAGAAAAACAGTTAAAUAACUGUUUUUCUUCUUCCAUGGAAGAAGAAAAACAGUUAAAU17.819.122


Target Position: 6736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6736CCCAACAUUGUUUCUUUAU73.97035036

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9816754CCCAACATTGTTTCTTTATATAAAGAAACAATGTTGGG0.449000.061900.948301.000001.000001.00000


Target Position: 9747, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9747GAUUUCUCAACUAUUUUAU83.50972249

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9745-9767TTGATTTCTCAACTATTTTATAAAUAAAAUAGUUGAGAAAUCAAGAUUUCUCAACUAUUUUAUAAU-7.514.822


Target Position: 7853, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7853GAAAAUGGUGGACUGUUUA91.6417643

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7851-7873GTGAAAATGGTGGACTGTTTAGGUAAACAGUCCACCAUUUUCACGAAAAUGGUGGACUGUUUAGGU17.811.322


Target Position: 2590, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2590CCGUUUCUCCAAUAUCAAA91.8867612

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2588-2610TCCCGTTTCTCCAATATCAAAACUUUGAUAUUGGAGAAACGGGACCGUUUCUCCAAUAUCAAAACU8.719.732


Target Position: 5401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5401UCAAUUAUACCUCAAUAAA83.872155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8305419TCAATTATACCTCAATAAATTTATTGAGGTATAATTGA0.311800.082000.724100.750001.000001.00000


Target Position: 9711, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9711GUGUAAUUCAUACAUAUAU89.2481993

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9709-9731AAGTGTAATTCATACATATATAGAUAUAUGUAUGAAUUACACUUGUGUAAUUCAUACAUAUAUAGU8.26.922


Target Position: 1136, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1136GACCUAAAAUGGUUUGAAA99.586876

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1134-1156TGGACCTAAAATGGTTTGAAAGCUUUCAAACCAUUUUAGGUCCAGACCUAAAAUGGUUUGAAAGCU14.918.622


Target Position: 4271, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4271CAAAAUAAGAAAUUAGCAU85.1311866

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4269-4291AACAAAATAAGAAATTAGCATCTAUGCUAAUUUCUUAUUUUGUUCAAAAUAAGAAAUUAGCAUCUU19.7-9.722


Target Position: 8418, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8418GAAGAAGAAAAACAGUUAA94.529342

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8416-8438TGGAAGAAGAAAAACAGTTAAATUUAACUGUUUUUCUUCUUCCAGAAGAAGAAAAACAGUUAAAUU19.019.112


Target Position: 6023, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6023GUAUUAUUUUGUAUAGCUU90.0786865

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6021-6043CTGTATTATTTTGTATAGCTTTTAAGCUAUACAAAAUAAUACAGGUAUUAUUUUGUAUAGCUUUUU19.5-8.012


Target Position: 9583, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9583GCUUUAAGUAUCAUAUUUU90.3794809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5289601GCTTTAAGTATCATATTTTAAAATATGATACTTAAAGC0.469500.128500.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9581-9603TGGCTTTAAGTATCATATTTTCTAAAAUAUGAUACUUAAAGCCAGCUUUAAGUAUCAUAUUUUCUU-1.81.332


Target Position: 8833, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8833CAUUUGUCAUUUUUCUAGA89.6055935

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8831-8853TTCATTTGTCATTTTTCTAGAGAUCUAGAAAAAUGACAAAUGAACAUUUGUCAUUUUUCUAGAGAU11.714.822


Target Position: 1068, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1068CUCGAUUUGAGAAAUACCU71.69175733

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1066-1088ACCTCGATTTGAGAAATACCTTGAGGUAUUUCUCAAAUCGAGGUCUCGAUUUGAGAAAUACCUUGU13.916.722


Target Position: 7484, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7484CUUACUUUUUUUUUAACAU80.77763008

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7482-7504TCCTTACTTTTTTTTTAACATTAAUGUUAAAAAAAAAGUAAGGACUUACUUUUUUUUUAACAUUAU7.24.921


Target Position: 2128, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2128CAUGAUGUUGGAAAUCUUA94.6684331

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2126-2148AACATGATGTTGGAAATCTTAGTUAAGAUUUCCAACAUCAUGUUCAUGAUGUUGGAAAUCUUAGUU5.320.522


Target Position: 7021, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7021GUUUUAGAGCAUAGAAGAA94.3454363

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7019-7041CTGTTTTAGAGCATAGAAGAAGCUUCUUCUAUGCUCUAAAACAGGUUUUAGAGCAUAGAAGAAGCU20.27.123


Target Position: 3747, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3747CUAAAGAUGAUGAUGAAUU82.02522659

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3745-3767TACTAAAGATGATGATGAATTCTAAUUCAUCAUCAUCUUUAGUACUAAAGAUGAUGAUGAAUUCUU16.26.922


Target Position: 5387, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5387CAGUUUGUUGUAUGUCAAU86.07881639

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5385-5407TGCAGTTTGTTGTATGTCAATTAAUUGACAUACAACAAACUGCACAGUUUGUUGUAUGUCAAUUAU20.517.821


Target Position: 5692, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5692CUUAUUUAUGUGUGUUUUA86.90461435

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5690-5712CTCTTATTTATGTGTGTTTTAACUAAAACACACAUAAAUAAGAGCUUAUUUAUGUGUGUUUUAACU13.3-7.521


Target Position: 5195, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5195CUCUUAGAAUUAAGUUAAU85.57591755

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5193-5215GGCTCTTAGAATTAAGTTAATTTAUUAACUUAAUUCUAAGAGCCCUCUUAGAAUUAAGUUAAUUUU4.920.222


Target Position: 4535, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4535GAAAAUGAAGCCAAAGAGA87.55241291

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4533-4555CTGAAAATGAAGCCAAAGAGAAAUCUCUUUGGCUUCAUUUUCAGGAAAAUGAAGCCAAAGAGAAAU16.67.421


Target Position: 1984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1984AGACAUAAACAAAAACAAA94.5819338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7442002AGACATAAACAAAAACAAATTTGTTTTTGTTTATGTCT0.874700.697200.724100.750001.000001.00000


Target Position: 2413, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2413GAGAAGAAAAGGAAUAAUA97.4497152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5122431GAGAAGAAAAGGAATAATATATTATTCCTTTTCTTCTC0.766900.236500.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2411-2433CTGAGAAGAAAAGGAATAATAATUAUUAUUCCUUUUCUUCUCAGGAGAAGAAAAGGAAUAAUAAUU1.819.122


Target Position: 8883, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8883CAGUAUAUACAUUUUGUAA102.532

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8881-8903CTCAGTATATACATTTTGTAAGCUUACAAAAUGUAUAUACUGAGCAGUAUAUACAUUUUGUAAGCU7.26.122


Target Position: 3700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3700CCUCAACCAUUCCCCUCAA86.52041529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9503718CCTCAACCATTCCCCTCAATTGAGGGGAATGGTTGAGG0.281300.264300.698301.000001.000001.00000


Target Position: 1266, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1266CUGCUUUAGACAAAAAUGA79.08353533

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1264-1286GACTGCTTTAGACAAAAATGAAGUCAUUUUUGUCUAAAGCAGUCCUGCUUUAGACAAAAAUGAAGU-3.319.732


Target Position: 8214, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8214GAUUUUUCUUGCUUUUCAA96.6689194

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8212-8234AAGATTTTTCTTGCTTTTCAAAGUUGAAAAGCAAGAAAAAUCUUGAUUUUUCUUGCUUUUCAAAGU12.20.422


Target Position: 8167, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8167CAGAAAAAAAUUAAAGUCA87.31081344

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8165-8187TGCAGAAAAAAATTAAAGTCACCUGACUUUAAUUUUUUUCUGCACAGAAAAAAAUUAAAGUCACCU14.65.522


Target Position: 4915, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4915GAACUUUGAGAAUAAGGAA97.8473133

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4913-4935AAGAACTTTGAGAATAAGGAAGCUUCCUUAUUCUCAAAGUUCUUGAACUUUGAGAAUAAGGAAGCU19.910.322


Target Position: 6607, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6607GGAUAUUUGUGUAUUAGCA99.476679

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6605-6627CAGGATATTTGTGTATTAGCAGTUGCUAAUACACAAAUAUCCUGGGAUAUUUGUGUAUUAGCAGUU14.91.833


Target Position: 9558, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9558GUUUUUUGGAUUUUUUUGU66.53077158

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9556-9578TCGTTTTTTGGATTTTTTTGTCTACAAAAAAAUCCAAAAAACGAGUUUUUUGGAUUUUUUUGUCUU-2.9-2.911


Target Position: 6683, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6683GUUUCCAUGAUUUUAUUUU75.70044517

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6681-6703AAGTTTCCATGATTTTATTTTCTAAAAUAAAAUCAUGGAAACUUGUUUCCAUGAUUUUAUUUUCUU-9.720.122


Target Position: 5529, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5529CUGAACUAUGAAUUAGACA84.30712061

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5527-5549TCCTGAACTATGAATTAGACATCUGUCUAAUUCAUAGUUCAGGACUGAACUAUGAAUUAGACAUCU14.520.332


Target Position: 388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
388GGCAGAAGACAAAAUUAAA100.58560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
151406GGCAGAAGACAAAATTAAATTTAATTTTGTCTTCTGCC0.963700.335501.000001.000001.000001.00000


Target Position: 1461, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1461GGAUUUUGCACUAUUACUA96.8328185

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1459-1481GTGGATTTTGCACTATTACTATCUAGUAAUAGUGCAAAAUCCACGGAUUUUGCACUAUUACUAUCU6.37.422


Target Position: 1982, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1982GUAGACAUAAACAAAAACA87.17151385

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1980-2002GTGTAGACATAAACAAAAACAAAUGUUUUUGUUUAUGUCUACACGUAGACAUAAACAAAAACAAAU5.620.321


Target Position: 2020, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2020GAAAGCAUUAUAUUUCUGU79.70123337

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2018-2040CAGAAAGCATTATATTTCTGTGGACAGAAAUAUAAUGCUUUCUGGAAAGCAUUAUAUUUCUGUGGU12.018.522


Target Position: 2414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2414AGAAGAAAAGGAAUAAUAA97.2965159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9502432AGAAGAAAAGGAATAATAATTATTATTCCTTTTCTTCT0.902600.697500.689700.750001.000001.00000


Target Position: 9752, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9752CUCAACUAUUUUAUAAGUA88.20241174

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9750-9772TTCTCAACTATTTTATAAGTAACUACUUAUAAAAUAGUUGAGAACUCAACUAUUUUAUAAGUAACU6.320.322


Target Position: 5551, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5551GUUAGCAAUAAUAAGCAUU78.30583759

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5549-5571CAGTTAGCAATAATAAGCATTTTAAUGCUUAUUAUUGCUAACUGGUUAGCAAUAAUAAGCAUUUUU19.719.722


Target Position: 8066, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8066CAUUACCUAAUAAUUACCU75.05784707

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8064-8086TGCATTACCTAATAATTACCTCAAGGUAAUUAUUAGGUAAUGCACAUUACCUAAUAAUUACCUCAU13.918.532


Target Position: 9093, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9093GUUUCACAGACAUCAUAGA89.09841013

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9091-9113AAGTTTCACAGACATCATAGATCUCUAUGAUGUCUGUGAAACUUGUUUCACAGACAUCAUAGAUCU13.320.532


Target Position: 1862, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1862CUAAUGUGCUGGUAUGAUA96.7994188

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1860-1882GCCTAATGTGCTGGTATGATAGAUAUCAUACCAGCACAUUAGGCCUAAUGUGCUGGUAUGAUAGAU16.013.522


Target Position: 2751, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2751CCAAUCUUGAUGCUUUAAU74.15344975

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2749-2771ACCCAATCTTGATGCTTTAATACAUUAAAGCAUCAAGAUUGGGUCCAAUCUUGAUGCUUUAAUACU13.712.032


Target Position: 6792, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6792CCUCAAUGUGUAUAAUUAU91.5614652

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6790-6812ATCCTCAATGTGTATAATTATTGAUAAUUAUACACAUUGAGGAUCCUCAAUGUGUAUAAUUAUUGU-8.018.122


Target Position: 3758, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3758GAUGAAUUCUGCAACAUUU94.025389

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3756-3778ATGATGAATTCTGCAACATTTGGAAAUGUUGCAGAAUUCAUCAUGAUGAAUUCUGCAACAUUUGGU12.17.222


Target Position: 2201, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2201GGAAAAUCUGUCUUUGUUA97.4166153

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2199-2221TTGGAAAATCTGTCTTTGTTAATUAACAAAGACAGAUUUUCCAAGGAAAAUCUGUCUUUGUUAAUU10.310.412


Target Position: 5117, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5117CCAAUCUCUUCUUCAAGAA88.64761104

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5115-5137CACCAATCTCTTCTTCAAGAAGAUUCUUGAAGAAGAGAUUGGUGCCAAUCUCUUCUUCAAGAAGAU20.420.422


Target Position: 5642, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5642GAUUUUAUUUCUCUUUUUA96.1663222

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5640-5662TGGATTTTATTTCTCTTTTTAATUAAAAAGAGAAAUAAAAUCCAGAUUUUAUUUCUCUUUUUAAUU5.5-10.312


Target Position: 1402, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1402CGUAGUAUCUGAUGACUUU94.8466317

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1400-1422GACGTAGTATCTGATGACTTTCTAAAGUCAUCAGAUACUACGUCCGUAGUAUCUGAUGACUUUCUU19.214.223


Target Position: 8617, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8617GAUCUUCACUCAAGUUAGU83.89872151

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8615-8637CAGATCTTCACTCAAGTTAGTTCACUAACUUGAGUGAAGAUCUGGAUCUUCACUCAAGUUAGUUCU9.820.432


Target Position: 3442, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3442CAUCAUAGGAAUAAAAGGA86.39871558

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3440-3462ACCATCATAGGAATAAAAGGAGCUCCUUUUAUUCCUAUGAUGGUCAUCAUAGGAAUAAAAGGAGCU11.013.323


Target Position: 5901, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5901CUCAAGAACCAGCAUUAGU74.99544727

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5899-5921TACTCAAGAACCAGCATTAGTAAACUAAUGCUGGUUCUUGAGUACUCAAGAACCAGCAUUAGUAAU19.720.433


Target Position: 9775, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9775GAAUUUUUCAUUAGAUCUU83.38272272

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9773-9795TGGAATTTTTCATTAGATCTTATAAGAUCUAAUGAAAAAUUCCAGAAUUUUUCAUUAGAUCUUAUU20.2-12.021


Target Position: 7575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7575GGCAUUCUCUAUUCUUUUC74.4674892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7067593GGCATTCTCTATTCTTTTCGAAAAGAATAGAGAATGCC0.545100.121200.827600.750001.000001.00000


Target Position: 8688, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8688CAAUUUCUCAGCCUUAUGA86.67811486

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8686-8708TACAATTTCTCAGCCTTATGAGCUCAUAAGGCUGAGAAAUUGUACAAUUUCUCAGCCUUAUGAGCU17.45.323


Target Position: 2265, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2265GAGAAACUAAGUUUUACUU86.25171594

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2263-2285TGGAGAAACTAAGTTTTACTTGGAAGUAAAACUUAGUUUCUCCAGAGAAACUAAGUUUUACUUGGU4.917.723


Target Position: 4861, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4861GCACAAUCAGUUUAUACCU83.84512160

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4859-4881GTGCACAATCAGTTTATACCTCTAGGUAUAAACUGAUUGUGCACGCACAAUCAGUUUAUACCUCUU15.320.522


Target Position: 951, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951CUCAUCUACCUCAUUUACA82.88432413

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
949-971CCCTCATCTACCTCATTTACATAUGUAAAUGAGGUAGAUGAGGGCUCAUCUACCUCAUUUACAUAU6.921.422


Target Position: 6176, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6176GUGACAUACAUUAUUUACU81.93082689

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6174-6196TTGTGACATACATTATTTACTGCAGUAAAUAAUGUAUGUCACAAGUGACAUACAUUAUUUACUGCU1.421.522


Target Position: 5639, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5639GUGGAUUUUAUUUCUCUUU76.37854322

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5637-5659ATGTGGATTTTATTTCTCTTTTTAAAGAGAAAUAAAAUCCACAUGUGGAUUUUAUUUCUCUUUUUU19.120.121


Target Position: 275, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
275GUGUUGUUUCGCAUUAUUA92.6943532

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
273-295AGGTGTTGTTTCGCATTATTAAAUAAUAAUGCGAAACAACACCUGUGUUGUUUCGCAUUAUUAAAU-1.819.333


Target Position: 2264, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2264GGAGAAACUAAGUUUUACU89.8678895

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2262-2284ATGGAGAAACTAAGTTTTACTTGAGUAAAACUUAGUUUCUCCAUGGAGAAACUAAGUUUUACUUGU8.221.523


Target Position: 2919, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2919CAAAUGUGGGUUUAAAUCU78.77883620

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2917-2939AGCAAATGTGGGTTTAAATCTCAAGAUUUAAACCCACAUUUGCUCAAAUGUGGGUUUAAAUCUCAU2.112.122


Target Position: 6294, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6294GCUGUAACUGUUGAAAUUA90.199841

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6292-6314AAGCTGTAACTGTTGAAATTATTUAAUUUCAACAGUUACAGCUUGCUGUAACUGUUGAAAUUAUUU7.419.022


Target Position: 5389, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5389GUUUGUUGUAUGUCAAUUA94.2449372

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5387-5409CAGTTTGTTGTATGTCAATTATAUAAUUGACAUACAACAAACUGGUUUGUUGUAUGUCAAUUAUAU14.812.211


Target Position: 239, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
239GAUAAAAUCUUUACUGAUA100.7755

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
237-259ATGATAAAATCTTTACTGATATTUAUCAGUAAAGAUUUUAUCAUGAUAAAAUCUUUACUGAUAUUU20.3-10.322


Target Position: 850, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
850GUUUUCAGUAUUAAAAGAA87.25211359

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
848-870GAGTTTTCAGTATTAAAAGAAAAUUCUUUUAAUACUGAAAACUCGUUUUCAGUAUUAAAAGAAAAU7.112.222


Target Position: 8099, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8099GAAUGUAUUAAUUGAUUUA100.47661

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8097-8119TTGAATGTATTAATTGATTTAAAUAAAUCAAUUAAUACAUUCAAGAAUGUAUUAAUUGAUUUAAAU7.46.722


Target Position: 8574, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8574GUUGUCUAAUUUUUACUUU79.38133448

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8572-8594TGGTTGTCTAATTTTTACTTTTAAAAGUAAAAAUUAGACAACCAGUUGUCUAAUUUUUACUUUUAU4.920.322


