siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Sidirect 146   170   172   351   355   612   615   642   694   705   716   722   803   935   989   1030   1037   1253   1358   1432  
1474   1476   1503   1615   1674   1680   1767   1869   1926   1976   1979   2037   2079   2081   2092   2164   2173   2276   2279   2299  
2309   2310   2312   2316   2319   2325   2326   2332   2336   2561   2595   2637   2685   2747   2967   2996   3040   3041   3232   3242  
3327   3378   3379   3400   3424   3493   3548   3667   4024   4032   4065   4090   4091   4100   4122   4126   4132   4136   4141   4143  
4188   4190   4192   4205   4214   4265   4279  
Biltr, Rnaxs 60   61   84   87   95   96   97   98   132   133   134   138   139   140   143   158   159   162   163   164  
165   168   192   194   195   196   212   216   218   221   222   233   234   241   242   243   244   245   246   259  
272   273   274   275   276   277   278   279   280   281   283   306   317   318   320   339   343   344   345   348  
362   363   368   369   370   372   382   383   419   423   424   425   427   428   429   430   431   437   438   457  
458   459   464   467   506   518   590   597   600   601   619   634   638   639   640   646   647   648   649   650  
652   653   697   702   710   711   712   713   730   736   737   740   741   742   744   745   777   778   779   791  
792   799   802   808   837   838   845   847   848   850   853   854   855   902   941   942   943   944   946   961  
970   971   973   974   975   976   1012   1015   1016   1018   1021   1049   1051   1057   1058   1099   1110   1117   1118   1119  
1120   1153   1154   1179   1182   1184   1186   1187   1188   1190   1272   1273   1278   1279   1282   1283   1285   1286   1287   1309  
1317   1318   1320   1321   1322   1323   1324   1325   1326   1327   1328   1335   1336   1346   1347   1361   1367   1368   1460   1462  
1463   1464   1465   1468   1469   1470   1471   1491   1522   1523   1525   1526   1527   1528   1534   1535   1546   1547   1577   1578  
1579   1582   1583   1609   1640   1650   1659   1660   1661   1663   1664   1665   1669   1670   1671   1672   1673   1678   1681   1683  
1684   1690   1696   1700   1701   1702   1705   1709   1710   1711   1736   1765   1766   1768   1771   1775   1782   1783   1797   1798  
1799   1805   1806   1807   1808   1812   1816   1817   1818   1827   1861   1862   1866   1867   1887   1888   1895   1896   1897   1900  
1901   1908   1910   1919   1920   1921   1922   1930   1931   1932   1933   1945   1951   1954   1957   1958   2002   2003   2005   2058  
2068   2069   2070   2071   2073   2074   2076   2077   2078   2089   2116   2134   2135   2136   2137   2138   2139   2141   2194   2195  
2196   2197   2248   2249   2250   2255   2278   2282   2283   2286   2287   2290   2343   2344   2374   2375   2376   2388   2389   2470  
2510   2511   2512   2522   2523   2545   2546   2547   2567   2568   2574   2621   2622   2648   2656   2675   2715   2716   2717   2718  
2749   2792   2793   2798   2804   2812   2830   2831   2863   2894   2900   2901   2902   2903   2907   2908   2909   2912   2913   2933  
2934   2935   2938   2944   2945   2948   2953   2954   2955   2956   2957   2981   2982   2983   2984   2985   2986   3003   3005   3034  
3035   3036   3037   3069   3070   3071   3162   3163   3166   3169   3171   3190   3191   3192   3212   3213   3214   3215   3216   3217  
3222   3228   3236   3237   3239   3248   3251   3261   3273   3274   3276   3277   3278   3279   3280   3283   3284   3285   3298   3299  
3340   3351   3352   3353   3354   3355   3356   3363   3364   3410   3411   3412   3413   3418   3419   3420   3422   3423   3430   3527  
3528   3529   3535   3536   3537   3538   3604   3609   3610   3645   3646   3647   3648   3651   3652   3655   3656   3657   3663   3664  
3665   3675   3676   3688   3689   3720   3721   3722   3784   3785   3787   3788   3824   3938   3939   3967   3968   3998   3999   4000  
4001   4002   4004   4023   4025   4026   4029   4037   4040   4054   4066   4097   4102   4103   4134   4148   4175   4176   4177   4185  
4186   4187   4224   4225   4238   4239   4242   4245   4246   4247   4249   4250   4255   4260   4285   4286   4289  
Biltr, Rnaxs, Sidirect 144   307   308   309   364   371   374   516   591   610   651   714   721   800   801   849   1027   1189   1369   1370  
1472   1682   1691   1697   1703   1769   1809   1860   1923   1925   2006   2039   2142   2288   2504   2748   2750   2864   2865   2866  
2914   3030   3043   3165   3170   3221   3229   3230   3421   3969   4027   4028   4038   4039   4041   4055   4067   4068   4080   4135  
4149   4226   4251   4256   4257   4287   4288  