Target Position: 6172, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6172GUUUGUGACAUACAUUAUU82.40462541

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6170-6192CAGTTTGTGACATACATTATTTAAAUAAUGUAUGUCACAAACUGGUUUGUGACAUACAUUAUUUAU6.720.522


Target Position: 6112, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6112GAAAUUCUAAUUGUUGUUU75.32864621

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6110-6132AAGAAATTCTAATTGTTGTTTAAAAACAACAAUUAGAAUUUCUUGAAAUUCUAAUUGUUGUUUAAU19.35.322


Target Position: 169, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
169GGAUAUGAAUGGAAUUAUA107.2644

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
167-189CTGGATATGAATGGAATTATACAUAUAAUUCCAUUCAUAUCCAGGGAUAUGAAUGGAAUUAUACAU1.817.412


Target Position: 1219, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1219CAAGGAAAAGAAAAAGUUA96.0935227

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1217-1239TACAAGGAAAAGAAAAAGTTAAAUAACUUUUUCUUUUCCUUGUACAAGGAAAAGAAAAAGUUAAAU3.218.721


Target Position: 6832, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6832GUUUUUAAAGGAAACAUCU78.39583726

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6830-6852TTGTTTTTAAAGGAAACATCTATAGAUGUUUCCUUUAAAAACAAGUUUUUAAAGGAAACAUCUAUU14.8-9.122


Target Position: 897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
897GGAUAAUAGAUGAUUGGAU94.4287353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
963915GGATAATAGATGATTGGATATCCAATCATCTATTATCC0.337900.214900.689701.000001.000001.00000


Target Position: 8825, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8825CAGAAGUUCAUUUGUCAUU80.2163174

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8823-8845TGCAGAAGTTCATTTGTCATTTTAAUGACAAAUGAACUUCUGCACAGAAGUUCAUUUGUCAUUUUU20.517.721


Target Position: 5848, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5848CUUAGAACUAUAAAUAGCA87.29451349

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5846-5868TGCTTAGAACTATAAATAGCATTUGCUAUUUAUAGUUCUAAGCACUUAGAACUAUAAAUAGCAUUU13.614.632


Target Position: 3267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3267GCAAGCAAAGAAAGAAUAA90.0864863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2483285GCAAGCAAAGAAAGAATAATTATTCTTTCTTTGCTTGC0.916200.400900.819001.000001.000001.00000


Target Position: 4909, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4909CAAAAAGAACUUUGAGAAU84.98971902

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4907-4929AACAAAAAGAACTTTGAGAATAAAUUCUCAAAGUUCUUUUUGUUCAAAAAGAACUUUGAGAAUAAU20.45.521


Target Position: 3114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3114GGCCUGGAGAAAAUGAGAA88.10911190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3563132GGCCTGGAGAAAATGAGAATTCTCATTTTCTCCAGGCC0.517300.191300.827601.000001.000001.00000


Target Position: 6793, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6793CUCAAUGUGUAUAAUUAUU83.67692205

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6791-6813TCCTCAATGTGTATAATTATTGCAAUAAUUAUACACAUUGAGGACUCAAUGUGUAUAAUUAUUGCU-8.020.523


Target Position: 3840, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3840CAGUUCUACCUCAAGAAAU85.15381859

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3838-3860TGCAGTTCTACCTCAAGAAATAAAUUUCUUGAGGUAGAACUGCACAGUUCUACCUCAAGAAAUAAU12.218.922


Target Position: 7749, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7749CUUCAAGAAAUUUAAAAUU77.78523910

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7747-7769GACTTCAAGAAATTTAAAATTCTAAUUUUAAAUUUCUUGAAGUCCUUCAAGAAAUUUAAAAUUCUU-9.720.421


Target Position: 8735, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8735CUUCCAAAUUUUGUUUUUA84.53622000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8733-8755TGCTTCCAAATTTTGTTTTTACTUAAAAACAAAAUUUGGAAGCACUUCCAAAUUUUGUUUUUACUU5.620.112


Target Position: 4798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4798GCCCUUCCAUCAUACUUUA91.1341706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2514816GCCCTTCCATCATACTTTATAAAGTATGATGGAAGGGC0.594000.237400.965501.000001.000001.00000


Target Position: 1346, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1346GAAACUGAGUUUAGACAAU90.8179759

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1344-1366TTGAAACTGAGTTTAGACAATATAUUGUCUAAACUCAGUUUCAAGAAACUGAGUUUAGACAAUAUU20.319.223


Target Position: 147, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
147CUGAAUUUGACAACUUGUA83.13342346

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
145-167TCCTGAATTTGACAACTTGTACCUACAAGUUGUCAAAUUCAGGACUGAAUUUGACAACUUGUACCU17.87.432


Target Position: 4905, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4905CAAACAAAAAGAACUUUGA86.18091613

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4903-4925TGCAAACAAAAAGAACTTTGAGAUCAAAGUUCUUUUUGUUUGCACAAACAAAAAGAACUUUGAGAU10.35.622


Target Position: 5423, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5423GUAAUAAAAAACUAAAUUA95.8903239

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5421-5443CTGTAATAAAAAACTAAATTAAAUAAUUUAGUUUUUUAUUACAGGUAAUAAAAAACUAAAUUAAAU-4.3-7.522


Target Position: 8805, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8805CUGUCUUUAAAAAUCAAUU79.23093489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4658823CTGTCTTTAAAAATCAATTAATTGATTTTTAAAGACAG0.463600.206000.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8803-8825CTCTGTCTTTAAAAATCAATTGCAAUUGAUUUUUAAAGACAGAGCUGUCUUUAAAAAUCAAUUGCU7.219.212


Target Position: 1877, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1877GAUAGAGACACAGAGUUUA94.6651332

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1875-1897ATGATAGAGACACAGAGTTTATCUAAACUCUGUGUCUCUAUCAUGAUAGAGACACAGAGUUUAUCU17.720.222


Target Position: 5172, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5172CUAAACCUUCUGAGUAAAU78.23773777

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5170-5192TTCTAAACCTTCTGAGTAAATTTAUUUACUCAGAAGGUUUAGAACUAAACCUUCUGAGUAAAUUUU14.618.622


Target Position: 9371, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9371GUUGGUAUACUAUUAAAUU89.2249994

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9369-9391CAGTTGGTATACTATTAAATTGTAAUUUAAUAGUAUACCAACUGGUUGGUAUACUAUUAAAUUGUU-10.320.032


Target Position: 4220, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4220CCUGUUUCCUCUAACAGAA91.8467617

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4218-4240TCCCTGTTTCCTCTAACAGAAGAUUCUGUUAGAGGAAACAGGGACCUGUUUCCUCUAACAGAAGAU20.319.222


Target Position: 5913, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5913CAUUAGUAAUUUCUAGUAA99.551978

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5911-5933AGCATTAGTAATTTCTAGTAAAAUUACUAGAAAUUACUAAUGCUCAUUAGUAAUUUCUAGUAAAAU20.16.332


Target Position: 447, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
447GAUUUGAUUCCAACUGUAU89.8857891

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
445-467CAGATTTGATTCCAACTGTATCAAUACAGUUGGAAUCAAAUCUGGAUUUGAUUCCAACUGUAUCAU19.07.223


Target Position: 7488, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7488CUUUUUUUUUAACAUUAUU78.01583836

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7486-7508TACTTTTTTTTTAACATTATTATAAUAAUGUUAAAAAAAAAGUACUUUUUUUUUAACAUUAUUAUU6.7-11.310


Target Position: 955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
955UCUACCUCAUUUACAUAUU71.86545671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
672973TCTACCTCATTTACATATTAATATGTAAATGAGGTAGA0.693600.381300.715500.750001.000001.00000


Target Position: 5400, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5400GUCAAUUAUACCUCAAUAA91.9245605

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5398-5420ATGTCAATTATACCTCAATAAATUUAUUGAGGUAUAAUUGACAUGUCAAUUAUACCUCAAUAAAUU13.48.900


Target Position: 8131, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8131CUAAAGUCUUAAACAUCUA92.9439503

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8129-8151GACTAAAGTCTTAAACATCTAAGUAGAUGUUUAAGACUUUAGUCCUAAAGUCUUAAACAUCUAAGU19.214.623


Target Position: 2857, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2857GUUUACAGGAAGUAUUUUU80.25263166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2855-2877AGGTTTACAGGAAGTATTTTTATAAAAAUACUUCCUGUAAACCUGUUUACAGGAAGUAUUUUUAUU-0.311.822


Target Position: 4141, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4141GCUUAAAGAAAUUCUAAAA95.1239300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4294159GCTTAAAGAAATTCTAAAATTTTAGAATTTCTTTAAGC0.462700.396900.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4139-4161ATGCTTAAAGAAATTCTAAAAATUUUUAGAAUUUCUUUAAGCAUGCUUAAAGAAAUUCUAAAAAUU7.11.322


Target Position: 8827, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8827GAAGUUCAUUUGUCAUUUU89.6301929

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8825-8847CAGAAGTTCATTTGTCATTTTTCAAAAUGACAAAUGAACUUCUGGAAGUUCAUUUGUCAUUUUUCU14.819.221


Target Position: 1352, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1352GAGUUUAGACAAUAUAAAA104.53511

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1350-1372CTGAGTTTAGACAATATAAAAGAUUUUAUAUUGUCUAAACUCAGGAGUUUAGACAAUAUAAAAGAU-8.09.822


Target Position: 1586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1586CCUUUUAAGCCAUUUGAAC68.51466629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8961604CCTTTTAAGCCATTTGAACGTTCAAATGGCTTAAAAGG0.292600.104300.698300.750001.000001.00000


Target Position: 2066, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2066CACAAAUUUUUUUUGAAGA84.07082105

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2064-2086GACACAAATTTTTTTTGAAGAAAUCUUCAAAAAAAAUUUGUGUCCACAAAUUUUUUUUGAAGAAAU12.25.312


Target Position: 2202, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2202GAAAAUCUGUCUUUGUUAA96.9921176

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2200-2222TGGAAAATCTGTCTTTGTTAATTUUAACAAAGACAGAUUUUCCAGAAAAUCUGUCUUUGUUAAUUU7.25.322


Target Position: 5363, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5363CAAAUUGUGCACUUUAAGU80.10263212

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5361-5383ATCAAATTGTGCACTTTAAGTATACUUAAAGUGCACAAUUUGAUCAAAUUGUGCACUUUAAGUAUU1.35.312


Target Position: 3272, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3272CAAAGAAAGAAUAAUAAGA91.9042609

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3270-3292AGCAAAGAAAGAATAATAAGAAGUCUUAUUAUUCUUUCUUUGCUCAAAGAAAGAAUAAUAAGAAGU-2.35.512


Target Position: 8944, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8944CUAGUCAAGAUAAAGCUUA84.78071951

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8942-8964TCCTAGTCAAGATAAAGCTTAAAUAAGCUUUAUCUUGACUAGGACUAGUCAAGAUAAAGCUUAAAU17.020.322


Target Position: 7675, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7675CAUUUCUGCCCCAUGUUGA82.07562639

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7673-7695GCCATTTCTGCCCCATGTTGAGGUCAACAUGGGGCAGAAAUGGCCAUUUCUGCCCCAUGUUGAGGU18.112.023


Target Position: 6008, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6008GUUAAUUAAUAAACUGUAU86.83161453

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6006-6028ATGTTAATTAATAAACTGTATTAAUACAGUUUAUUAAUUAACAUGUUAAUUAAUAAACUGUAUUAU19.0-7.521


Target Position: 1078, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1078GAAAUACCUUGUGAAACUA95.0951303

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1076-1098GAGAAATACCTTGTGAAACTATCUAGUUUCACAAGGUAUUUCUCGAAAUACCUUGUGAAACUAUCU19.213.923


Target Position: 2544, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2544CUUUUGUUUAUCAAACUAU82.10682624

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2542-2564TCCTTTTGTTTATCAAACTATTGAUAGUUUGAUAAACAAAAGGACUUUUGUUUAUCAAACUAUUGU11.85.622


Target Position: 5334, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5334CUUUUCAUGCUGUUUAAAA86.02091653

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5332-5354CACTTTTCATGCTGTTTAAAAGAUUUUAAACAGCAUGAAAAGUGCUUUUCAUGCUGUUUAAAAGAU0.07.422


Target Position: 7695, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7695GAAACAAUCUGUUGAUAGA98.7237105

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7693-7715AGGAAACAATCTGTTGATAGACCUCUAUCAACAGAUUGUUUCCUGAAACAAUCUGUUGAUAGACCU13.45.333


Target Position: 5804, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5804GUACCAAAGCAACUUUAGA88.08661192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5802-5824TTGTACCAAAGCAACTTTAGAATUCUAAAGUUGCUUUGGUACAAGUACCAAAGCAACUUUAGAAUU9.820.032


Target Position: 5402, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5402CAAUUAUACCUCAAUAAAU95.2163288

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5400-5422GTCAATTATACCTCAATAAATCTAUUUAUUGAGGUAUAAUUGACCAAUUAUACCUCAAUAAAUCUU-1.4-8.001


Target Position: 2967, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2967CUGGAUAUACUAAGAAAGU78.38423731

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2965-2987ACCTGGATATACTAAGAAAGTTGACUUUCUUAGUAUAUCCAGGUCUGGAUAUACUAAGAAAGUUGU10.321.222


Target Position: 4181, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4181GACCAUAAGAAUGAAAUCA87.52631303

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4179-4201TGGACCATAAGAATGAAATCAAAUGAUUUCAUUCUUAUGGUCCAGACCAUAAGAAUGAAAUCAAAU16.320.022


Target Position: 1287, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1287GCGAAAUGAUAACUUCUAA98.0849127

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1285-1307AGGCGAAATGATAACTTCTAAGGUUAGAAGUUAUCAUUUCGCCUGCGAAAUGAUAACUUCUAAGGU18.914.133


Target Position: 2715, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2715GUAGGAUUCGUGUGAUUUU85.65621731

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10271519GTAGGATTCGTGTGATTTT1/1/0/097.75XRN1NM_019001.3+NM_001042604.11+1NANANA3:142098973..142098991(-)00XRN1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2713-2735AGGTAGGATTCGTGTGATTTTCAAAAAUCACACGAAUCCUACCUGUAGGAUUCGUGUGAUUUUCAU14.819.933


Target Position: 5575, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5575CACUAUCAUUGAGGAAUAA94.9587312

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5573-5595TACACTATCATTGAGGAATAATTUUAUUCCUCAAUGAUAGUGUACACUAUCAUUGAGGAAUAAUUU19.920.322


Target Position: 3140, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3140GAAAAAGUUCAAGAAAUUA93.3333462

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3138-3160CTGAAAAAGTTCAAGAAATTATTUAAUUUCUUGAACUUUUUCAGGAAAAAGUUCAAGAAAUUAUUU5.33.222


Target Position: 5855, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5855CUAUAAAUAGCAUUCUAAA98.7449103

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5853-5875AACTATAAATAGCATTCTAAATTUUUAGAAUGCUAUUUAUAGUUCUAUAAAUAGCAUUCUAAAUUU6.9-8.022


Target Position: 732, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
732CUCUCUUAAGAGAAGAAGU78.50033697

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
730-752TTCTCTCTTAAGAGAAGAAGTTCACUUCUUCUCUUAAGAGAGAACUCUCUUAAGAGAAGAAGUUCU19.120.222


Target Position: 6520, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6520GUAGUCUUACUUGUUUUUU72.43925487

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6518-6540AAGTAGTCTTACTTGTTTTTTAAAAAAAACAAGUAAGACUACUUGUAGUCUUACUUGUUUUUUAAU5.618.922


Target Position: 9689, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9689CAUUUUGUUCAUUUAAACA90.8385755

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9687-9709AACATTTTGTTCATTTAAACAAAUGUUUAAAUGAACAAAAUGUUCAUUUUGUUCAUUUAAACAAAU0.05.322


Target Position: 2296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2296AGGAACACAGAAGCUUUAU71.60735761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6512314AGGAACACAGAAGCTTTATATAAAGCTTCTGTGTTCCT0.497300.348100.801700.750001.000001.00000


Target Position: 3228, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3228CAGCUAUUGUUGAGAAAAU90.2117838

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3226-3248TGCAGCTATTGTTGAGAAAATTGAUUUUCUCAACAAUAGCUGCACAGCUAUUGUUGAGAAAAUUGU14.818.322


Target Position: 5194, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5194GCUCUUAGAAUUAAGUUAA93.2788466

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5192-5214TGGCTCTTAGAATTAAGTTAATTUUAACUUAAUUCUAAGAGCCAGCUCUUAGAAUUAAGUUAAUUU6.616.332


Target Position: 9629, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9629GAGUAUUUUCAUCUAGUUU89.4756962

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9627-9649TTGAGTATTTTCATCTAGTTTAAAAACUAGAUGAAAAUACUCAAGAGUAUUUUCAUCUAGUUUAAU18.94.622


Target Position: 7802, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7802CAAAGUUUAAAAAUAUGCU77.73783922

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7800-7822CCCAAAGTTTAAAAATATGCTCAAGCAUAUUUUUAAACUUUGGGCAAAGUUUAAAAAUAUGCUCAU15.23.222


Target Position: 5701, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5701GUGUGUUUUAACUUAUGCU82.41222536

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5699-5721ATGTGTGTTTTAACTTATGCTTTAGCAUAAGUUAAAACACACAUGUGUGUUUUAACUUAUGCUUUU19.719.321


Target Position: 4901, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4901GUUGCAAACAAAAAGAACU77.46734001

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4899-4921GGGTTGCAAACAAAAAGAACTTTAGUUCUUUUUGUUUGCAACCCGUUGCAAACAAAAAGAACUUUU13.320.022


Target Position: 8952, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8952GAUAAAGCUUAAAAUUCCA90.655783

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8950-8972AAGATAAAGCTTAAAATTCCAGAUGGAAUUUUAAGCUUUAUCUUGAUAAAGCUUAAAAUUCCAGAU14.213.622


Target Position: 8088, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8088CGUUAGAAUUUGAAUGUAU94.327366

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8086-8108AGCGTTAGAATTTGAATGTATTAAUACAUUCAAAUUCUAACGCUCGUUAGAAUUUGAAUGUAUUAU16.114.622


Target Position: 8360, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8360CCAAACUAAGCUAGAUUCU73.67415127

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8358-8380TTCCAAACTAAGCTAGATTCTTGAGAAUCUAGCUUAGUUUGGAACCAAACUAAGCUAGAUUCUUGU16.011.832


Target Position: 9549, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9549GUUGUUUUCGUUUUUUGGA72.26875546

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9547-9569AGGTTGTTTTCGTTTTTTGGATTUCCAAAAAACGAAAACAACCUGUUGUUUUCGUUUUUUGGAUUU11.55.622