Target Position: 1119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1119AACCAUCUCAGCGACAAAA80.1391121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6671137AACCATCTCAGCGACAAAATTTTGTCGCTGAGATGGTT0.293200.052500.646600.500000.962001.00000


Target Position: 639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
639CGACUCUAGAAUCAGAAGA82.9673804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
809657CGACTCTAGAATCAGAAGATCTTCTGATTCTAGAGTCG0.097000.008300.569000.750000.929300.62500


Target Position: 3069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3069UUCCAGAAGAUUGUUUGUU58.23833575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9963087TTCCAGAAGATTGTTTGTTAACAAACAATCTTCTGGAA0.085000.003900.525900.500001.000001.00000


Target Position: 3274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3274GUACCCAUCUCCCUUCUUU80.4981081

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4993292GTACCCATCTCCCTTCTTTAAAGAAGGGAGATGGGTAC0.205400.036000.681000.750001.000001.00000


Target Position: 437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
437ACUGAUACUCCUGACACUA85.0616637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
915455ACTGATACTCCTGACACTATAGTGTCAGGAGTATCAGT0.162300.090700.534500.750001.000001.00000


Target Position: 2510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2510GAGAGACUUGAAACCCACA92.8849136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9852528GAGAGACTTGAAACCCACATGTGGGTTTCAAGTCTCTC0.217800.019000.603400.500000.951100.62500


Target Position: 2079, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2079CUCUACUUAAGUACAUUGA79.57271175

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2077-2099GGCTCTACTTAAGTACATTGAAAUCAAUGUACUUAAGUAGAGCCCUCUACUUAAGUACAUUGAAAU13.518.922


Target Position: 1323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1323UACUGCCUGUGAAGAAAUU71.9782094

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7911341TACTGCCTGTGAAGAAATTAATTTCTTCACAGGCAGTA0.197800.008700.672400.500001.000001.00000


Target Position: 2983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2983UGAGCACAAAAGACUUAAU80.07721127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4523001TGAGCACAAAAGACTTAATATTAAGTCTTTTGTGCTCA0.541900.062300.715500.750001.000001.00000


Target Position: 802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
802AGAAAUGACCAUUUAUAUC74.01891812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
878820AGAAATGACCATTTATATCGATATAAATGGTCATTTCT0.160300.077700.543100.500000.994600.62500


Target Position: 3419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3419GACUGGAUUAAACUGCAAA93.9997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4543437GACTGGATTAAACTGCAAATTTGCAGTTTAATCCAGTC0.232700.023000.819000.750001.000001.00000


Target Position: 1976, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1976GAUGCAAAUUGCAACUUGA97.27834

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1974-1996ATGATGCAAATTGCAACTTGATCUCAAGUUGCAAUUUGCAUCAUGAUGCAAAUUGCAACUUGAUCU16.720.022


Target Position: 4066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4066ACCAAAAAGUAAAUGCAUU76.78211488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8424084ACCAAAAAGTAAATGCATTAATGCATTTACTTTTTGGT0.063500.029300.844800.750001.000001.00000


Target Position: 4102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4102UCAUUGUAGUUUAAGGAAA81.7619942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5864120TCATTGTAGTTTAAGGAAATTTCCTTAAACTACAATGA0.116400.039100.724100.750001.000001.00000