Target Position: 1127, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1127GUUUUUGUGGACCUAAAAU79.79223300

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1125-1147AAGTTTTTGTGGACCTAAAATGGAUUUUAGGUCCACAAAAACUUGUUUUUGUGGACCUAAAAUGGU11.05.613


Target Position: 8033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8033CCUUCCAGUCUCGUUCCUU74.60984847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8028051CCTTCCAGTCTCGTTCCTTAAGGAACGAGACTGGAAGG0.499200.283700.706901.000001.000001.00000


Target Position: 1354, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1354GUUUAGACAAUAUAAAAGA87.54181295

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1352-1374GAGTTTAGACAATATAAAAGAACUCUUUUAUAUUGUCUAAACUCGUUUAGACAAUAUAAAAGAACU-4.314.621


Target Position: 8512, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8512GUCUUUUUUACUCACUUUU74.31114925

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8510-8532AGGTCTTTTTTACTCACTTTTTAAAAAGUGAGUAAAAAAGACCUGUCUUUUUUACUCACUUUUUAU19.25.532


Target Position: 5270, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5270GAAUGUACUAUUUUAAAAU93.2343473

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5268-5290TAGAATGTACTATTTTAAAATAAAUUUUAAAAUAGUACAUUCUAGAAUGUACUAUUUUAAAAUAAU-9.114.621


Target Position: 9942, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9942GUUACGUUAUCCGUAGAUU80.60583060

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9940-9962GTGTTACGTTATCCGTAGATTTCAAUCUACGGAUAACGUAACACGUUACGUUAUCCGUAGAUUUCU20.915.033


Target Position: 3931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3931CCCUCACAGAAAAUUUAAA89.15981002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5943949CCCTCACAGAAAATTTAAATTTAAATTTTCTGTGAGGG0.682500.114800.991401.000001.000001.00000


Target Position: 8819, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8819CAAUUGCAGAAGUUCAUUU85.02851892

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8817-8839ATCAATTGCAGAAGTTCATTTGTAAAUGAACUUCUGCAAUUGAUCAAUUGCAGAAGUUCAUUUGUU14.820.022


Target Position: 694, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
694GAUUAUGCUUGGAUUAACA98.1901123

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
692-714TTGATTATGCTTGGATTAACAAGUGUUAAUCCAAGCAUAAUCAAGAUUAUGCUUGGAUUAACAAGU10.015.222


Target Position: 9241, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9241CAUCUCAAGUGCAAUUUGU80.75013021

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9239-9261GCCATCTCAAGTGCAATTTGTGAACAAAUUGCACUUGAGAUGGCCAUCUCAAGUGCAAUUUGUGAU4.220.432


Target Position: 1951, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1951GUAUAAAAUAAUAUCCUUA99.671673

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1949-1971AGGTATAAAATAATATCCTTAGAUAAGGAUAUUAUUUUAUACCUGUAUAAAAUAAUAUCCUUAGAU19.9-7.521


Target Position: 2010, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2010GAAUUGACCAGAAAGCAUU85.73481712

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2008-2030CAGAATTGACCAGAAAGCATTATAAUGCUUUCUGGUCAAUUCUGGAAUUGACCAGAAAGCAUUAUU18.514.833


Target Position: 7941, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7941CUUUGUCUCCUAACUGAAA89.3603978

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7939-7961GCCTTTGTCTCCTAACTGAAACAUUUCAGUUAGGAGACAAAGGCCUUUGUCUCCUAACUGAAACAU19.219.233


Target Position: 7798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7798CCCCCAAAGUUUAAAAAUA89.15821003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8947816CCCCCAAAGTTTAAAAATATATTTTTAAACTTTGGGGG0.493800.070900.948301.000001.000001.00000


Target Position: 7161, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7161CAGUGAAAGAGUUUUAUUU89.14941004

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7159-7181GGCAGTGAAAGAGTTTTATTTTCAAAUAAAACUCUUUCACUGCCCAGUGAAAGAGUUUUAUUUUCU-9.719.222


Target Position: 9022, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9022CAAUACAGUAAGAGAUAGU84.3562049

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9020-9042TCCAATACAGTAAGAGATAGTGTACUAUCUCUUACUGUAUUGGACAAUACAGUAAGAGAUAGUGUU20.211.622


Target Position: 6410, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6410GUAAGUUAUAGCAUACUUU88.59821109

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6408-6430AAGTAAGTTATAGCATACTTTTTAAAGUAUGCUAUAACUUACUUGUAAGUUAUAGCAUACUUUUUU11.66.632


Target Position: 3863, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3863CAAGUAAAUCAACAUCAUA100.70357

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3861-3883GCCAAGTAAATCAACATCATAAAUAUGAUGUUGAUUUACUUGGCCAAGUAAAUCAACAUCAUAAAU20.54.922


Target Position: 6197, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6197CUAUUUCAUUCUGAUUCUA89.7837909

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6195-6217GCCTATTTCATTCTGATTCTATAUAGAAUCAGAAUGAAAUAGGCCUAUUUCAUUCUGAUUCUAUAU20.48.922


Target Position: 7746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7746GGACUUCAAGAAAUUUAAA96.133224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2777764GGACTTCAAGAAATTTAAATTTAAATTTCTTGAAGTCC0.762900.222300.870701.000001.000001.00000


Target Position: 1023, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1023CAGAACUUGGGGGUUAUAU75.25594651

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1021-1043GCCAGAACTTGGGGGTTATATTAAUAUAACCCCCAAGUUCUGGCCAGAACUUGGGGGUUAUAUUAU15.317.732


Target Position: 9681, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9681GUGUUCAACAUUUUGUUCA80.58553067

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9679-9701AAGTGTTCAACATTTTGTTCATTUGAACAAAAUGUUGAACACUUGUGUUCAACAUUUUGUUCAUUU14.920.512


Target Position: 6841, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6841GGAAACAUCUAUUAUGGUA98.7245104

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6839-6861AAGGAAACATCTATTATGGTAATUACCAUAAUAGAUGUUUCCUUGGAAACAUCUAUUAUGGUAAUU20.014.832


Target Position: 995, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
995CUUUAUGGAACAUAUGUUA89.8941890

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
993-1015TTCTTTATGGAACATATGTTACCUAACAUAUGUUCCAUAAAGAACUUUAUGGAACAUAUGUUACCU6.712.822


Target Position: 8959, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8959CUUAAAAUUCCAGAAAUUA86.48911538

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8957-8979AGCTTAAAATTCCAGAAATTAATUAAUUUCUGGAAUUUUAAGCUCUUAAAAUUCCAGAAAUUAAUU5.3-9.721


Target Position: 6510, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6510GACUCUUAAAGUAGUCUUA96.0098229

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6508-6530ATGACTCTTAAAGTAGTCTTACTUAAGACUACUUUAAGAGUCAUGACUCUUAAAGUAGUCUUACUU18.918.923


Target Position: 7745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7745UGGACUUCAAGAAAUUUAA81.83312715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3417763TGGACTTCAAGAAATTTAATTAAATTTCTTGAAGTCCA0.686200.210900.810300.750001.000001.00000


Target Position: 8136, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8136GUCUUAAACAUCUAAGACU83.58662230

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8134-8156AAGTCTTAAACATCTAAGACTCAAGUCUUAGAUGUUUAAGACUUGUCUUAAACAUCUAAGACUCAU18.97.133


Target Position: 497, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
497CAUGAACAUCUGAAGUAUU91.3466678

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
495-517TACATGAACATCTGAAGTATTTTAAUACUUCAGAUGUUCAUGUACAUGAACAUCUGAAGUAUUUUU14.520.522


Target Position: 3600, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3600CUGAAACUGGAAAUCAGAA89.14051007

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3598-3620CTCTGAAACTGGAAATCAGAAGTUUCUGAUUUCCAGUUUCAGAGCUGAAACUGGAAAUCAGAAGUU20.419.222


Target Position: 4619, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4619GUAUUUGCAAAUUAUCCUU79.78763302

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4617-4639AAGTATTTGCAAATTATCCTTCAAAGGAUAAUUUGCAAAUACUUGUAUUUGCAAAUUAUCCUUCAU19.915.322


Target Position: 7940, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7940CCUUUGUCUCCUAACUGAA90.9288735

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7938-7960AGCCTTTGTCTCCTAACTGAAACUUCAGUUAGGAGACAAAGGCUCCUUUGUCUCCUAACUGAAACU20.319.232


Target Position: 9134, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9134CAUGUAUAAAAUAGUUUUA93.7649414

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9132-9154AACATGTATAAAATAGTTTTAGTUAAAACUAUUUUAUACAUGUUCAUGUAUAAAAUAGUUUUAGUU4.98.221


Target Position: 6911, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6911CUUUAAAGUGUGAAAUGUU85.72651714

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6909-6931TACTTTAAAGTGTGAAATGTTTCAACAUUUCACACUUUAAAGUACUUUAAAGUGUGAAAUGUUUCU14.8-3.822


Target Position: 1987, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1987CAUAAACAAAAACAAAAUA90.229833

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1985-2007GACATAAACAAAAACAAAATAACUAUUUUGUUUUUGUUUAUGUCCAUAAACAAAAACAAAAUAACU5.36.911


Target Position: 1302, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1302CUAAGGAUAAUUUAGAAGA84.83611933

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1300-1322TTCTAAGGATAATTTAGAAGATGUCUUCUAAAUUAUCCUUAGAACUAAGGAUAAUUUAGAAGAUGU11.719.922


Target Position: 2780, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2780CAUAAAUAUUCUAUAAAGU88.83131065

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2778-2800AGCATAAATATTCTATAAAGTACACUUUAUAGAAUAUUUAUGCUCAUAAAUAUUCUAUAAAGUACU-2.3-8.022


Target Position: 9128, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9128GAAAAACAUGUAUAAAAUA99.268686

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9126-9148AAGAAAAACATGTATAAAATAGTUAUUUUAUACAUGUUUUUCUUGAAAAACAUGUAUAAAAUAGUU-10.35.622


Target Position: 6846, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6846CAUCUAUUAUGGUAAUACA103.44824

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6844-6866AACATCTATTATGGTAATACAAAUGUAUUACCAUAAUAGAUGUUCAUCUAUUAUGGUAAUACAAAU9.56.623


Target Position: 8147, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8147CUAAGACUCAGUUGUAGUU83.1642341

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8145-8167ATCTAAGACTCAGTTGTAGTTGCAACUACAACUGAGUCUUAGAUCUAAGACUCAGUUGUAGUUGCU19.018.933


Target Position: 5274, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5274GUACUAUUUUAAAAUAAUA100.10265

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5272-5294ATGTACTATTTTAAAATAATATGUAUUAUUUUAAAAUAGUACAUGUACUAUUUUAAAAUAAUAUGU-10.36.311


Target Position: 3984, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3984CCCAAAAAAUGUCCAAUAA89.4921960

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3982-4004GTCCCAAAAAATGTCCAATAAGCUUAUUGGACAUUUUUUGGGACCCCAAAAAAUGUCCAAUAAGCU21.211.523


Target Position: 4976, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4976GAUUCUUCCAACAUUGUCA92.9499502

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4974-4996CAGATTCTTCCAACATTGTCAAAUGACAAUGUUGGAAGAAUCUGGAUUCUUCCAACAUUGUCAAAU20.514.822


Target Position: 9791, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9791CUUAUACAGAGAAGUAUUU80.59513065

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9789-9811ATCTTATACAGAGAAGTATTTTAAAAUACUUCUCUGUAUAAGAUCUUAUACAGAGAAGUAUUUUAU4.68.522


Target Position: 7282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7282GCCCUGUCUCUACUAAAAA89.5009959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2887300GCCCTGTCTCTACTAAAAATTTTTAGTAGAGACAGGGC0.853200.214401.000001.000001.000001.00000


Target Position: 5232, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5232CCUUUUUAUAAAUACAUAU86.8421451

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5230-5252TACCTTTTTATAAATACATATCTAUAUGUAUUUAUAAAAAGGUACCUUUUUAUAAAUACAUAUCUU8.2-3.812


Target Position: 9860, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9860GAUUUUAAAUAUCUUUACA96.5126202

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9858-9880TTGATTTTAAATATCTTTACATTUGUAAAGAUAUUUAAAAUCAAGAUUUUAAAUAUCUUUACAUUU14.6-9.722


Target Position: 4266, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4266CUAAACAAAAUAAGAAAUU72.76455388

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4264-4286GCCTAAACAAAATAAGAAATTAGAAUUUCUUAUUUUGUUUAGGCCUAAACAAAAUAAGAAAUUAGU5.37.222


Target Position: 5246, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5246CAUAUCUAUGUCUCAUAAA95.7349253

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5244-5266TACATATCTATGTCTCATAAAAAUUUAUGAGACAUAGAUAUGUACAUAUCUAUGUCUCAUAAAAAU13.48.233


Target Position: 2355, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2355GAGAUAAAGAACAAUCUAA101.84739

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2353-2375TGGAGATAAAGAACAATCTAACTUUAGAUUGUUCUUUAUCUCCAGAGAUAAAGAACAAUCUAACUU13.46.923


Target Position: 3138, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3138CUGAAAAAGUUCAAGAAAU84.75241956

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3136-3158TGCTGAAAAAGTTCAAGAAATTAAUUUCUUGAACUUUUUCAGCACUGAAAAAGUUCAAGAAAUUAU12.27.721


Target Position: 8549, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8549GUGUUAGUCAUAACUGUUU81.29772853

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8547-8569TTGTGTTAGTCATAACTGTTTATAAACAGUUAUGACUAACACAAGUGUUAGUCAUAACUGUUUAUU17.819.023


Target Position: 8615, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8615CAGAUCUUCACUCAAGUUA85.70181721

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8613-8635TGCAGATCTTCACTCAAGTTAGTUAACUUGAGUGAAGAUCUGCACAGAUCUUCACUCAAGUUAGUU19.219.122


Target Position: 7740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7740GCAGUUGGACUUCAAGAAA90.723774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9487758GCAGTTGGACTTCAAGAAATTTCTTGAAGTCCAACTGC0.282000.069800.853401.000001.000001.00000


Target Position: 722, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
722GCACAUUUUUCUCUCUUAA94.8353319

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
720-742AGGCACATTTTTCTCTCTTAAGAUUAAGAGAGAAAAAUGUGCCUGCACAUUUUUCUCUCUUAAGAU20.212.122


Target Position: 8949, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8949CAAGAUAAAGCUUAAAAUU86.79081461

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8947-8969GTCAAGATAAAGCTTAAAATTCCAAUUUUAAGCUUUAUCUUGACCAAGAUAAAGCUUAAAAUUCCU-9.76.922


Target Position: 9851, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9851GUAAUUUUUGAUUUUAAAU80.84582983

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9849-9871TTGTAATTTTTGATTTTAAATATAUUUAAAAUCAAAAAUUACAAGUAAUUUUUGAUUUUAAAUAUU-9.1-9.722


Target Position: 857, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
857GUAUUAAAAGAAAAGAUCA92.8479515

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
855-877CAGTATTAAAAGAAAAGATCACAUGAUCUUUUCUUUUAAUACUGGUAUUAAAAGAAAAGAUCACAU14.8-7.522


Target Position: 2083, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2083GAAAAGUGGUGUUCAAGUA97.774136

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2081-2103AAGAAAAGTGGTGTTCAAGTATTUACUUGAACACCACUUUUCUUGAAAAGUGGUGUUCAAGUAUUU19.210.333


Target Position: 1501, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1501CUGGUAUUAUCCUUAUCAU90.9192736

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1499-1521AGCTGGTATTATCCTTATCATTAAUGAUAAGGAUAAUACCAGCUCUGGUAUUAUCCUUAUCAUUAU13.420.032


Target Position: 9404, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9404GGUUUCUGUAGCUGUUUUA91.1875700

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9402-9424TAGGTTTCTGTAGCTGTTTTAGTUAAAACAGCUACAGAAACCUAGGUUUCUGUAGCUGUUUUAGUU10.319.222


Target Position: 2040, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2040GAUUUCCUACUCUGAAACA90.0582868

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2038-2060TGGATTTCCTACTCTGAAACACAUGUUUCAGAGUAGGAAAUCCAGAUUUCCUACUCUGAAACACAU19.218.722


Target Position: 4982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4982UCCAACAUUGUCAAAGUAA76.68914228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5835000TCCAACATTGTCAAAGTAATTACTTTGACAATGTTGGA0.395500.299300.836200.750001.000001.00000


Target Position: 7093, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7093GCACUAAACCCAUAAGGAU89.3605977

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7091-7113GTGCACTAAACCCATAAGGATACAUCCUUAUGGGUUUAGUGCACGCACUAAACCCAUAAGGAUACU19.911.832


Target Position: 9622, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9622CUUCUUUGAGUAUUUUCAU80.85272982

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9620-9642TGCTTCTTTGAGTATTTTCATCTAUGAAAAUACUCAAAGAAGCACUUCUUUGAGUAUUUUCAUCUU7.412.222


Target Position: 9631, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9631GUAUUUUCAUCUAGUUUAA94.9732311

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9629-9651GAGTATTTTCATCTAGTTTAATGUUAAACUAGAUGAAAAUACUCGUAUUUUCAUCUAGUUUAAUGU6.62.122


Target Position: 7742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7742AGUUGGACUUCAAGAAAUU84.09632099

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8617760AGTTGGACTTCAAGAAATTAATTTCTTGAAGTCCAACT0.416000.164500.698300.750001.000001.00000


Target Position: 6202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6202UCAUUCUGAUUCUAUAUUU78.94463573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8706220TCATTCTGATTCTATATTTAAATATAGAATCAGAATGA0.300200.200200.724100.750001.000001.00000


Target Position: 3735, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3735CUCAAGUACCUACUAAAGA82.28412572

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3733-3755TACTCAAGTACCTACTAAAGATGUCUUUAGUAGGUACUUGAGUACUCAAGUACCUACUAAAGAUGU9.820.333


Target Position: 2518, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2518GAAACAGUGGUCAAAACAA97.9324131

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2516-2538GAGAAACAGTGGTCAAAACAAGTUUGUUUUGACCACUGUUUCUCGAAACAGUGGUCAAAACAAGUU12.217.821


Target Position: 8577, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8577GUCUAAUUUUUACUUUUAU85.90461676

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8575-8597TTGTCTAATTTTTACTTTTATTAAUAAAAGUAAAAAUUAGACAAGUCUAAUUUUUACUUUUAUUAU4.96.922


Target Position: 4189, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4189GAAUGAAAUCAAACAGAUU94.9839308

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4187-4209AAGAATGAAATCAAACAGATTGCAAUCUGUUUGAUUUCAUUCUUGAAUGAAAUCAAACAGAUUGCU19.27.412