Target Position: 653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
653GAAGAAGUGGAUUUAAAUG79.88231148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
955671GAAGAAGTGGATTTAAATGCATTTAAATCCACTTCTTC0.162400.013500.517200.500001.000001.00000


Target Position: 3784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3784GGCAGGAUAUGGUGCAGGU82.3132871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8953802GGCAGGATATGGTGCAGGTACCTGCACCATATCCTGCC0.056800.006700.646600.750000.945700.62500


Target Position: 243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
243GGAACAAAAACAGGCAGAA88.9384338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
341261GGAACAAAAACAGGCAGAATTCTGCCTGTTTTTGTTCC0.180400.160200.698301.000001.000001.00000


Target Position: 1799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1799AUUGAUACCAGCAUGUUUU73.54531870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9991817ATTGATACCAGCATGTTTTAAAACATGCTGGTATCAAT0.054500.019400.508600.500001.000001.00000


Target Position: 458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
458GCAAAUGCUGAAGGAGAUU74.5741736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
789476GCAAATGCTGAAGGAGATTAATCTCCTTCAGCATTTGC0.077900.008800.844801.000001.000001.00000


Target Position: 808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
808GACCAUUUAUAUCAAGCAG78.93981248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
974826GACCATTTATATCAAGCAGCTGCTTGATATAAATGGTC0.130100.089400.534500.500001.000001.00000


Target Position: 2332, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2332CGAUGUUGUUUAUGUCAUU92.6344149

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2330-2352AACGATGTTGTTTATGTCATTGAAAUGACAUAAACAACAUCGUUCGAUGUUGUUUAUGUCAUUGAU20.520.522


Target Position: 3998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3998GUGUGUAGACAGUAAGGAA102.752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6134016GTGTGTAGACAGTAAGGAATTCCTTACTGTCTACACAC0.232800.033900.620700.750001.000001.00000


Target Position: 3163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3163CCCCAAUGUAUGCUAUCAU82.664830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8503181CCCCAATGTATGCTATCATATGATAGCATACATTGGGG0.062500.009500.836201.000001.000001.00000


Target Position: 2830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2830UCCAGAGCCUUUCAUCAAU72.53782017

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4772848TCCAGAGCCTTTCATCAATATTGATGAAAGGCTCTGGA0.136400.110300.862100.750001.000001.00000


Target Position: 2512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2512GAGACUUGAAACCCACAUG75.35231653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7392530GAGACTTGAAACCCACATGCATGTGGGTTTCAAGTCTC0.188900.022000.655200.500001.000001.00000


Target Position: 3676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3676CGGAUAUAGAAGGGGAGGU67.83382628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8053694CGGATATAGAAGGGGAGGTACCTCCCCTTCTATATCCG0.070700.025900.560300.750001.000001.00000


Target Position: 649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
649AUCAGAAGAAGUGGAUUUA79.26621211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
778667ATCAGAAGAAGTGGATTTATAAATCCACTTCTTCTGAT0.073600.017000.646600.500001.000001.00000


Target Position: 2039, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2039CAAUUGAACGAAAAGGAAA91.0596219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772057CAATTGAACGAAAAGGAAATTTCCTTTTCGTTCAATTG0.044700.006400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2037-2059CTCAATTGAACGAAAAGGAAACTUUUCCUUUUCGUUCAAUUGAGCAAUUGAACGAAAAGGAAACUU18.77.421


Target Position: 4080, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4080GCAUUUUCACCCAUUCUGU79.61421171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5274098GCATTTTCACCCATTCTGTACAGAATGGGTGAAAATGC0.141000.048900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4078-4100ATGCATTTTCACCCATTCTGTGGACAGAAUGGGUGAAAAUGCAUGCAUUUUCACCCAUUCUGUGGU18.17.432


Target Position: 3430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3430ACUGCAAAUAUCUCAUGAA91.6604188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8823448ACTGCAAATATCTCATGAATTCATGAGATATTTGCAGT0.267100.055000.534500.750001.000001.00000