Target Position: 2549, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2549GUUUAUCAAACUAUUGUCA85.82111698

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2547-2569TTGTTTATCAAACTATTGTCAAGUGACAAUAGUUUGAUAAACAAGUUUAUCAAACUAUUGUCAAGU16.18.922


Target Position: 5413, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5413CAAUAAAUCUGUAAUAAAA105.5987

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5411-5433CTCAATAAATCTGTAATAAAAAAUUUUAUUACAGAUUUAUUGAGCAAUAAAUCUGUAAUAAAAAAU-7.5-10.312


Target Position: 6170, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6170CAGUUUGUGACAUACAUUA94.517344

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6168-6190ATCAGTTTGTGACATACATTATTUAAUGUAUGUCACAAACUGAUCAGUUUGUGACAUACAUUAUUU6.717.832


Target Position: 4264, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4264GCCUAAACAAAAUAAGAAA92.8746514

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4262-4284CAGCCTAAACAAAATAAGAAATTUUUCUUAUUUUGUUUAGGCUGGCCUAAACAAAAUAAGAAAUUU6.918.623


Target Position: 2423, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2423GGAAUAAUAAUAAAUGAAA98.3277118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2682441GGAATAATAATAAATGAAATTTCATTTATTATTATTCC0.572500.555000.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2421-2443AAGGAATAATAATAAATGAAACAUUUCAUUUAUUAUUAUUCCUUGGAAUAAUAAUAAAUGAAACAU7.41.822


Target Position: 7094, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7094CACUAAACCCAUAAGGAUA95.8451244

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7092-7114TGCACTAAACCCATAAGGATACTUAUCCUUAUGGGUUUAGUGCACACUAAACCCAUAAGGAUACUU19.912.932


Target Position: 691, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
691CUUGAUUAUGCUUGGAUUA85.36581802

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
689-711GACTTGATTATGCTTGGATTAACUAAUCCAAGCAUAAUCAAGUCCUUGAUUAUGCUUGGAUUAACU20.18.922


Target Position: 2928, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2928GUUUAAAUCUCAAAUUCAA97.077169

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2926-2948GGGTTTAAATCTCAAATTCAACAUUGAAUUUGAGAUUUAAACCCGUUUAAAUCUCAAAUUCAACAU7.4-9.722


Target Position: 5055, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5055CAUCUUCUUUUCAAGUUGA89.04651025

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5053-5075TGCATCTTCTTTTCAAGTTGAAAUCAACUUGAAAAGAAGAUGCACAUCUUCUUUUCAAGUUGAAAU16.719.122


Target Position: 9957, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9957GAUUUCUAGCAUGAAGUUA88.98421037

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9955-9977TAGATTTCTAGCATGAAGTTAGCUAACUUCAUGCUAGAAAUCUAGAUUUCUAGCAUGAAGUUAGCU19.26.932


Target Position: 1057, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1057CCUCAACUUACCUCGAUUU79.93353256

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8105719CCTCAACTTACCTCGATTT1/1/0/097.75XRN1NM_019001.3+NM_001042604.11+1NANANA3:142140345..142140363(-)00XRN1(0.002)


Target Position: 6812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6812GCCUCAUAAACUCUCUCUU82.26742576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7996830GCCTCATAAACTCTCTCTTAAGAGAGAGTTTATGAGGC0.320200.086700.862101.000001.000001.00000


Target Position: 8424, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8424GAAAAACAGUUAAAUAAGA92.7522525

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8422-8444AAGAAAAACAGTTAAATAAGACAUCUUAUUUAACUGUUUUUCUUGAAAAACAGUUAAAUAAGACAU-4.35.622


Target Position: 8029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8029UGCUCCUUCCAGUCUCGUU71.52725785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9758047TGCTCCTTCCAGTCTCGTTAACGAGACTGGAAGGAGCA0.305200.062400.706900.750001.000001.00000


Target Position: 2936, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2936CUCAAAUUCAACAAGAAAA86.97691426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9962954CTCAAATTCAACAAGAAAATTTTCTTGTTGAATTTGAG0.273200.070500.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2934-2956ATCTCAAATTCAACAAGAAAAATUUUUCUUGUUGAAUUUGAGAUCUCAAAUUCAACAAGAAAAAUU12.27.422


Target Position: 5886, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5886CAAUUUUUUAGGUUACUCA91.923606

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5884-5906TACAATTTTTTAGGTTACTCAAGUGAGUAACCUAAAAAAUUGUACAAUUUUUUAGGUUACUCAAGU21.4-12.033


Target Position: 9801, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9801GAAGUAUUUUAUUAAAAAU95.617258

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9799-9821GAGAAGTATTTTATTAAAAATTCAUUUUUAAUAAAAUACUUCUCGAAGUAUUUUAUUAAAAAUUCU-9.14.621


Target Position: 2474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2474GGUCGUAAAUAUCAAAUAA104.21515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3182492GGTCGTAAATATCAAATAATTATTTGATATTTACGACC0.616500.198400.819001.000001.000001.00000


Target Position: 1448, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1448CAGGCAAUACAGUGGAUUU89.2142995

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9144819CAGGCAATACAGTGGATTT1/1/0/097.75XRN1NM_019001.3+NM_001042604.11+1NANANA3:142136019..142136037(-)00XRN1(0.002)


Target Position: 2294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2294CCAGGAACACAGAAGCUUU88.00451206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4202312CCAGGAACACAGAAGCTTTAAAGCTTCTGTGTTCCTGG0.467400.183900.844801.000001.000001.00000


Target Position: 9641, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9641CUAGUUUAAUGUGAGUAAU82.63332482

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9639-9661ATCTAGTTTAATGTGAGTAATAGAUUACUCACAUUAAACUAGAUCUAGUUUAAUGUGAGUAAUAGU20.36.632


Target Position: 6580, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6580GCUGAUUUCAGAGUUUAAA86.6711489

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6578-6600CTGCTGATTTCAGAGTTTAAATGUUUAAACUCUGAAAUCAGCAGGCUGAUUUCAGAGUUUAAAUGU4.912.032


Target Position: 8754, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8754CUGUAGAAGACAAUUAAUU82.13912614

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8752-8774TACTGTAGAAGACAATTAATTTAAAUUAAUUGUCUUCUACAGUACUGUAGAAGACAAUUAAUUUAU-10.320.323


Target Position: 9706, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9706CAAAAGUGUAAUUCAUACA90.8127760

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9704-9726AACAAAAGTGTAATTCATACATAUGUAUGAAUUACACUUUUGUUCAAAAGUGUAAUUCAUACAUAU16.110.321


Target Position: 833, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833GAGUAUAUUGACUAUGAGU91.635645

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
831-853GAGAGTATATTGACTATGAGTTTACUCAUAGUCAAUAUACUCUCGAGUAUAUUGACUAUGAGUUUU17.86.122


Target Position: 2937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2937UCAAAUUCAACAAGAAAAA74.97254732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9842955TCAAATTCAACAAGAAAAATTTTTCTTGTTGAATTTGA0.274900.096700.724100.750001.000001.00000


Target Position: 8298, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8298GCAAGUUUUUUUAUUGUUU81.44272818

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8296-8318ATGCAAGTTTTTTTATTGTTTCTAAACAAUAAAAAAACUUGCAUGCAAGUUUUUUUAUUGUUUCUU6.910.322


Target Position: 5953, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5953GUACAAUGAUUACAAAUUA98.647109

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5951-5973GGGTACAATGATTACAAATTAATUAAUUUGUAAUCAUUGUACCCGUACAAUGAUUACAAAUUAAUU5.313.522


Target Position: 7291, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7291CUACUAAAAAUACAAAAAU82.88452412

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7289-7311CTCTACTAAAAATACAAAAATTAAUUUUUGUAUUUUUAGUAGAGCUACUAAAAAUACAAAAAUUAU5.66.600


Target Position: 7799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7799CCCCAAAGUUUAAAAAUAU86.02281651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4857817CCCCAAAGTTTAAAAATATATATTTTTAAACTTTGGGG0.436800.266600.948301.000001.000001.00000


Target Position: 1208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1208GCCAGGAACUACAAGGAAA94.1786377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2701226GCCAGGAACTACAAGGAAATTTCCTTGTAGTTCCTGGC0.766500.225601.000001.000001.000001.00000


Target Position: 6857, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6857GUAAUACAAAGAAAAGUUA91.049716

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6855-6877TGGTAATACAAAGAAAAGTTAAAUAACUUUUCUUUGUAUUACCAGUAAUACAAAGAAAAGUUAAAU3.28.522


Target Position: 3479, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3479GUACUAUUUGAAGUAUUAU87.23551365

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3477-3499ATGTACTATTTGAAGTATTATTTAUAAUACUUCAAAUAGUACAUGUACUAUUUGAAGUAUUAUUUU6.36.322


Target Position: 1209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1209CCAGGAACUACAAGGAAAA89.4254969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2611227CCAGGAACTACAAGGAAAATTTTCCTTGTAGTTCCTGG0.838700.230600.844801.000001.000001.00000


Target Position: 2689, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2689GGAUUCAGGUGAUGUGAUU88.82871066

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2687-2709CAGGATTCAGGTGATGTGATTACAAUCACAUCACCUGAAUCCUGGGAUUCAGGUGAUGUGAUUACU20.520.422


Target Position: 9268, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9268CUAUGGUUUCCAAAAGAUA91.8083622

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9266-9288GACTATGGTTTCCAAAAGATACAUAUCUUUUGGAAACCAUAGUCCUAUGGUUUCCAAAAGAUACAU5.320.022


Target Position: 4974, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4974CAGAUUCUUCCAACAUUGU77.5493980

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4972-4994GCCAGATTCTTCCAACATTGTCAACAAUGUUGGAAGAAUCUGGCCAGAUUCUUCCAACAUUGUCAU12.119.123


Target Position: 6741, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6741CAUUGUUUCUUUAUCUGUA98.80799

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6739-6761AACATTGTTTCTTTATCTGTAGTUACAGAUAAAGAAACAAUGUUCAUUGUUUCUUUAUCUGUAGUU20.35.322


Target Position: 9625, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9625CUUUGAGUAUUUUCAUCUA95.8103248

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9623-9645TTCTTTGAGTATTTTCATCTAGTUAGAUGAAAAUACUCAAAGAACUUUGAGUAUUUUCAUCUAGUU20.419.222


Target Position: 8838, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8838GUCAUUUUUCUAGAGAUAA85.93791667

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8836-8858TTGTCATTTTTCTAGAGATAAATUUAUCUCUAGAAAAAUGACAAGUCAUUUUUCUAGAGAUAAAUU20.27.422


Target Position: 5912, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5912GCAUUAGUAAUUUCUAGUA95.5969261

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5910-5932CAGCATTAGTAATTTCTAGTAAAUACUAGAAAUUACUAAUGCUGGCAUUAGUAAUUUCUAGUAAAU18.911.622


Target Position: 8089, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8089GUUAGAAUUUGAAUGUAUU89.871894

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8087-8109GCGTTAGAATTTGAATGTATTAAAAUACAUUCAAAUUCUAACGCGUUAGAAUUUGAAUGUAUUAAU6.76.922


Target Position: 6420, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6420GCAUACUUUUUUAAAAGUA91.8451618

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6418-6440TAGCATACTTTTTTAAAAGTAGGUACUUUUAAAAAAGUAUGCUAGCAUACUUUUUUAAAAGUAGGU4.911.612


Target Position: 7453, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7453GUCUCAAAAAAAAGAAAAA88.71531092

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7451-7473CTGTCTCAAAAAAAAGAAAAAAGUUUUUCUUUUUUUUGAGACAGGUCUCAAAAAAAAGAAAAAAGU5.520.400


Target Position: 9843, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9843CUCAUUUUGUAAUUUUUGA80.56293076

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9841-9863TGCTCATTTTGTAATTTTTGATTUCAAAAAUUACAAAAUGAGCACUCAUUUUGUAAUUUUUGAUUU-3.37.422


Target Position: 518, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
518GUAAAUAUGAAAAUUUCCA81.96572682

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
516-538TTGTAAATATGAAAATTTCCACAUGGAAAUUUUCAUAUUUACAAGUAAAUAUGAAAAUUUCCACAU14.2-8.022


Target Position: 9774, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9774GGAAUUUUUCAUUAGAUCU85.64371733

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9772-9794CTGGAATTTTTCATTAGATCTTAAGAUCUAAUGAAAAAUUCCAGGGAAUUUUUCAUUAGAUCUUAU16.00.421


Target Position: 4257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4257CCUCUCAGCCUAAACAAAA87.30141345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5264275CCTCTCAGCCTAAACAAAATTTTGTTTAGGCTGAGAGG0.419000.276600.844801.000001.000001.00000


Target Position: 893, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893GAAAGGAUAAUAGAUGAUU84.4862015

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
891-913TTGAAAGGATAATAGATGATTGGAAUCAUCUAUUAUCCUUUCAAGAAAGGAUAAUAGAUGAUUGGU20.418.733


Target Position: 949, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949CCCUCAUCUACCUCAUUUA92.5913538

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_794919CCCTCATCTACCTCATTTA1/1/0/097.75XRN1NM_019001.3+NM_001042604.11+1NANANA3:142141491..142141509(-)00XRN1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
619967CCCTCATCTACCTCATTTATAAATGAGGTAGATGAGGG0.478500.110600.956901.000001.000001.00000


Target Position: 7983, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7983CAAUAAGUUUUUUCUUUUU85.62091741

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7981-8003TTCAATAAGTTTTTTCTTTTTTGAAAAAGAAAAAACUUAUUGAACAAUAAGUUUUUUCUUUUUUGU5.54.621


Target Position: 4800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4800CCUUCCAUCAUACUUUAUA87.61351275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3724818CCTTCCATCATACTTTATATATAAAGTATGATGGAAGG0.570100.306200.801701.000001.000001.00000


Target Position: 5788, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5788CUUUAUUCUAAAUUUUGUA87.77291250

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5786-5808TGCTTTATTCTAAATTTTGTACCUACAAAAUUUAGAAUAAAGCACUUUAUUCUAAAUUUUGUACCU5.32.122


Target Position: 5821, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5821GAAUAAUCAGAAUAUUUCA100.01667

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5819-5841TAGAATAATCAGAATATTTCATCUGAAAUAUUCUGAUUAUUCUAGAAUAAUCAGAAUAUUUCAUCU1.81.822


Target Position: 898, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
898GAUAAUAGAUGAUUGGAUU94.2254374

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
896-918AGGATAATAGATGATTGGATTTTAAUCCAAUCAUCUAUUAUCCUGAUAAUAGAUGAUUGGAUUUUU20.1-2.722


Target Position: 8524, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8524CACUUUUUAUUUAUGUGUU83.74172192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8522-8544CTCACTTTTTATTTATGTGTTCTAACACAUAAAUAAAAAGUGAGCACUUUUUAUUUAUGUGUUCUU20.43.223


Target Position: 5641, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5641GGAUUUUAUUUCUCUUUUU89.6778926

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5639-5661GTGGATTTTATTTCTCTTTTTAAAAAAAGAGAAAUAAAAUCCACGGAUUUUAUUUCUCUUUUUAAU10.32.111


Target Position: 5294, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5294GUGUAAAUUGAAAUUUUUU83.22622330

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5292-5314ATGTGTAAATTGAAATTTTTTTCAAAAAAUUUCAAUUUACACAUGUGUAAAUUGAAAUUUUUUUCU-12.06.912


Target Position: 5556, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5556CAAUAAUAAGCAUUUUUUA96.7421192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5554-5576AGCAATAATAAGCATTTTTTACAUAAAAAAUGCUUAUUAUUGCUCAAUAAUAAGCAUUUUUUACAU-12.0-8.022


Target Position: 8369, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8369GCUAGAUUCUUGGUUUUAA94.382357

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8367-8389AAGCTAGATTCTTGGTTTTAATGUUAAAACCAAGAAUCUAGCUUGCUAGAUUCUUGGUUUUAAUGU14.011.622


Target Position: 4183, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4183CCAUAAGAAUGAAAUCAAA100.30263

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4181-4203GACCATAAGAATGAAATCAAACAUUUGAUUUCAUUCUUAUGGUCCCAUAAGAAUGAAAUCAAACAU7.413.422


Target Position: 831, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831GAGAGUAUAUUGACUAUGA101.02548

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
829-851GAGAGAGTATATTGACTATGAGTUCAUAGUCAAUAUACUCUCUCGAGAGUAUAUUGACUAUGAGUU20.318.922


Target Position: 9804, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9804GUAUUUUAUUAAAAAUUCA92.3716564

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9802-9824AAGTATTTTATTAAAAATTCAAAUGAAUUUUUAAUAAAAUACUUGUAUUUUAUUAAAAAUUCAAAU0.4-7.522


Target Position: 3380, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3380CUUUUUGACCGUGUUGUAA81.96072683

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3378-3400GTCTTTTTGACCGTGTTGTAAATUUACAACACGGUCAAAAAGACCUUUUUGACCGUGUUGUAAAUU20.47.733


Target Position: 5130, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5130CAAGAAGAAAAUCAAGAAA92.2354578

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5128-5150TTCAAGAAGAAAATCAAGAAAACUUUCUUGAUUUUCUUCUUGAACAAGAAGAAAAUCAAGAAAACU20.419.122


Target Position: 1350, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1350CUGAGUUUAGACAAUAUAA96.5232201

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1348-1370AACTGAGTTTAGACAATATAAAAUUAUAUUGUCUAAACUCAGUUCUGAGUUUAGACAAUAUAAAAU0.019.223


Target Position: 9575, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9575GUCUUUUGGCUUUAAGUAU81.04512923

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9573-9595TTGTCTTTTGGCTTTAAGTATCAAUACUUAAAGCCAAAAGACAAGUCUUUUGGCUUUAAGUAUCAU6.612.222


Target Position: 2162, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2162GAUGAACUUACCGUAGAAA92.4526553

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2160-2182CAGATGAACTTACCGTAGAAAATUUUCUACGGUAAGUUCAUCUGGAUGAACUUACCGUAGAAAAUU20.919.233


Target Position: 6486, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6486GUAACUCAUUGGAAACUCU86.80231459

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6484-6506ATGTAACTCATTGGAAACTCTGCAGAGUUUCCAAUGAGUUACAUGUAACUCAUUGGAAACUCUGCU21.520.331


Target Position: 10072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10072GACUUGAGAAUGAUUUUAU90.7861764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
91510090GACTTGAGAATGATTTTATATAAAATCATTCTCAAGTC0.287500.094500.775900.750001.000001.00000


Target Position: 4334, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4334CAGUCUAUGGACAAUAUGU88.3211153