Target Position: 162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
162UCAUGGGUGACGUUAAAAA81.9059920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
621180TCATGGGTGACGTTAAAAATTTTTAACGTCACCCATGA0.386600.035200.724100.750001.000001.00000


Target Position: 2902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2902UGAUCACGUAGCCCUUUUA84.4462684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5972920TGATCACGTAGCCCTTTTATAAAAGGGCTACGTGATCA0.148900.064400.689700.750001.000001.00000


Target Position: 4002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4002GUAGACAGUAAGGAAAAAA87.1867450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3314020GTAGACAGTAAGGAAAAAATTTTTTCCTTACTGTCTAC0.213400.114100.681000.750001.000001.00000


Target Position: 1058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1058CCCCCGCCUGAAGAUCCUU63.94083055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3211076CCCCCGCCTGAAGATCCTTAAGGATCTTCAGGCGGGGG0.191400.103400.853401.000000.918500.62500


Target Position: 3354, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3354CCCUGCAGUUGCUUCUCUU82.4467862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8253372CCCTGCAGTTGCTTCTCTTAAGAGAAGCAACTGCAGGG0.125100.007800.853401.000000.956501.00000


Target Position: 3969, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3969GCUAUUAAAACUUGGUUAU80.35861097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8613987GCTATTAAAACTTGGTTATATAACCAAGTTTTAATAGC0.061200.020300.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3967-3989CGGCTATTAAAACTTGGTTATGTAUAACCAAGUUUUAAUAGCCGGCUAUUAAAACUUGGUUAUGUU20.0-2.333


Target Position: 3191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3191AGGAAGAUUCUCACCACUG71.05762229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7883209AGGAAGATTCTCACCACTGCAGTGGTGAGAATCTTCCT0.071400.013900.560300.500000.989100.62500


Target Position: 3229, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3229CCACAAAUCAUCUGUUAAU87.3214441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2743247CCACAAATCATCTGTTAATATTAACAGATGATTTGTGG0.218400.170400.836201.000000.951100.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3227-3249ATCCACAAATCATCTGTTAATTGAUUAACAGAUGAUUUGUGGAUCCACAAAUCAUCUGUUAAUUGU11.812.123


Target Position: 1812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1812UGUUUUGUGAAUAUUUCUU71.45022179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7751830TGTTTTGTGAATATTTCTTAAGAAATATTCACAAAACA0.086300.051600.569000.750001.000001.00000


Target Position: 3665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3665GACAAUGGAAGCGGAUAUA86.6718484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7603683GACAATGGAAGCGGATATATATATCCGCTTCCATTGTC0.075500.045800.775900.750001.000001.00000


Target Position: 281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
281GUGGAAGGUUAUAAUUACA93.6421106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
688299GTGGAAGGTTATAATTACATGTAATTATAACCTTCCAC0.318000.036700.586200.500001.000001.00000


Target Position: 1526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1526GAGCGAGUUGCAUUUGAAA95.906454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3691544GAGCGAGTTGCATTTGAAATTTCAAATGCAACTCGCTC0.254300.084900.810300.750000.978300.75000


Target Position: 961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
961GGAAGGAGAGACAGUGGAG81.2699986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
786979GGAAGGAGAGACAGTGGAGCTCCACTGTCTCTCCTTCC0.140000.026700.560300.750001.000001.00000


Target Position: 971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
971ACAGUGGAGCCUUACAAAG67.03832709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
988989ACAGTGGAGCCTTACAAAGCTTTGTAAGGCTCCACTGT0.095900.017100.569000.500001.000001.00000


Target Position: 4136, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4136CAUUAGUGAUUUUGUUUAU89.8514281

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4134-4156TGCATTAGTGATTTTGTTTATATAUAAACAAAAUCACUAAUGCACAUUAGUGAUUUUGUUUAUAUU7.211.622


Target Position: 276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
276UUCAGGUGGAAGGUUAUAA72.14312071

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
676294TTCAGGTGGAAGGTTATAATTATAACCTTCCACCTGAA0.427600.053600.637900.500001.000001.00000