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4332-4354TTCAGTCTATGGACAATATGTGTACAUAUUGUCCAUAGACUGAACAGUCUAUGGACAAUAUGUGUU5.618.932


Target Position: 8123, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8123CAUGUAGACUAAAGUCUUA100.81754

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8121-8143ATCATGTAGACTAAAGTCTTAAAUAAGACUUUAGUCUACAUGAUCAUGUAGACUAAAGUCUUAAAU17.720.323


Target Position: 871, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
871GAUCACAUUUAAAUAUGAU93.7753413

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
869-891AAGATCACATTTAAATATGATATAUCAUAUUUAAAUGUGAUCUUGAUCACAUUUAAAUAUGAUAUU8.720.522


Target Position: 812, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
812CUACACUUGUCUUUAAUGA84.88871922

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
810-832TTCTACACTTGTCTTTAATGAGAUCAUUAAAGACAAGUGUAGAACUACACUUGUCUUUAAUGAGAU-1.419.032


Target Position: 6581, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6581CUGAUUUCAGAGUUUAAAU82.68672461

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6579-6601TGCTGATTTCAGAGTTTAAATGTAUUUAAACUCUGAAAUCAGCACUGAUUUCAGAGUUUAAAUGUU0.016.322


Target Position: 5145, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5145GAAAACUGGCUGUUAAUUU83.34622288

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5143-5165AAGAAAACTGGCTGTTAATTTTGAAAUUAACAGCCAGUUUUCUUGAAAACUGGCUGUUAAUUUUGU-0.310.321


Target Position: 8847, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8847CUAGAGAUAAAUUAUAGUA97.1863162

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8845-8867TTCTAGAGATAAATTATAGTACTUACUAUAAUUUAUCUCUAGAACUAGAGAUAAAUUAUAGUACUU6.320.233


Target Position: 8992, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8992GACUUUAUUCAUAUUUCCA93.8199407

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8990-9012CTGACTTTATTCATATTTCCATCUGGAAAUAUGAAUAAAGUCAGGACUUUAUUCAUAUUUCCAUCU15.54.622


Target Position: 5654, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5654CUUUUUAAUGAUGUAAGAA87.63151272

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5652-5674CTCTTTTTAATGATGTAAGAAAAUUCUUACAUCAUUAAAAAGAGCUUUUUAAUGAUGUAAGAAAAU20.3-9.122


Target Position: 3146, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3146GUUCAAGAAAUUAUUACUU80.94472955

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3144-3166AAGTTCAAGAAATTATTACTTGGAAGUAAUAAUUUCUUGAACUUGUUCAAGAAAUUAUUACUUGGU6.320.422


Target Position: 6882, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6882GACAGUAAUGUUAUAUUAA101.4943

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6880-6902GTGACAGTAATGTTATATTAACCUUAAUAUAACAUUACUGUCACGACAGUAAUGUUAUAUUAACCU-5.919.022


Target Position: 3925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3925ACAUGACCCUCACAGAAAA91.289682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8523943ACATGACCCTCACAGAAAATTTTCTGTGAGGGTCATGT0.305800.159700.706900.750000.983700.75000


Target Position: 9723, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9723CAUAUAUAGAUACAUAUCU88.35751149

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9721-9743TACATATATAGATACATATCTTAAGAUAUGUAUCUAUAUAUGUACAUAUAUAGAUACAUAUCUUAU16.0-6.411


Target Position: 2295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2295CAGGAACACAGAAGCUUUA90.8254758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6902313CAGGAACACAGAAGCTTTATAAAGCTTCTGTGTTCCTG0.482500.204100.750000.750001.000001.00000


Target Position: 1681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1681CUCACCAAUUAUAGAAUAU84.13282095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5291699CTCACCAATTATAGAATATATATTCTATAATTGGTGAG0.551500.296500.767200.750001.000001.00000


Target Position: 8714, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8714GUAUUUCUUGGUAUCAUGU79.59973377

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8712-8734CTGTATTTCTTGGTATCATGTTGACAUGAUACCAAGAAAUACAGGUAUUUCUUGGUAUCAUGUUGU14.96.923


Target Position: 5410, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5410CCUCAAUAAAUCUGUAAUA93.8473405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9785428CCTCAATAAATCTGTAATATATTACAGATTTATTGAGG0.276300.137100.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5408-5430TACCTCAATAAATCTGTAATAAAUAUUACAGAUUUAUUGAGGUACCUCAAUAAAUCUGUAAUAAAU11.613.421


Target Position: 9552, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9552GUUUUCGUUUUUUGGAUUU69.73716286

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9550-9572TTGTTTTCGTTTTTTGGATTTTTAAAUCCAAAAAACGAAAACAAGUUUUCGUUUUUUGGAUUUUUU20.115.322


Target Position: 8290, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8290CUAUUGAUGCAAGUUUUUU76.72524218

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8288-8310AACTATTGATGCAAGTTTTTTTAAAAAAACUUGCAUCAAUAGUUCUAUUGAUGCAAGUUUUUUUAU3.28.722


Target Position: 5838, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5838CAUCUAACUGCUUAGAACU85.79081705

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5836-5858TTCATCTAACTGCTTAGAACTATAGUUCUAAGCAGUUAGAUGAACAUCUAACUGCUUAGAACUAUU14.614.533


Target Position: 9582, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9582GGCUUUAAGUAUCAUAUUU90.5488795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5359600GGCTTTAAGTATCATATTTAAATATGATACTTAAAGCC0.543200.126301.000001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9580-9602TTGGCTTTAAGTATCATATTTTCAAAUAUGAUACUUAAAGCCAAGGCUUUAAGUAUCAUAUUUUCU8.713.722


Target Position: 9621, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9621GCUUCUUUGAGUAUUUUCA87.64651270

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9619-9641CTGCTTCTTTGAGTATTTTCATCUGAAAAUACUCAAAGAAGCAGGCUUCUUUGAGUAUUUUCAUCU2.110.322


Target Position: 8062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8062CCUGCAUUACCUAAUAAUU85.89131681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4688080CCTGCATTACCTAATAATTAATTATTAGGTAATGCAGG0.447000.265100.836201.000001.000001.00000


Target Position: 808, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
808CCUUCUACACUUGUCUUUA89.589938

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
806-828CACCTTCTACACTTGTCTTTAATUAAAGACAAGUGUAGAAGGUGCCUUCUACACUUGUCUUUAAUU19.218.932


Target Position: 7288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7288UCUCUACUAAAAAUACAAA84.7171967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5857306TCTCTACTAAAAATACAAATTTGTATTTTTAGTAGAGA0.941700.780600.724100.750001.000001.00000


Target Position: 4236, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4236GAAGAGAUGAAUAUGGAUU87.43971324

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4234-4256CAGAAGAGATGAATATGGATTACAAUCCAUAUUCAUCUCUUCUGGAAGAGAUGAAUAUGGAUUACU21.219.122


Target Position: 10058, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10058GGAUUUUAAUUAAAGACUU89.3804976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95810076GGATTTTAATTAAAGACTTAAGTCTTTAATTAAAATCC0.279500.228900.732801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10056-10078ATGGATTTTAATTAAAGACTTGAAAGUCUUUAAUUAAAAUCCAUGGAUUUUAAUUAAAGACUUGAU17.72.122


Target Position: 8909, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8909CAGUGAAACCAUCAGUUUU89.12931009

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8907-8929GTCAGTGAAACCATCAGTTTTGCAAAACUGAUGGUUUCACUGACCAGUGAAACCAUCAGUUUUGCU19.219.222


Target Position: 9678, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9678GAAGUGUUCAACAUUUUGU80.80842999

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9676-9698TTGAAGTGTTCAACATTTTGTTCACAAAAUGUUGAACACUUCAAGAAGUGUUCAACAUUUUGUUCU4.217.822


Target Position: 6475, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6475CUGAUUUUCAUGUAACUCA86.13661623

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6473-6495ATCTGATTTTCATGTAACTCATTUGAGUUACAUGAAAAUCAGAUCUGAUUUUCAUGUAACUCAUUU21.47.422


Target Position: 4899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4899GGGUUGCAAACAAAAAGAA90.1119859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9844917GGGTTGCAAACAAAAAGAATTCTTTTTGTTTGCAACCC0.413500.061600.819001.000001.000001.00000


Target Position: 4400, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4400GAACUUUCUCGAAUUUGUU85.50021776

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4398-4420CTGAACTTTCTCGAATTTGTTCCAACAAAUUCGAGAAAGUUCAGGAACUUUCUCGAAUUUGUUCCU5.313.323


Target Position: 5869, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5869CUAAAUUUGAGUAAAUACA85.03741888

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5867-5889TTCTAAATTTGAGTAAATACAATUGUAUUUACUCAAAUUUAGAACUAAAUUUGAGUAAAUACAAUU1.4-9.722


Target Position: 1326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1326CUGAAGAUGAUGACCUAUU79.98793241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9491344CTGAAGATGATGACCTATTAATAGGTCATCATCTTCAG0.281600.153000.775900.750001.000001.00000


Target Position: 2534, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2534CAAGUUGUUCCUUUUGUUU80.52653089

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2532-2554AACAAGTTGTTCCTTTTGTTTATAAACAAAAGGAACAACUUGUUCAAGUUGUUCCUUUUGUUUAUU5.617.822


Target Position: 6786, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6786GUAAAUCCUCAAUGUGUAU84.68231973

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6784-6806AAGTAAATCCTCAATGTGTATAAAUACACAUUGAGGAUUUACUUGUAAAUCCUCAAUGUGUAUAAU20.415.523


Target Position: 842, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
842GACUAUGAGUUUUCAGUAU91.8607616

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
840-862TTGACTATGAGTTTTCAGTATTAAUACUGAAAACUCAUAGUCAAGACUAUGAGUUUUCAGUAUUAU20.320.322


Target Position: 5925, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5925CUAGUAAAAUUGUUUCAAA97.4793148

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5923-5945TTCTAGTAAAATTGTTTCAAAATUUUGAAACAAUUUUACUAGAACUAGUAAAAUUGUUUCAAAAUU14.96.622


Target Position: 9447, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9447CUGUUUCUCAUUAAAAAGA79.80123298

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9445-9467TGCTGTTTCTCATTAAAAAGAATUCUUUUUAAUGAGAAACAGCACUGUUUCUCAUUAAAAAGAAUU-3.819.222


Target Position: 166, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
166CCUGGAUAUGAAUGGAAUU83.37362274

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_616619CCTGGATATGAATGGAATT1/1/0/097.75XRN1NM_019001.3+NM_001042604.11+1NANANA3:142151694..142151712(-)00XRN1(0.002)


Target Position: 5386, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5386GCAGUUUGUUGUAUGUCAA97.1377165

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5384-5406GTGCAGTTTGTTGTATGTCAATTUUGACAUACAACAAACUGCACGCAGUUUGUUGUAUGUCAAUUU21.516.712


Target Position: 5255, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5255GUCUCAUAAAAAUUAGAAU87.11621395

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5253-5275ATGTCTCATAAAAATTAGAATGTAUUCUAAUUUUUAUGAGACAUGUCUCAUAAAAAUUAGAAUGUU6.921.421


Target Position: 6738, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6738CAACAUUGUUUCUUUAUCU88.8321064

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6736-6758CCCAACATTGTTTCTTTATCTGTAGAUAAAGAAACAAUGUUGGGCAACAUUGUUUCUUUAUCUGUU6.912.122


Target Position: 8409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8409AGGCAGAUGGAAGAAGAAA83.32542296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5278427AGGCAGATGGAAGAAGAAATTTCTTCTTCCATCTGCCT0.713400.475000.844800.750001.000001.00000


Target Position: 1557, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1557CACUCAAAAUCCAUUUUGA94.4476349

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1555-1577TACACTCAAAATCCATTTTGAACUCAAAAUGGAUUUUGAGUGUACACUCAAAAUCCAUUUUGAACU4.219.222


Target Position: 3955, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3955GUGUAAGAGUCCUAAAGCU87.56391286

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3953-3975GAGTGTAAGAGTCCTAAAGCTGAAGCUUUAGGACUCUUACACUCGUGUAAGAGUCCUAAAGCUGAU18.320.331


Target Position: 9885, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9885GCCAAUUAAAGUGUUUUAA81.35562837

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9883-9905CTGCCAATTAAAGTGTTTTAAACUUAAAACACUUUAAUUGGCAGGCCAAUUAAAGUGUUUUAAACU7.212.822


Target Position: 4050, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4050CCAAAGAAAAUGAAGUACA86.30081579

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4048-4070CTCCAAAGAAAATGAAGTACAGTUGUACUUCAUUUUCUUUGGAGCCAAAGAAAAUGAAGUACAGUU21.412.212


Target Position: 5748, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5748CUGUGAAAGGAUCACAUUU84.08042100

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5746-5768TGCTGTGAAAGGATCACATTTGTAAAUGUGAUCCUUUCACAGCACUGUGAAAGGAUCACAUUUGUU20.520.522


Target Position: 4256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4256CCCUCUCAGCCUAAACAAA89.07561018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1024274CCCTCTCAGCCTAAACAAATTTGTTTAGGCTGAGAGGG0.772100.452400.991401.000001.000001.00000


Target Position: 1930, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1930CAUAGAACGAUGUUGUACA94.3518361

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1928-1950GCCATAGAACGATGTTGTACAAGUGUACAACAUCGUUCUAUGGCCAUAGAACGAUGUUGUACAAGU21.514.533


Target Position: 6287, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6287GGUUCAAGCUGUAACUGUU96.6437196

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6285-6307GTGGTTCAAGCTGTAACTGTTGAAACAGUUACAGCUUGAACCACGGUUCAAGCUGUAACUGUUGAU19.019.221


Target Position: 4483, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4483CCAAGUAAAAUUAUCUAAU85.70151722

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4481-4503TGCCAAGTAAAATTATCTAATGGAUUAGAUAAUUUUACUUGGCACCAAGUAAAAUUAUCUAAUGGU8.411.823


Target Position: 4482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4482GCCAAGUAAAAUUAUCUAA90.9935722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5584500GCCAAGTAAAATTATCTAATTAGATAATTTTACTTGGC0.405400.122600.965501.000001.000001.00000


Target Position: 1511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1511CCUUAUCAUUAUGCACCUU80.31543148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7751529CCTTATCATTATGCACCTTAAGGTGCATAATGATAAGG0.419300.236100.706901.000001.000001.00000


Target Position: 1452, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1452CAAUACAGUGGAUUUUGCA87.52741301

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1450-1472GGCAATACAGTGGATTTTGCACTUGCAAAAUCCACUGUAUUGCCCAAUACAGUGGAUUUUGCACUU14.011.633


Target Position: 6295, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6295CUGUAACUGUUGAAAUUAU90.2328832

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6293-6315AGCTGTAACTGTTGAAATTATTTAUAAUUUCAACAGUUACAGCUCUGUAACUGUUGAAAUUAUUUU2.119.022


Target Position: 866, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
866GAAAAGAUCACAUUUAAAU88.74511082

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
864-886AAGAAAAGATCACATTTAAATATAUUUAAAUGUGAUCUUUUCUUGAAAAGAUCACAUUUAAAUAUU-9.75.322


Target Position: 2938, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2938CAAAUUCAACAAGAAAAAU80.77623009

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2936-2958CTCAAATTCAACAAGAAAAATGAAUUUUUCUUGUUGAAUUUGAGCAAAUUCAACAAGAAAAAUGAU5.57.422


Target Position: 924, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
924GGUUUCUUGUUGGUAAUGA84.0622109

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
922-944GGGGTTTCTTGTTGGTAATGATTUCAUUACCAACAAGAAACCCCGGUUUCUUGUUGGUAAUGAUUU20.013.322


Target Position: 5421, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5421CUGUAAUAAAAAACUAAAU82.93392397

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5419-5441ATCTGTAATAAAAAACTAAATTAAUUUAGUUUUUUAUUACAGAUCUGUAAUAAAAAACUAAAUUAU4.98.521


Target Position: 960, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
960CUCAUUUACAUAUUAAUCA85.13461864

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
958-980ACCTCATTTACATATTAATCATGUGAUUAAUAUGUAAAUGAGGUCUCAUUUACAUAUUAAUCAUGU1.88.922


Target Position: 5546, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5546CAUCAGUUAGCAAUAAUAA98.1102126

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5544-5566GACATCAGTTAGCAATAATAAGCUUAUUAUUGCUAACUGAUGUCCAUCAGUUAGCAAUAAUAAGCU-8.019.223


Target Position: 835, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
835GUAUAUUGACUAUGAGUUU88.3821144

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
833-855GAGTATATTGACTATGAGTTTTCAAACUCAUAGUCAAUAUACUCGUAUAUUGACUAUGAGUUUUCU19.20.031


Target Position: 8957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8957AGCUUAAAAUUCCAGAAAU83.25162318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7468975AGCTTAAAATTCCAGAAATATTTCTGGAATTTTAAGCT0.350100.204600.844800.750001.000001.00000


Target Position: 9008, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9008CCAUCAAACUUCUCCAAUA100.29464

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5900819CCATCAAACTTCTCCAATA1/1/0/0100.00XRN1NM_019001.3+NM_001042604.11+1NANANA3:142026515..142026533(-)00XRN1(0.002)&RIF1(0.029)


Target Position: 5303, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5303GAAAUUUUUUUCAUUUUUA92.7724521

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5301-5323TTGAAATTTTTTTCATTTTTAAGUAAAAAUGAAAAAAAUUUCAAGAAAUUUUUUUCAUUUUUAAGU-3.3-12.011


Target Position: 2845, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2845CCUUGUUUCAAGGUUUACA82.09122633

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2843-2865TACCTTGTTTCAAGGTTTACAGGUGUAAACCUUGAAACAAGGUACCUUGUUUCAAGGUUUACAGGU21.110.332


Target Position: 385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
385GGAGGCAGAAGACAAAAUU83.26322314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
561403GGAGGCAGAAGACAAAATTAATTTTGTCTTCTGCCTCC0.404400.163400.862101.000001.000001.00000


Target Position: 5555, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5555GCAAUAAUAAGCAUUUUUU84.3842037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7465573GCAATAATAAGCATTTTTTAAAAAATGCTTATTATTGC0.336900.217300.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5553-5575TAGCAATAATAAGCATTTTTTACAAAAAAUGCUUAUUAUUGCUAGCAAUAAUAAGCAUUUUUUACU-3.3-1.822


Target Position: 1837, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1837GAAAAGAAACCAACAUAGU82.20822602

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1835-1857AGGAAAAGAAACCAACATAGTGAACUAUGUUGGUUUCUUUUCCUGAAAAGAAACCAACAUAGUGAU11.65.522


Target Position: 5257, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5257CUCAUAAAAAUUAGAAUGU72.48385469