Target Position: 2276, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2276GGAGUAACCAAGGUUAUUU85.0929634

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2274-2296TTGGAGTAACCAAGGTTATTTTGAAAUAACCUUGGUUACUCCAAGGAGUAACCAAGGUUAUUUUGU13.921.423


Target Position: 3217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3217UAAUGCACUUAUCCACAAA85.9265554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8943235TAATGCACTTATCCACAAATTTGTGGATAAGTGCATTA0.681200.082300.534500.500000.983700.62500


Target Position: 3340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3340GACUUUAGUCACCCCCCUG72.49972021

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8893358GACTTTAGTCACCCCCCTGCAGGGGGGTGACTAAAGTC0.096700.007700.534500.500001.000001.00000


Target Position: 1736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1736GUAGUACUGCGUGAUGUUG71.01652233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9821754GTAGTACTGCGTGATGTTGCAACATCACGCAGTACTAC0.067600.006400.534500.500001.000001.00000


Target Position: 467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
467GAAGGAGAUUUACCAACAA99.033116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
943485GAAGGAGATTTACCAACAATTGTTGGTAAATCTCCTTC0.578300.082100.525900.750000.994600.87500


Target Position: 1661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1661GCAGGCAUUCGAGGAAUCA81.2311991

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5931679GCAGGCATTCGAGGAATCATGATTCCTCGAATGCCTGC0.282800.032600.629300.750001.000001.00000


Target Position: 1920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1920CUCCACCAAAAGACAAAAA79.68171167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571938CTCCACCAAAAGACAAAAATTTTTGTCTTTTGGTGGAG0.819800.376500.810300.750000.983700.62500


Target Position: 1700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1700AUACAUGAAAGAGAUAUUA83.3624779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811718ATACATGAAAGAGATATTATAATATCTCTTTCATGTAT0.247200.021100.508600.500001.000001.00000


Target Position: 2288, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2288GUUAUUUUGUCCACAAAUA90.7412237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6712306GTTATTTTGTCCACAAATATATTTGTGGACAAAATAAC0.257600.041200.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2286-2308AGGTTATTTTGTCCACAAATATTUAUUUGUGGACAAAAUAACCUGUUAUUUUGUCCACAAAUAUUU12.1-9.722


Target Position: 976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
976GGAGCCUUACAAAGUAAAC73.26441898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
578994GGAGCCTTACAAAGTAAACGTTTACTTTGTAAGGCTCC0.109500.024900.724100.750001.000001.00000


Target Position: 1684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1684UGUAAUUGUAGAUGAAAUA85.7608576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9821702TGTAATTGTAGATGAAATATATTTCATCTACAATTACA0.044300.006600.663800.750001.000001.00000


Target Position: 1869, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1869CAGUUCAAGAAUAUUUUCU77.84591353

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1867-1889CCCAGTTCAAGAATATTTTCTGGAGAAAAUAUUCUUGAACUGGGCAGUUCAAGAAUAUUUUCUGGU2.119.222


Target Position: 3273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3273AGUACCCAUCUCCCUUCUU70.8972252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7483291AGTACCCATCTCCCTTCTTAAGAAGGGAGATGGGTACT0.202500.034800.569000.750001.000001.00000


Target Position: 4068, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4068CAAAAAGUAAAUGCAUUUU75.83391592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6694086CAAAAAGTAAATGCATTTTAAAATGCATTTACTTTTTG0.089400.035300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4066-4088ACCAAAAAGTAAATGCATTTTCAAAAAUGCAUUUACUUUUUGGUCAAAAAGUAAAUGCAUUUUCAU20.03.221


Target Position: 3538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3538CCCCGUAAAUGAACGUAUG71.29612204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8673556CCCCGTAAATGAACGTATGCATACGTTCATTTACGGGG0.059800.038900.836200.750000.907600.87500


Target Position: 3400, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3400GCAGAUUGUGCUUGUAGAU86.7865474

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3398-3420GGGCAGATTGTGCTTGTAGATGAAUCUACAAGCACAAUCUGCCCGCAGAUUGUGCUUGUAGAUGAU20.318.123