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5255-5277GTCTCATAAAAATTAGAATGTACACAUUCUAAUUUUUAUGAGACCUCAUAAAAAUUAGAAUGUACU13.48.932


Target Position: 1850, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1850CAUAGUGAGUGCCUAAUGU85.68861725

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1848-1870AACATAGTGAGTGCCTAATGTGCACAUUAGGCACUCACUAUGUUCAUAGUGAGUGCCUAAUGUGCU17.420.323


Target Position: 9674, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9674CAUUGAAGUGUUCAACAUU90.5043796

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9672-9694GTCATTGAAGTGTTCAACATTTTAAUGUUGAACACUUCAAUGACCAUUGAAGUGUUCAACAUUUUU20.512.022


Target Position: 7843, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7843GACUUUUUGUGAAAAUGGU80.09063218

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7841-7863AGGACTTTTTGTGAAAATGGTGGACCAUUUUCACAAAAAGUCCUGACUUUUUGUGAAAAUGGUGGU11.33.232


Target Position: 9114, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9114CUUUUCUUAAAGAAGAAAA82.5362511

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9112-9134TCCTTTTCTTAAAGAAGAAAAACUUUUCUUCUUUAAGAAAAGGACUUUUCUUAAAGAAGAAAAACU14.85.520


Target Position: 5681, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5681GGAGAAUGGCUCUUAUUUA102.14636

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5679-5701CAGGAGAATGGCTCTTATTTATGUAAAUAAGAGCCAUUCUCCUGGGAGAAUGGCUCUUAUUUAUGU-4.320.422


Target Position: 9113, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9113CCUUUUCUUAAAGAAGAAA82.23862593

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9111-9133ATCCTTTTCTTAAAGAAGAAAAAUUUCUUCUUUAAGAAAAGGAUCCUUUUCUUAAAGAAGAAAAAU19.110.321


Target Position: 1033, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1033GGGUUAUAUUAAUGAAAGU88.97061038

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1031-1053GGGGGTTATATTAATGAAAGTGGACUUUCAUUAAUAUAACCCCCGGGUUAUAUUAAUGAAAGUGGU12.015.323


Target Position: 2591, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2591CGUUUCUCCAAUAUCAAAA87.73881252

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2589-2611CCCGTTTCTCCAATATCAAAACAUUUUGAUAUUGGAGAAACGGGCGUUUCUCCAAUAUCAAAACAU8.921.523


Target Position: 9698, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9698CAUUUAAACAAAAGUGUAA93.3605460

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9696-9718TTCATTTAAACAAAAGTGTAATTUUACACUUUUGUUUAAAUGAACAUUUAAACAAAAGUGUAAUUU19.0-9.722


Target Position: 4968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4968GCCAGCCAGAUUCUUCCAA77.24794064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4564986GCCAGCCAGATTCTTCCAATTGGAAGAATCTGGCTGGC0.451500.189800.853401.000001.000001.00000


Target Position: 7289, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7289CUCUACUAAAAAUACAAAA86.07291641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9927307CTCTACTAAAAATACAAAATTTTGTATTTTTAGTAGAG0.941400.804700.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7287-7309GTCTCTACTAAAAATACAAAAATUUUUGUAUUUUUAGUAGAGACCUCUACUAAAAAUACAAAAAUU6.920.100


Target Position: 3798, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3798GAAAGAUGCAAUACUUUCA94.0573384

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3796-3818TGGAAAGATGCAATACTTTCAGCUGAAAGUAUUGCAUCUUUCCAGAAAGAUGCAAUACUUUCAGCU14.612.022


Target Position: 4230, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4230CUAACAGAAGAGAUGAAUA96.9673177

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4228-4250CTCTAACAGAAGAGATGAATATGUAUUCAUCUCUUCUGUUAGAGCUAACAGAAGAGAUGAAUAUGU16.220.322


Target Position: 2255, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2255GUAUCAGAUGGAGAAACUA94.6555333

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2253-2275CTGTATCAGATGGAGAAACTAAGUAGUUUCUCCAUCUGAUACAGGUAUCAGAUGGAGAAACUAAGU17.721.422


Target Position: 8551, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8551GUUAGUCAUAACUGUUUAU86.09781636

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8549-8571GTGTTAGTCATAACTGTTTATAGAUAAACAGUUAUGACUAACACGUUAGUCAUAACUGUUUAUAGU11.820.322


Target Position: 215, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
215GAUGUUCACUUUAGAAUUU87.26481357

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
213-235ATGATGTTCACTTTAGAATTTCAAAAUUCUAAAGUGAACAUCAUGAUGUUCACUUUAGAAUUUCAU6.920.522


Target Position: 9797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9797CAGAGAAGUAUUUUAUUAA100.8453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5369815CAGAGAAGTATTTTATTAATTAATAAAATACTTCTCTG0.547400.137900.750000.750001.000001.00000


Target Position: 4027, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4027CUUUUUAGCAUCUUUGAAU80.76373013

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4025-4047AACTTTTTAGCATCTTTGAATATAUUCAAAGAUGCUAAAAAGUUCUUUUUAGCAUCUUUGAAUAUU12.2-3.822


Target Position: 6583, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6583GAUUUCAGAGUUUAAAUGU80.6343054

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6581-6603CTGATTTCAGAGTTTAAATGTTAACAUUUAAACUCUGAAAUCAGGAUUUCAGAGUUUAAAUGUUAU-1.412.012


Target Position: 5229, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5229CUACCUUUUUAUAAAUACA92.5779540

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5227-5249ATCTACCTTTTTATAAATACATAUGUAUUUAUAAAAAGGUAGAUCUACCUUUUUAUAAAUACAUAU1.418.622


Target Position: 4198, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4198CAAACAGAUUGCUAAUGAA104.29314

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4196-4218ATCAAACAGATTGCTAATGAAATUUCAUUAGCAAUCUGUUUGAUCAAACAGAUUGCUAAUGAAAUU13.419.222


Target Position: 8538, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8538GUGUUCUAUUUGUGUUAGU76.71354221

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8536-8558ATGTGTTCTATTTGTGTTAGTCAACUAACACAAAUAGAACACAUGUGUUCUAUUUGUGUUAGUCAU19.020.323


Target Position: 855, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
855CAGUAUUAAAAGAAAAGAU89.9519884

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
853-875TTCAGTATTAAAAGAAAAGATCAAUCUUUUCUUUUAAUACUGAACAGUAUUAAAAGAAAAGAUCAU14.86.322


Target Position: 3395, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3395GUAAAUGUGAGAGAAAACU73.75715101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3393-3415TTGTAAATGTGAGAGAAAACTTCAGUUUUCUCUCACAUUUACAAGUAAAUGUGAGAGAAAACUUCU13.36.912


Target Position: 1683, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1683CACCAAUUAUAGAAUAUUA104.04217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8771701CACCAATTATAGAATATTATAATATTCTATAATTGGTG0.571200.368900.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1681-1703CTCACCAATTATAGAATATTACCUAAUAUUCUAUAAUUGGUGAGCACCAAUUAUAGAAUAUUACCU1.818.822


Target Position: 6687, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6687CCAUGAUUUUAUUUUCUGU85.80571701

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6685-6707TTCCATGATTTTATTTTCTGTTAACAGAAAAUAAAAUCAUGGAACCAUGAUUUUAUUUUCUGUUAU12.213.622


Target Position: 1950, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1950GGUAUAAAAUAAUAUCCUU96.864184

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1948-1970AAGGTATAAAATAATATCCTTAGAAGGAUAUUAUUUUAUACCUUGGUAUAAAAUAAUAUCCUUAGU19.91.412


Target Position: 9845, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9845CAUUUUGUAAUUUUUGAUU78.5443688

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9843-9865CTCATTTTGTAATTTTTGATTTTAAUCAAAAAUUACAAAAUGAGCAUUUUGUAAUUUUUGAUUUUU7.45.322


Target Position: 601, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
601GCAUAAAAUCAUGGAAUUU84.22952082

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
599-621GAGCATAAAATCATGGAATTTATAAAUUCCAUGAUUUUAUGCUCGCAUAAAAUCAUGGAAUUUAUU20.1-1.423


Target Position: 1212, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1212GGAACUACAAGGAAAAGAA98.845697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9351230GGAACTACAAGGAAAAGAATTCTTTTCCTTGTAGTTCC0.872400.282900.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1210-1232CAGGAACTACAAGGAAAAGAAAAUUCUUUUCCUUGUAGUUCCUGGGAACUACAAGGAAAAGAAAAU14.821.422


Target Position: 3862, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3862CCAAGUAAAUCAACAUCAU89.8523896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9543880CCAAGTAAATCAACATCATATGATGTTGATTTACTTGG0.877300.409500.689701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3860-3882AGCCAAGTAAATCAACATCATAAAUGAUGUUGAUUUACUUGGCUCCAAGUAAAUCAACAUCAUAAU20.511.823


Target Position: 3137, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3137GCUGAAAAAGUUCAAGAAA90.7842765

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3135-3157GTGCTGAAAAAGTTCAAGAAATTUUUCUUGAACUUUUUCAGCACGCUGAAAAAGUUCAAGAAAUUU20.412.222


Target Position: 4560, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4560CACUUUUUGCUUUACAACA86.01721654

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4558-4580TGCACTTTTTGCTTTACAACAGTUGUUGUAAAGCAAAAAGUGCACACUUUUUGCUUUACAACAGUU14.73.233


Target Position: 8043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8043UCGUUCCUUUUCACAUUUU66.50087173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4768061TCGTTCCTTTTCACATTTTAAAATGTGAAAAGGAACGA0.744700.536400.793100.750001.000001.00000


Target Position: 6908, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6908CUACUUUAAAGUGUGAAAU75.4424587

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6906-6928TCCTACTTTAAAGTGTGAAATGTAUUUCACACUUUAAAGUAGGACUACUUUAAAGUGUGAAAUGUU20.56.632


Target Position: 1085, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1085CUUGUGAAACUAUCAGAUU81.98482675

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1083-1105ACCTTGTGAAACTATCAGATTTTAAUCUGAUAGUUUCACAAGGUCUUGUGAAACUAUCAGAUUUUU20.420.522


Target Position: 5787, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5787GCUUUAUUCUAAAUUUUGU82.77012441

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5785-5807TTGCTTTATTCTAAATTTTGTACACAAAAUUUAGAAUAAAGCAAGCUUUAUUCUAAAUUUUGUACU-3.3-4.322


Target Position: 9414, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9414GCUGUUUUAGUAAUUUGAA90.208839

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9412-9434TAGCTGTTTTAGTAATTTGAAGCUUCAAAUUACUAAAACAGCUAGCUGUUUUAGUAAUUUGAAGCU7.410.322


Target Position: 5565, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5565GCAUUUUUUACACUAUCAU83.97132128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8855583GCATTTTTTACACTATCATATGATAGTGTAAAAAATGC0.794800.437500.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5563-5585AAGCATTTTTTACACTATCATTGAUGAUAGUGUAAAAAAUGCUUGCAUUUUUUACACUAUCAUUGU20.3-3.332


Target Position: 3201, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3201CUUCUUGUGAUUUACAAAU77.64983946

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3199-3221TTCTTCTTGTGATTTACAAATTCAUUUGUAAAUCACAAGAAGAACUUCUUGUGAUUUACAAAUUCU7.219.212


Target Position: 3703, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3703CAACCAUUCCCCUCAAUCA92.7543524

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3701-3723CTCAACCATTCCCCTCAATCACTUGAUUGAGGGGAAUGGUUGAGCAACCAUUCCCCUCAAUCACUU20.418.832


Target Position: 6477, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6477GAUUUUCAUGUAACUCAUU86.55941522

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6475-6497CTGATTTTCATGTAACTCATTGGAAUGAGUUACAUGAAAAUCAGGAUUUUCAUGUAACUCAUUGGU19.27.422


Target Position: 2064, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2064GACACAAAUUUUUUUUGAA96.3991206

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2062-2084CAGACACAAATTTTTTTTGAAGAUUCAAAAAAAAUUUGUGUCUGGACACAAAUUUUUUUUGAAGAU7.719.322


Target Position: 8756, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8756GUAGAAGACAAUUAAUUUA95.2802287

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8754-8776CTGTAGAAGACAATTAATTTATTUAAAUUAAUUGUCUUCUACAGGUAGAAGACAAUUAAUUUAUUU-9.720.222


Target Position: 8739, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8739CAAAUUUUGUUUUUACUGU77.92013871

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8737-8759TCCAAATTTTGTTTTTACTGTAGACAGUAAAAACAAAAUUUGGACAAAUUUUGUUUUUACUGUAGU11.8-12.022


Target Position: 7821, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7821CAUUCAACUUGAAUCUUCU91.1926699

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7819-7841CTCATTCAACTTGAATCTTCTGAAGAAGAUUCAAGUUGAAUGAGCAUUCAACUUGAAUCUUCUGAU14.814.812


Target Position: 277, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
277GUUGUUUCGCAUUAUUAAA88.07571194

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
275-297GTGTTGTTTCGCATTATTAAACCUUUAAUAAUGCGAAACAACACGUUGUUUCGCAUUAUUAAACCU-7.514.932


Target Position: 6988, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6988GACAGUUAUAUAAAUAGCA93.0611493

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6986-7008GTGACAGTTATATAAATAGCATGUGCUAUUUAUAUAACUGUCACGACAGUUAUAUAAAUAGCAUGU13.619.022


Target Position: 9103, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9103CAUCAUAGAUCCUUUUCUU92.9878500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9101-9123GACATCATAGATCCTTTTCTTAAAAGAAAAGGAUCUAUGAUGUCCAUCAUAGAUCCUUUUCUUAAU10.313.332


Target Position: 7483, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7483CCUUACUUUUUUUUUAACA82.24112592

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7481-7503ATCCTTACTTTTTTTTTAACATTUGUUAAAAAAAAAGUAAGGAUCCUUACUUUUUUUUUAACAUUU0.09.822


Target Position: 9644, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9644GUUUAAUGUGAGUAAUAGA95.3584280

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9642-9664TAGTTTAATGTGAGTAATAGATGUCUAUUACUCACAUUAAACUAGUUUAAUGUGAGUAAUAGAUGU6.3-1.422


Target Position: 4142, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4142CUUAAAGAAAUUCUAAAAA84.76091955

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4140-4162TGCTTAAAGAAATTCTAAAAATTUUUUUAGAAUUUCUUUAAGCACUUAAAGAAAUUCUAAAAAUUU7.17.122


Target Position: 6344, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6344CCUAUGUUUAUAUAUAUAU89.9351885

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6342-6364GGCCTATGTTTATATATATATATAUAUAUAUAUAAACAUAGGCCCCUAUGUUUAUAUAUAUAUAUU-6.411.621


Target Position: 1503, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1503GGUAUUAUCCUUAUCAUUA100.3462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6941521GGTATTATCCTTATCATTATAATGATAAGGATAATACC0.351000.114900.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1501-1523CTGGTATTATCCTTATCATTATGUAAUGAUAAGGAUAAUACCAGGGUAUUAUCCUUAUCAUUAUGU8.71.122


Target Position: 2752, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2752CAAUCUUGAUGCUUUAAUA104.12116

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2750-2772CCCAATCTTGATGCTTTAATACAUAUUAAAGCAUCAAGAUUGGGCAAUCUUGAUGCUUUAAUACAU-4.312.022


Target Position: 8302, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8302GUUUUUUUAUUGUUUCUUU82.01882660

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8300-8322AAGTTTTTTTATTGTTTCTTTCTAAAGAAACAAUAAAAAAACUUGUUUUUUUAUUGUUUCUUUCUU13.3-11.311


Target Position: 6033, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6033GUAUAGCUUUUUAUUUGCU78.48643702

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6031-6053TTGTATAGCTTTTTATTTGCTTAAGCAAAUAAAAAGCUAUACAAGUAUAGCUUUUUAUUUGCUUAU15.319.522


Target Position: 10071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10071AGACUUGAGAAUGAUUUUA83.63982214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95510089AGACTTGAGAATGATTTTATAAAATCATTCTCAAGTCT0.280900.081400.689700.750001.000001.00000


Target Position: 506, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
506CUGAAGUAUUUUGUAAAUA86.98741421

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
504-526ATCTGAAGTATTTTGTAAATATGUAUUUACAAAAUACUUCAGAUCUGAAGUAUUUUGUAAAUAUGU6.920.322


Target Position: 8830, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8830GUUCAUUUGUCAUUUUUCU79.60863373

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8828-8850AAGTTCATTTGTCATTTTTCTAGAGAAAAAUGACAAAUGAACUUGUUCAUUUGUCAUUUUUCUAGU0.47.422


Target Position: 8237, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8237GUAACUAAUAAAGAUUGAA90.1298856

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8235-8257GGGTAACTAATAAAGATTGAAGGUUCAAUCUUUAUUAGUUACCCGUAACUAAUAAAGAUUGAAGGU20.46.622


Target Position: 2354, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2354GGAGAUAAAGAACAAUCUA99.897368

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2352-2374TTGGAGATAAAGAACAATCTAACUAGAUUGUUCUUUAUCUCCAAGGAGAUAAAGAACAAUCUAACU19.216.022


Target Position: 1679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679GACUCACCAAUUAUAGAAU89.9841878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4061697GACTCACCAATTATAGAATATTCTATAATTGGTGAGTC0.568100.278000.810300.750001.000001.00000


Target Position: 5185, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5185GUAAAUUUGGCUCUUAGAA86.24881597

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5183-5205GAGTAAATTTGGCTCTTAGAATTUUCUAAGAGCCAAAUUUACUCGUAAAUUUGGCUCUUAGAAUUU20.2-9.732


Target Position: 7800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7800CCCAAAGUUUAAAAAUAUG73.11435299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6167818CCCAAAGTTTAAAAATATGCATATTTTTAAACTTTGGG0.383400.264900.836200.750001.000001.00000


Target Position: 5224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5224UCCAUCUACCUUUUUAUAA75.7674494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4105242TCCATCTACCTTTTTATAATTATAAAAAGGTAGATGGA0.549500.494400.836200.750001.000001.00000


Target Position: 6856, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6856GGUAAUACAAAGAAAAGUU88.5171125

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6854-6876ATGGTAATACAAAGAAAAGTTAAAACUUUUCUUUGUAUUACCAUGGUAAUACAAAGAAAAGUUAAU13.39.522


Target Position: 4250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4250GGAUUACCCUCUCAGCCUA95.8506243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8894268GGATTACCCTCTCAGCCTATAGGCTGAGAGGGTAATCC0.539200.081700.698301.000000.967400.87500


Target Position: 2634, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2634GAAGUAUGGUCUUUAUGCU87.88191224

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2632-2654GAGAAGTATGGTCTTTATGCTGGAGCAUAAAGACCAUACUUCUCGAAGUAUGGUCUUUAUGCUGGU15.311.623


Target Position: 6816, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6816CAUAAACUCUCUCUUUGUU86.9861422

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6814-6836CTCATAAACTCTCTCTTTGTTTTAACAAAGAGAGAGUUUAUGAGCAUAAACUCUCUCUUUGUUUUU19.24.622


Target Position: 3491, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3491GUAUUAUUUGAUGAAGAAU84.54441994

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3489-3511AAGTATTATTTGATGAAGAATTTAUUCUUCAUCAAAUAAUACUUGUAUUAUUUGAUGAAGAAUUUU20.4-8.012


Target Position: 844, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844CUAUGAGUUUUCAGUAUUA99.780870

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
842-864GACTATGAGTTTTCAGTATTAAAUAAUACUGAAAACUCAUAGUCCUAUGAGUUUUCAGUAUUAAAU11.620.323


Target Position: 3865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3865AGUAAAUCAACAUCAUAAA91.0342717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8933883AGTAAATCAACATCATAAATTTATGATGTTGATTTACT0.728000.659000.706900.750001.000001.00000


Target Position: 6209, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6209GAUUCUAUAUUUUUAGCUU93.131487

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6207-6229CTGATTCTATATTTTTAGCTTTAAAGCUAAAAAUAUAGAAUCAGGAUUCUAUAUUUUUAGCUUUAU18.36.622


Target Position: 1090, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1090GAAACUAUCAGAUUUUGAU91.7011631

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1088-1110GTGAAACTATCAGATTTTGATCGAUCAAAAUCUGAUAGUUUCACGAAACUAUCAGAUUUUGAUCGU7.44.632


Target Position: 6525, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6525CUUACUUGUUUUUUAAAAU82.60082489

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6523-6545GTCTTACTTGTTTTTTAAAATGCAUUUUAAAAAACAAGUAAGACCUUACUUGUUUUUUAAAAUGCU-9.111.811


Target Position: 9449, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9449GUUUCUCAUUAAAAAGAAU87.56661284

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9447-9469CTGTTTCTCATTAAAAAGAATGAAUUCUUUUUAAUGAGAAACAGGUUUCUCAUUAAAAAGAAUGAU5.520.412


Target Position: 8370, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8370CUAGAUUCUUGGUUUUAAU87.65121269

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8368-8390AGCTAGATTCTTGGTTTTAATGAAUUAAAACCAAGAAUCUAGCUCUAGAUUCUUGGUUUUAAUGAU0.016.022


Target Position: 5103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5103ACCAUAAGUCAACACCAAU79.96923246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3455121ACCATAAGTCAACACCAATATTGGTGTTGACTTATGGT0.872700.756400.844800.750000.989100.87500


Target Position: 503, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
503CAUCUGAAGUAUUUUGUAA99.558977

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
501-523AACATCTGAAGTATTTTGTAAATUUACAAAAUACUUCAGAUGUUCAUCUGAAGUAUUUUGUAAAUU7.220.422


Target Position: 5467, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5467GUAUCAGUGGACUAAACAU93.5982438

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5465-5487CAGTATCAGTGGACTAAACATTAAUGUUUAGUCCACUGAUACUGGUAUCAGUGGACUAAACAUUAU11.820.332


Target Position: 7072, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7072GGAAAUUUCAGUAGACAUA95.7415252

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7070-7092AGGGAAATTTCAGTAGACATAGTUAUGUCUACUGAAAUUUCCCUGGAAAUUUCAGUAGACAUAGUU20.30.433


Target Position: 1985, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1985GACAUAAACAAAAACAAAA93.7392416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6522003GACATAAACAAAAACAAAATTTTGTTTTTGTTTATGTC0.889200.714100.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1983-2005TAGACATAAACAAAAACAAAATAUUUUGUUUUUGUUUAUGUCUAGACAUAAACAAAAACAAAAUAU5.66.911


Target Position: 8202, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8202GUUUCAAUUUAAGAUUUUU82.9532391

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8200-8222TGGTTTCAATTTAAGATTTTTCTAAAAAUCUUAAAUUGAAACCAGUUUCAAUUUAAGAUUUUUCUU5.37.421


Target Position: 8881, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8881CUCAGUAUAUACAUUUUGU84.38262039

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8879-8901TGCTCAGTATATACATTTTGTAAACAAAAUGUAUAUACUGAGCACUCAGUAUAUACAUUUUGUAAU4.220.322


Target Position: 1937, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1937CGAUGUUGUACAAGGUAUA96.2148220

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1935-1957AACGATGTTGTACAAGGTATAAAUAUACCUUGUACAACAUCGUUCGAUGUUGUACAAGGUAUAAAU18.520.532


Target Position: 9505, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9505CCUUUCUUUCCCUUACAGU72.97855331

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9503-9525TTCCTTTCTTTCCCTTACAGTTAACUGUAAGGGAAAGAAAGGAACCUUUCUUUCCCUUACAGUUAU16.410.312


Target Position: 5813, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5813CAACUUUAGAAUAAUCAGA88.38791143

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5811-5833AGCAACTTTAGAATAATCAGAATUCUGAUUAUUCUAAAGUUGCUCAACUUUAGAAUAAUCAGAAUU13.44.932


Target Position: 8479, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8479CUUUCUAGCACAAGGAAAU79.38943447

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8477-8499ATCTTTCTAGCACAAGGAAATAGAUUUCCUUGUGCUAGAAAGAUCUUUCUAGCACAAGGAAAUAGU18.711.722


Target Position: 9019, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9019CUCCAAUACAGUAAGAGAU83.33232294

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9017-9039TTCTCCAATACAGTAAGAGATAGAUCUCUUACUGUAUUGGAGAACUCCAAUACAGUAAGAGAUAGU20.221.222


Target Position: 4314, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4314CUAAUGAGUACCAUAAUGU80.67943042

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4312-4334TGCTAATGAGTACCATAATGTTCACAUUAUGGUACUCAUUAGCACUAAUGAGUACCAUAAUGUUCU5.613.422


Target Position: 8410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8410GGCAGAUGGAAGAAGAAAA95.7607251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1438428GGCAGATGGAAGAAGAAAATTTTCTTCTTCCATCTGCC0.706700.551901.000001.000001.000001.00000


Target Position: 8958, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8958GCUUAAAAUUCCAGAAAUU88.8181071

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8918976GCTTAAAATTCCAGAAATTAATTTCTGGAATTTTAAGC0.294200.189500.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8956-8978AAGCTTAAAATTCCAGAAATTAAAAUUUCUGGAAUUUUAAGCUUGCUUAAAAUUCCAGAAAUUAAU12.0-3.821


Target Position: 5965, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5965CAAAUUAAUCUUCUAACAA94.5707339

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5963-5985TACAAATTAATCTTCTAACAAAAUUGUUAGAAGAUUAAUUUGUACAAAUUAAUCUUCUAACAAAAU20.3-9.722


Target Position: 6345, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6345CUAUGUUUAUAUAUAUAUA107.0426

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6343-6365GCCTATGTTTATATATATATATAUAUAUAUAUAUAAACAUAGGCCUAUGUUUAUAUAUAUAUAUAU-6.46.911


Target Position: 3997, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3997CAAUAAGCAGCCUAACUCU88.12111186

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3995-4017TCCAATAAGCAGCCTAACTCTGGAGAGUUAGGCUGCUUAUUGGACAAUAAGCAGCCUAACUCUGGU18.913.633


Target Position: 5277, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5277CUAUUUUAAAAUAAUAUGU77.3034046

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5275-5297TACTATTTTAAAATAATATGTGTACAUAUUAUUUUAAAAUAGUACUAUUUUAAAAUAAUAUGUGUU0.0-7.521


Target Position: 8466, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8466GACUAUACCGUAUCUUUCU85.41691791

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8464-8486TGGACTATACCGTATCTTTCTAGAGAAAGAUACGGUAUAGUCCAGACUAUACCGUAUCUUUCUAGU14.814.223


Target Position: 3268, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3268CAAGCAAAGAAAGAAUAAU84.6191986

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3266-3288TGCAAGCAAAGAAAGAATAATAAAUUAUUCUUUCUUUGCUUGCACAAGCAAAGAAAGAAUAAUAAU6.918.622


Target Position: 9051, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9051CAUCAAGUCUCCAGAAACA96.3293212

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9049-9071AGCATCAAGTCTCCAGAAACATGUGUUUCUGGAGACUUGAUGCUCAUCAAGUCUCCAGAAACAUGU19.219.222


Target Position: 136, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
136GCAUCAGAUUCCUGAAUUU93.0097498

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_113619GCATCAGATTCCTGAATTT1/1/0/0100.00XRN1NM_019001.3+NM_001042604.11+1NANANA3:142151724,142166712..142151735,142166718(-)00XRN1(0.002)


Target Position: 7889, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7889CCCAAAUUGCUUUAUGCUU74.10244994

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7887-7909TCCCCAAATTGCTTTATGCTTCCAAGCAUAAAGCAAUUUGGGGACCCAAAUUGCUUUAUGCUUCCU19.711.322


Target Position: 6406, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6406GGAAGUAAGUUAUAGCAUA104.56310

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6404-6426AAGGAAGTAAGTTATAGCATACTUAUGCUAUAACUUACUUCCUUGGAAGUAAGUUAUAGCAUACUU19.714.623


Target Position: 7165, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7165GAAAGAGUUUUAUUUUCCA92.0983587

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7163-7185GTGAAAGAGTTTTATTTTCCAGCUGGAAAAUAAAACUCUUUCACGAAAGAGUUUUAUUUUCCAGCU14.217.721


Target Position: 6691, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6691GAUUUUAUUUUCUGUUAUU90.5537793

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6689-6711ATGATTTTATTTTCTGTTATTTTAAUAACAGAAAAUAAAAUCAUGAUUUUAUUUUCUGUUAUUUUU11.6-10.312


Target Position: 6842, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6842GAAACAUCUAUUAUGGUAA97.1751163

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6840-6862AGGAAACATCTATTATGGTAATAUUACCAUAAUAGAUGUUUCCUGAAACAUCUAUUAUGGUAAUAU21.114.822


Target Position: 212, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
212GAUGAUGUUCACUUUAGAA102.3734

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
210-232ATGATGATGTTCACTTTAGAATTUUCUAAAGUGAACAUCAUCAUGAUGAUGUUCACUUUAGAAUUU11.720.522


Target Position: 9297, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9297CAAAGUUAAACCUGUAAAA92.1781582

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9295-9317TACAAAGTTAAACCTGTAAAAAGUUUUACAGGUUUAACUUUGUACAAAGUUAAACCUGUAAAAAGU11.84.922


Target Position: 8540, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8540GUUCUAUUUGUGUUAGUCA91.4088673

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8538-8560GTGTTCTATTTGTGTTAGTCATAUGACUAACACAAAUAGAACACGUUCUAUUUGUGUUAGUCAUAU21.46.932


Target Position: 6863, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6863CAAAGAAAAGUUAAAUUGU81.67522761

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6861-6883TACAAAGAAAAGTTAAATTGTGAACAAUUUAACUUUUCUUUGUACAAAGAAAAGUUAAAUUGUGAU-1.45.512


Target Position: 7747, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7747GACUUCAAGAAAUUUAAAA89.6498928

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7745-7767TGGACTTCAAGAAATTTAAAATTUUUUAAAUUUCUUGAAGUCCAGACUUCAAGAAAUUUAAAAUUU-9.719.221


Target Position: 5444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5444CCUUGCAUUAAAAUAAUAU83.82432165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3785462CCTTGCATTAAAATAATATATATTATTTTAATGCAAGG0.735800.445800.801701.000001.000001.00000


Target Position: 9264, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9264GAGACUAUGGUUUCCAAAA93.4347455

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9262-9284AGGAGACTATGGTTTCCAAAAGAUUUUGGAAACCAUAGUCUCCUGAGACUAUGGUUUCCAAAAGAU20.118.922


Target Position: 4014, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4014CUGGAAUUGAGAACUUUUU75.50954573

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4012-4034CTCTGGAATTGAGAACTTTTTAGAAAAAGUUCUCAAUUCCAGAGCUGGAAUUGAGAACUUUUUAGU3.220.122


Target Position: 7954, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7954CUGAAACAUUAUUUCUAAA94.7454326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5877972CTGAAACATTATTTCTAAATTTAGAAATAATGTTTCAG0.396200.116700.784500.750000.934800.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7952-7974AACTGAAACATTATTTCTAAATAUUUAGAAAUAAUGUUUCAGUUCUGAAACAUUAUUUCUAAAUAU7.120.522


Target Position: 6826, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6826CUCUUUGUUUUUAAAGGAA85.43611789

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6824-6846CTCTCTTTGTTTTTAAAGGAAACUUCCUUUAAAAACAAAGAGAGCUCUUUGUUUUUAAAGGAAACU19.919.211


Target Position: 4804, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4804CCAUCAUACUUUAUAUUCU91.567649

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4802-4824TTCCATCATACTTTATATTCTGGAGAAUAUAAAGUAUGAUGGAACCAUCAUACUUUAUAUUCUGGU3.514.923


Target Position: 9683, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9683GUUCAACAUUUUGUUCAUU79.58623383

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9681-9703GTGTTCAACATTTTGTTCATTTAAAUGAACAAAAUGUUGAACACGUUCAACAUUUUGUUCAUUUAU20.520.522


Target Position: 2473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2473AGGUCGUAAAUAUCAAAUA89.547952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4932491AGGTCGTAAATATCAAATATATTTGATATTTACGACCT0.617100.137400.801700.750001.000001.00000


Target Position: 948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
948UCCCUCAUCUACCUCAUUU69.99216227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
651966TCCCTCATCTACCTCATTTAAATGAGGTAGATGAGGGA0.469300.105500.870700.750001.000001.00000


Target Position: 8201, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8201GGUUUCAAUUUAAGAUUUU83.6052228

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8199-8221TTGGTTTCAATTTAAGATTTTTCAAAAUCUUAAAUUGAAACCAAGGUUUCAAUUUAAGAUUUUUCU5.314.922


Target Position: 6653, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6653CAUUAUCUGUCAUUUAUCA97.6973138

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6651-6673TTCATTATCTGTCATTTATCATAUGAUAAAUGACAGAUAAUGAACAUUAUCUGUCAUUUAUCAUAU1.86.622


Target Position: 6297, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6297GUAACUGUUGAAAUUAUUU83.30142306

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6295-6317CTGTAACTGTTGAAATTATTTTAAAAUAAUUUCAACAGUUACAGGUAACUGUUGAAAUUAUUUUAU-10.319.021


Target Position: 5448, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5448GCAUUAAAAUAAUAUCACA101.33546

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5446-5468TTGCATTAAAATAATATCACAGTUGUGAUAUUAUUUUAAUGCAAGCAUUAAAAUAAUAUCACAGUU16.0-1.421


Target Position: 5412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5412UCAAUAAAUCUGUAAUAAA90.8071762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8825430TCAATAAATCTGTAATAAATTTATTACAGATTTATTGA0.297400.173100.724100.750001.000001.00000


Target Position: 3051, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3051CAGAACUAUUUAGUUAUAU84.71921966

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3049-3071TCCAGAACTATTTAGTTATATAGAUAUAACUAAAUAGUUCUGGACAGAACUAUUUAGUUAUAUAGU6.318.932


Target Position: 8009, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8009CUUAAGUGAAUUUUGAAGA78.24323774

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8007-8029AACTTAAGTGAATTTTGAAGATTUCUUCAAAAUUCACUUAAGUUCUUAAGUGAAUUUUGAAGAUUU12.211.821


Target Position: 1938, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1938GAUGUUGUACAAGGUAUAA93.5188445

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1936-1958ACGATGTTGTACAAGGTATAAAAUUAUACCUUGUACAACAUCGUGAUGUUGUACAAGGUAUAAAAU19.819.332


Target Position: 8198, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8198CUUGGUUUCAAUUUAAGAU80.28183156

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8196-8218ACCTTGGTTTCAATTTAAGATTTAUCUUAAAUUGAAACCAAGGUCUUGGUUUCAAUUUAAGAUUUU7.118.832


Target Position: 6387, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6387GAUAUGCUUAUAUUUUUAA94.8138322

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6385-6407GTGATATGCTTATATTTTTAAGGUUAAAAAUAUAAGCAUAUCACGAUAUGCUUAUAUUUUUAAGGU-9.719.722


Target Position: 8639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8639GUCACGCUUCUUCCCAUUA82.05782647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4188657GTCACGCTTCTTCCCATTATAATGGGAAGAAGCGTGAC0.959500.244500.784500.750000.994600.62500


Target Position: 8279, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8279GGAAUGAAGAACUAUUGAU92.2404576

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8277-8299GAGGAATGAAGAACTATTGATGCAUCAAUAGUUCUUCAUUCCUCGGAAUGAAGAACUAUUGAUGCU13.416.323


Target Position: 5865, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5865CAUUCUAAAUUUGAGUAAA94.7095329

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5863-5885AGCATTCTAAATTTGAGTAAATAUUUACUCAAAUUUAGAAUGCUCAUUCUAAAUUUGAGUAAAUAU20.36.912


Target Position: 8157, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8157GUUGUAGUUGCAGAAAAAA86.0051659

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8155-8177CAGTTGTAGTTGCAGAAAAAAATUUUUUUCUGCAACUACAACUGGUUGUAGUUGCAGAAAAAAAUU5.519.022


Target Position: 3198, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3198GUUCUUCUUGUGAUUUACA87.2131370

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3196-3218TCGTTCTTCTTGTGATTTACAAAUGUAAAUCACAAGAAGAACGAGUUCUUCUUGUGAUUUACAAAU10.019.132


Target Position: 8236, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8236GGUAACUAAUAAAGAUUGA90.052869

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8234-8256GGGGTAACTAATAAAGATTGAAGUCAAUCUUUAUUAGUUACCCCGGUAACUAAUAAAGAUUGAAGU12.014.331


Target Position: 5476, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5476GACUAAACAUUAAAAUGUA102.57931

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5474-5496TGGACTAAACATTAAAATGTACCUACAUUUUAAUGUUUAGUCCAGACUAAACAUUAAAAUGUACCU5.312.921


Target Position: 8840, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8840CAUUUUUCUAGAGAUAAAU82.62222484

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8838-8860GTCATTTTTCTAGAGATAAATTAAUUUAUCUCUAGAAAAAUGACCAUUUUUCUAGAGAUAAAUUAU6.90.412


Target Position: 2308, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2308GCUUUAUUCAGGAAGAACU82.09352632

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2306-2328AAGCTTTATTCAGGAAGAACTGCAGUUCUUCCUGAAUAAAGCUUGCUUUAUUCAGGAAGAACUGCU21.5-4.322