Target Position: 1711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1711AGAUAUUAAUACUGACUUC81.436970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9271729AGATATTAATACTGACTTCGAAGTCAGTATTAATATCT0.052600.041900.551700.500001.000001.00000


Target Position: 3939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3939GCUACUUUGGACAGGGAAG69.20822462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2533957GCTACTTTGGACAGGGAAGCTTCCCTGTCCAAAGTAGC0.522500.047100.715500.750001.000001.00000


Target Position: 4122, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4122CAAGCAUAUAGAUGCAUUA98.193626

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4120-4142ACCAAGCATATAGATGCATTAGTUAAUGCAUCUAUAUGCUUGGUCAAGCAUAUAGAUGCAUUAGUU19.919.733


Target Position: 3356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3356CUGCAGUUGCUUCUCUUUG65.55422894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8553374CTGCAGTTGCTTCTCTTTGCAAAGAGAAGCAACTGCAG0.086800.008200.637900.500000.956500.75000


Target Position: 4067, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4067CCAAAAAGUAAAUGCAUUU80.33521098

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7474085CCAAAAAGTAAATGCATTTAAATGCATTTACTTTTTGG0.076500.032300.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4065-4087CACCAAAAAGTAAATGCATTTTCAAAUGCAUUUACUUUUUGGUGCCAAAAAGUAAAUGCAUUUUCU19.92.121


Target Position: 4029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4029UAUGUGUUACGUGUUUUUU68.08262588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9234047TATGTGTTACGTGTTTTTTAAAAAACACGTAACACATA0.129200.051000.543100.500001.000001.00000


Target Position: 194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
194UGGUGUGGCAAAAGGAAGA72.46412028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
818212TGGTGTGGCAAAAGGAAGATCTTCCTTTTGCCACACCA0.242700.053200.620700.500001.000001.00000


Target Position: 4000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4000GUGUAGACAGUAAGGAAAA91.0314221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2994018GTGTAGACAGTAAGGAAAATTTTCCTTACTGTCTACAC0.250000.040200.793100.750001.000001.00000


Target Position: 1189, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1189GACUAGUAGCAACAUUGAU90.4309249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5401207GACTAGTAGCAACATTGATATCAATGTTGCTACTAGTC0.268000.033900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1187-1209TGGACTAGTAGCAACATTGATGAAUCAAUGUUGCUACUAGUCCAGACUAGUAGCAACAUUGAUGAU20.518.833


Target Position: 3412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3412UGUAGAUGACUGGAUUAAA88.8535346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6753430TGTAGATGACTGGATTAAATTTAATCCAGTCATCTACA0.204400.012800.706900.750001.000001.00000


Target Position: 143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
143UCUGAAGAAGACACUUGAA85.2512618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
834161TCTGAAGAAGACACTTGAATTCAAGTGTCTTCTTCAGA0.108300.008700.551700.750001.000001.00000


Target Position: 3785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3785GCAGGAUAUGGUGCAGGUG70.15222340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8323803GCAGGATATGGTGCAGGTGCACCTGCACCATATCCTGC0.064500.010000.560300.750000.989100.62500


Target Position: 195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
195GGUGUGGCAAAAGGAAGAU75.77711601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
392213GGTGTGGCAAAAGGAAGATATCTTCCTTTTGCCACACC0.220700.056700.672401.000001.000001.00000


Target Position: 800, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
800GCAGAAAUGACCAUUUAUA96.337849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182818GCAGAAATGACCATTTATATATAAATGGTCATTTCTGC0.260100.119600.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
798-820TTGCAGAAATGACCATTTATATCUAUAAAUGGUCAUUUCUGCAAGCAGAAAUGACCAUUUAUAUCU-1.812.022


Target Position: 2002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2002UGAUGAAUAUGGUCCAGAA98.629520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9092020TGATGAATATGGTCCAGAATTCTGGACCATATTCATCA0.055400.006100.551700.750001.000001.00000