Target Position: 8939, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8939CUUUCCUAGUCAAGAUAAA89.08851016

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8937-8959TCCTTTCCTAGTCAAGATAAAGCUUUAUCUUGACUAGGAAAGGACUUUCCUAGUCAAGAUAAAGCU6.919.922


Target Position: 1567, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1567CCAUUUUGAACUAGGAAAA85.72431715

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1565-1587ATCCATTTTGAACTAGGAAAACCUUUUCCUAGUUCAAAAUGGAUCCAUUUUGAACUAGGAAAACCU19.94.232


Target Position: 6772, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6772GUAAUGAGGCUCAAGUAAA93.9228395

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6770-6792GAGTAATGAGGCTCAAGTAAATCUUUACUUGAGCCUCAUUACUCGUAAUGAGGCUCAAGUAAAUCU11.813.432


Target Position: 6385, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6385GUGAUAUGCUUAUAUUUUU88.2871159

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6383-6405TTGTGATATGCTTATATTTTTAAAAAAAUAUAAGCAUAUCACAAGUGAUAUGCUUAUAUUUUUAAU-10.314.922


Target Position: 1340, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1340CUAUUUGAAACUGAGUUUA82.24112591

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1338-1360ACCTATTTGAAACTGAGTTTAGAUAAACUCAGUUUCAAAUAGGUCUAUUUGAAACUGAGUUUAGAU19.28.922


Target Position: 6677, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6677GUAUAAGUUUCCAUGAUUU90.7537770

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6675-6697TCGTATAAGTTTCCATGATTTTAAAAUCAUGGAAACUUAUACGAGUAUAAGUUUCCAUGAUUUUAU13.66.332


Target Position: 6712, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6712CAUAAGUUCAGAUGUUUAU85.78791706

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6710-6732TTCATAAGTTCAGATGTTTATCAAUAAACAUCUGAACUUAUGAACAUAAGUUCAGAUGUUUAUCAU6.94.622


Target Position: 958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958ACCUCAUUUACAUAUUAAU82.38672546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
827976ACCTCATTTACATATTAATATTAATATGTAAATGAGGT0.612100.393300.844800.750001.000001.00000


Target Position: 3656, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3656CAACAUAGCUCAAGUUCAU92.0115596

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3654-3676ATCAACATAGCTCAAGTTCATCAAUGAACUUGAGCUAUGUUGAUCAACAUAGCUCAAGUUCAUCAU19.211.622


Target Position: 8006, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8006CAACUUAAGUGAAUUUUGA91.4538669

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8004-8026AGCAACTTAAGTGAATTTTGAAGUCAAAAUUCACUUAAGUUGCUCAACUUAAGUGAAUUUUGAAGU-3.34.922


Target Position: 798, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
798CUACAUUUCACCUUCUACA87.78591244

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
796-818AACTACATTTCACCTTCTACACTUGUAGAAGGUGAAAUGUAGUUCUACAUUUCACCUUCUACACUU18.96.932


Target Position: 5977, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5977CUAACAAAAUAAAAUAUGA92.7892517

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5975-5997TTCTAACAAAATAAAATATGAAAUCAUAUUUUAUUUUGUUAGAACUAACAAAAUAAAAUAUGAAAU-1.87.222


Target Position: 2864, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2864GGAAGUAUUUUUAUUGGAA99.188787

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2862-2884CAGGAAGTATTTTTATTGGAAGAUUCCAAUAAAAAUACUUCCUGGGAAGUAUUUUUAUUGGAAGAU21.214.522


Target Position: 6203, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6203CAUUCUGAUUCUAUAUUUU93.0684492

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6201-6223TTCATTCTGATTCTATATTTTTAAAAAUAUAGAAUCAGAAUGAACAUUCUGAUUCUAUAUUUUUAU-8.020.421


Target Position: 1671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1671CCAAUGAAGACUCACCAAU79.61783369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7431689CCAATGAAGACTCACCAATATTGGTGAGTCTTCATTGG0.337200.148900.836201.000000.913000.62500


Target Position: 9308, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9308CUGUAAAAAGUCUUUUUUU82.28572571

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9306-9328ACCTGTAAAAAGTCTTTTTTTTTAAAAAAAGACUUUUUACAGGUCUGUAAAAAGUCUUUUUUUUUU-5.97.222


Target Position: 5981, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5981CAAAAUAAAAUAUGAAAUA92.7343527

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5979-6001AACAAAATAAAATATGAAATATTUAUUUCAUAUUUUAUUUUGUUCAAAAUAAAAUAUGAAAUAUUU7.2-9.711


Target Position: 4311, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4311GUGCUAAUGAGUACCAUAA93.6155435

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4309-4331CAGTGCTAATGAGTACCATAATGUUAUGGUACUCAUUAGCACUGGUGCUAAUGAGUACCAUAAUGU21.119.723


Target Position: 9012, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9012CAAACUUCUCCAAUACAGU82.19622604

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9010-9032ATCAAACTTCTCCAATACAGTAAACUGUAUUGGAGAAGUUUGAUCAAACUUCUCCAAUACAGUAAU11.613.321


Target Position: 1580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1580GGAAAACCUUUUAAGCCAU85.32511812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7191598GGAAAACCTTTTAAGCCATATGGCTTAAAAGGTTTTCC0.397500.094300.715501.000001.000001.00000


Target Position: 9506, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9506CUUUCUUUCCCUUACAGUU79.67753347

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9504-9526TCCTTTCTTTCCCTTACAGTTAAAACUGUAAGGGAAAGAAAGGACUUUCUUUCCCUUACAGUUAAU19.05.522


Target Position: 9800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9800AGAAGUAUUUUAUUAAAAA97.0294174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7659818AGAAGTATTTTATTAAAAATTTTTAATAAAATACTTCT0.379400.131800.724100.750001.000001.00000


Target Position: 7518, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7518CAAAACUGAGAAGAGAUUA86.75741471

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7516-7538GTCAAAACTGAGAAGAGATTAAGUAAUCUCUUCUCAGUUUUGACCAAAACUGAGAAGAGAUUAAGU19.110.322


Target Position: 9307, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9307CCUGUAAAAAGUCUUUUUU77.5293988

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9305-9327AACCTGTAAAAAGTCTTTTTTTTAAAAAAGACUUUUUACAGGUUCCUGUAAAAAGUCUUUUUUUUU5.511.832


Target Position: 1299, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1299CUUCUAAGGAUAAUUUAGA85.1811849

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1297-1319AACTTCTAAGGATAATTTAGAAGUCUAAAUUAUCCUUAGAAGUUCUUCUAAGGAUAAUUUAGAAGU-4.311.722


Target Position: 7284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7284CCUGUCUCUACUAAAAAUA86.19581609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3567302CCTGTCTCTACTAAAAATATATTTTTAGTAGAGACAGG0.872600.266500.801701.000001.000001.00000


Target Position: 7457, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7457CAAAAAAAAGAAAAAAGUU82.99872383

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7455-7477CTCAAAAAAAAGAAAAAAGTTTTAACUUUUUUCUUUUUUUUGAGCAAAAAAAAGAAAAAAGUUUUU3.2-11.311


Target Position: 4265, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4265CCUAAACAAAAUAAGAAAU81.33882844

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4263-4285AGCCTAAACAAAATAAGAAATTAAUUUCUUAUUUUGUUUAGGCUCCUAAACAAAAUAAGAAAUUAU7.111.822


Target Position: 4439, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4439CCUGAUUUCUCCUUUCUUA94.1112380

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4437-4459AACCTGATTTCTCCTTTCTTAGGUAAGAAAGGAGAAAUCAGGUUCCUGAUUUCUCCUUUCUUAGGU10.312.022


Target Position: 5864, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5864GCAUUCUAAAUUUGAGUAA86.92941432

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5862-5884TAGCATTCTAAATTTGAGTAAATUUACUCAAAUUUAGAAUGCUAGCAUUCUAAAUUUGAGUAAAUU20.313.412


Target Position: 8361, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8361CAAACUAAGCUAGAUUCUU82.672470

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8359-8381TCCAAACTAAGCTAGATTCTTGGAAGAAUCUAGCUUAGUUUGGACAAACUAAGCUAGAUUCUUGGU19.14.933


Target Position: 10051, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10051GCUCUAUGGAUUUUAAUUA93.7124419

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10049-10071ATGCTCTATGGATTTTAATTAAAUAAUUAAAAUCCAUAGAGCAUGCUCUAUGGAUUUUAAUUAAAU-9.717.822


Target Position: 8943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8943CCUAGUCAAGAUAAAGCUU82.25162585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9318961CCTAGTCAAGATAAAGCTTAAGCTTTATCTTGACTAGG0.284400.131000.706901.000001.000001.00000


Target Position: 2472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2472CAGGUCGUAAAUAUCAAAU79.88483270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9122490CAGGTCGTAAATATCAAATATTTGATATTTACGACCTG0.588300.123000.775900.750001.000001.00000


Target Position: 5960, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5960GAUUACAAAUUAAUCUUCU86.42221556

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5958-5980ATGATTACAAATTAATCTTCTAAAGAAGAUUAAUUUGUAAUCAUGAUUACAAAUUAAUCUUCUAAU14.86.932


Target Position: 5577, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5577CUAUCAUUGAGGAAUAAUU87.58111281

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5575-5597CACTATCATTGAGGAATAATTACAAUUAUUCCUCAAUGAUAGUGCUAUCAUUGAGGAAUAAUUACU1.88.733


Target Position: 4611, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4611CUUCACAAGUAUUUGCAAA88.29571157

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4609-4631GCCTTCACAAGTATTTGCAAATTUUUGCAAAUACUUGUGAAGGCCUUCACAAGUAUUUGCAAAUUU20.020.512


Target Position: 4135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4135ACGGAUGCUUAAAGAAAUU74.47554889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9674153ACGGATGCTTAAAGAAATTAATTTCTTTAAGCATCCGT0.474800.062900.767200.750001.000001.00000


Target Position: 736, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736CUUAAGAGAAGAAGUUCGA76.71844220

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
734-756CTCTTAAGAGAAGAAGTTCGATTUCGAACUUCUUCUCUUAAGAGCUUAAGAGAAGAAGUUCGAUUU19.711.733


Target Position: 9886, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9886CCAAUUAAAGUGUUUUAAA90.9925723

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9884-9906TGCCAATTAAAGTGTTTTAAACTUUUAAAACACUUUAAUUGGCACCAAUUAAAGUGUUUUAAACUU0.0-1.422


Target Position: 6604, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6604GCAGGAUAUUUGUGUAUUA102.30435

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4660419GCAGGATATTTGTGTATTA1/1/0/0100.00XRN1NM_019001.3+NM_001042604.11+1NANANA3:142028919..142028937(-)00XRN1(0.002)


Target Position: 5877, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5877GAGUAAAUACAAUUUUUUA102.43933

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5875-5897TTGAGTAAATACAATTTTTTAGGUAAAAAAUUGUAUUUACUCAAGAGUAAAUACAAUUUUUUAGGU-12.04.611


Target Position: 3094, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3094GUUCUAUGAAGAUGACAUU85.99551660

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3092-3114GTGTTCTATGAAGATGACATTTGAAUGUCAUCUUCAUAGAACACGUUCUAUGAAGAUGACAUUUGU20.513.422


Target Position: 3866, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3866GUAAAUCAACAUCAUAAAU85.67421728

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3864-3886AAGTAAATCAACATCATAAATCTAUUUAUGAUGUUGAUUUACUUGUAAAUCAACAUCAUAAAUCUU8.98.922


Target Position: 5703, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5703GUGUUUUAACUUAUGCUUU80.16783191

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5701-5723GTGTGTTTTAACTTATGCTTTGTAAAGCAUAAGUUAAAACACACGUGUUUUAACUUAUGCUUUGUU19.77.223


Target Position: 9772, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9772CUGGAAUUUUUCAUUAGAU86.55291525

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9770-9792AACTGGAATTTTTCATTAGATCTAUCUAAUGAAAAAUUCCAGUUCUGGAAUUUUUCAUUAGAUCUU13.420.121


Target Position: 9455, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9455CAUUAAAAAGAAUGAGAAU90.229834

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9453-9475CTCATTAAAAAGAATGAGAATTTAUUCUCAUUCUUUUUAAUGAGCAUUAAAAAGAAUGAGAAUUUU20.4-9.701


Target Position: 8579, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8579CUAAUUUUUACUUUUAUUA86.1751614

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8577-8599GTCTAATTTTTACTTTTATTATAUAAUAAAAGUAAAAAUUAGACCUAAUUUUUACUUUUAUUAUAU-9.7-9.722


Target Position: 3319, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3319GCUAUACAGACCUUUAGAA95.628255

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3317-3339TTGCTATACAGACCTTTAGAACAUUCUAAAGGUCUGUAUAGCAAGCUAUACAGACCUUUAGAACAU11.713.132


Target Position: 7968, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7968CUAAAUAUUUCUAUUCAAU88.98821036

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7966-7988TTCTAAATATTTCTATTCAATAAAUUGAAUAGAAAUAUUUAGAACUAAAUAUUUCUAUUCAAUAAU8.9-8.022


Target Position: 127, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
127GGUGAAAGAGCAUCAGAUU91.0099720

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
125-147GTGGTGAAAGAGCATCAGATTCCAAUCUGAUGCUCUUUCACCACGGUGAAAGAGCAUCAGAUUCCU20.419.222


Target Position: 3303, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3303CAGUGAAACCCCAUUUGCU85.17351853

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3301-3323AACAGTGAAACCCCATTTGCTATAGCAAAUGGGGUUUCACUGUUCAGUGAAACCCCAUUUGCUAUU20.019.222


Target Position: 7956, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7956GAAACAUUAUUUCUAAAUA100.73456

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
7954-7976CTGAAACATTATTTCTAAATATTUAUUUAGAAAUAAUGUUUCAGGAAACAUUAUUUCUAAAUAUUU6.95.321


Target Position: 874, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
874CACAUUUAAAUAUGAUAUU82.0862636

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
872-894ATCACATTTAAATATGATATTGAAAUAUCAUAUUUAAAUGUGAUCACAUUUAAAUAUGAUAUUGAU8.56.922


Target Position: 2357, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2357GAUAAAGAACAAUCUAACU88.68361100

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2355-2377GAGATAAAGAACAATCTAACTGGAGUUAGAUUGUUCUUUAUCUCGAUAAAGAACAAUCUAACUGGU14.56.922


Target Position: 8947, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8947GUCAAGAUAAAGCUUAAAA88.40981141

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8945-8967TAGTCAAGATAAAGCTTAAAATTUUUUAAGCUUUAUCUUGACUAGUCAAGAUAAAGCUUAAAAUUU13.720.432


Target Position: 9125, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9125GAAGAAAAACAUGUAUAAA98.991493

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
9123-9145AAGAAGAAAAACATGTATAAAATUUUAUACAUGUUUUUCUUCUUGAAGAAAAACAUGUAUAAAAUU8.55.511


Target Position: 4007, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4007CCUAACUCUGGAAUUGAGA78.36183742

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4005-4027AGCCTAACTCTGGAATTGAGAACUCUCAAUUCCAGAGUUAGGCUCCUAACUCUGGAAUUGAGAACU12.018.933


Target Position: 5411, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5411CUCAAUAAAUCUGUAAUAA90.8798748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9435429CTCAATAAATCTGTAATAATTATTACAGATTTATTGAG0.282700.150500.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5409-5431ACCTCAATAAATCTGTAATAAAAUUAUUACAGAUUUAUUGAGGUCUCAAUAAAUCUGUAAUAAAAU8.58.912


Target Position: 5779, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5779CCAGUUUUGCUUUAUUCUA87.7971242

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5777-5799TGCCAGTTTTGCTTTATTCTAAAUAGAAUAAAGCAAAACUGGCACCAGUUUUGCUUUAUUCUAAAU6.910.312


Target Position: 5629, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5629CUUACUGAAUGUGGAUUUU76.42584306

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5627-5649AACTTACTGAATGTGGATTTTATAAAAUCCACAUUCAGUAAGUUCUUACUGAAUGUGGAUUUUAUU20.120.312


Target Position: 10016, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10016CACUGAAAGAGUUUAAACA93.8778400

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10014-10036GTCACTGAAAGAGTTTAAACATCUGUUUAAACUCUUUCAGUGACCACUGAAAGAGUUUAAACAUCU0.019.222


Target Position: 5221, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5221CUUUCCAUCUACCUUUUUA88.90451050

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5219-5241CTCTTTCCATCTACCTTTTTATAUAAAAAGGUAGAUGGAAAGAGCUUUCCAUCUACCUUUUUAUAU9.520.122


Target Position: 6688, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6688CAUGAUUUUAUUUUCUGUU80.98092944

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6686-6708TCCATGATTTTATTTTCTGTTATAACAGAAAAUAAAAUCAUGGACAUGAUUUUAUUUUCUGUUAUU19.27.222


Target Position: 8093, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8093GAAUUUGAAUGUAUUAAUU92.4095559

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8091-8113TAGAATTTGAATGTATTAATTGAAAUUAAUACAUUCAAAUUCUAGAAUUUGAAUGUAUUAAUUGAU-8.07.422


Target Position: 8159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8159UGUAGUUGCAGAAAAAAAU76.45864299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8688177TGTAGTTGCAGAAAAAAATATTTTTTTCTGCAACTACA0.579500.105000.698300.750001.000001.00000


Target Position: 752, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
752CGAUUUGGUGGCAAAAAAA92.5129547

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
750-772TTCGATTTGGTGGCAAAAAAACAUUUUUUUGCCACCAAAUCGAACGAUUUGGUGGCAAAAAAACAU-2.920.122


Target Position: 1294, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1294GAUAACUUCUAAGGAUAAU84.3732042

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1292-1314ATGATAACTTCTAAGGATAATTTAUUAUCCUUAGAAGUUAUCAUGAUAACUUCUAAGGAUAAUUUU19.94.623


Target Position: 297, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
297CCAGGAAAGUGUUCUUUAU90.0761866

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_229719CCAGGAAAGTGTTCTTTAT1/1/0/0100.00XRN1NM_019001.3+NM_001042604.11+1NANANA3:142151563..142151581(-)00XRN1(0.002)


Target Position: 876, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
876CAUUUAAAUAUGAUAUUGA95.1783291

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
874-896CACATTTAAATATGATATTGAAAUCAAUAUCAUAUUUAAAUGUGCAUUUAAAUAUGAUAUUGAAAU8.7-9.712


Target Position: 1941, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1941GUUGUACAAGGUAUAAAAU86.5471526

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1939-1961ATGTTGTACAAGGTATAAAATAAAUUUUAUACCUUGUACAACAUGUUGUACAAGGUAUAAAAUAAU-7.520.421