Target Position: 3664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3664CGACAAUGGAAGCGGAUAU83.8034735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7833682CGACAATGGAAGCGGATATATATCCGCTTCCATTGTCG0.072800.045800.750001.000001.000001.00000


Target Position: 2194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2194AAGCCAUCGGUAUCAGAUU76.98911463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9942212AAGCCATCGGTATCAGATTAATCTGATACCGATGGCTT0.086200.003900.629300.500001.000001.00000


Target Position: 4148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4148UGUUUAUAUUAUGUAAAAU82.1951893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9894166TGTTTATATTATGTAAAATATTTTACATAATATAAACA0.050200.004100.698300.750001.000001.00000


Target Position: 2675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2675GAGCUUGAUGCAUUAGAUG77.99441335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8382693GAGCTTGATGCATTAGATGCATCTAATGCATCAAGCTC0.064000.008700.655200.500000.978300.75000


Target Position: 642, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
642CUCUAGAAUCAGAAGAAGU81.6261954

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
640-662GACTCTAGAATCAGAAGAAGTGGACUUCUUCUGAUUCUAGAGUCCUCUAGAAUCAGAAGAAGUGGU19.120.222


Target Position: 1671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1671GAGGAAUCAGUCAUGUAAU92.5072156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9061689GAGGAATCAGTCATGTAATATTACATGACTGATTCCTC0.055700.034100.801700.750001.000001.00000


Target Position: 1578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1578GCGUUCGAUUUGAGUCUAU83.7156742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8881596GCGTTCGATTTGAGTCTATATAGACTCAAATCGAACGC0.057600.011200.879301.000001.000001.00000


Target Position: 855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
855AUGGAUCAAAUAAGAAAUU69.91952375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
752873ATGGATCAAATAAGAAATTAATTTCTTATTTGATCCAT0.188800.121700.646600.500001.000001.00000


Target Position: 3162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3162ACCCCAAUGUAUGCUAUCA80.78261038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9593180ACCCCAATGTATGCTATCATGATAGCATACATTGGGGT0.052300.004800.629300.500001.000001.00000


Target Position: 3422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3422UGGAUUAAACUGCAAAUAU78.19211314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5873440TGGATTAAACTGCAAATATATATTTGCAGTTTAATCCA0.108000.038200.801700.750001.000001.00000


Target Position: 2319, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2319GCAUUACCAUAAACGAUGU82.8412819

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2317-2339AAGCATTACCATAAACGATGTTGACAUCGUUUAUGGUAAUGCUUGCAUUACCAUAAACGAUGUUGU21.120.023


Target Position: 96, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
96GAGUCACACACGGUCCUAA96.011951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
688114GAGTCACACACGGTCCTAATTAGGACCGTGTGTGACTC0.095600.012100.775900.750001.000001.00000


Target Position: 2138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2138GGCUGGAAUCUGAUUUAUA101.4645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5132156GGCTGGAATCTGATTTATATATAAATCAGATTCCAGCC0.126700.027800.956901.000001.000001.00000


Target Position: 3651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3651AGAUGGCCCGAUACGACAA85.8456567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7223669AGATGGCCCGATACGACAATTGTCGTATCGGGCCATCT0.375000.018600.577600.750000.902200.75000


Target Position: 3667, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3667CAAUGGAAGCGGAUAUAGA95.112368

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3665-3687GACAATGGAAGCGGATATAGAAGUCUAUAUCCGCUUCCAUUGUCCAAUGGAAGCGGAUAUAGAAGU8.220.132


Target Position: 3036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3036UUCAGCUCAAAGAGAUUUU61.54363302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6813054TTCAGCTCAAAGAGATTTTAAAATCTCTTTGAGCTGAA0.104500.028700.672400.500001.000001.00000


Target Position: 730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730UCAGAAAGAAAAGAUCCAA79.38881197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
744748TCAGAAAGAAAAGATCCAATTGGATCTTTTCTTTCTGA0.238900.192000.577600.750001.000001.00000


Target Position: 3248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3248UGUCCUUUUAGUAGCCAAG62.6463193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8233266TGTCCTTTTAGTAGCCAAGCTTGGCTACTAAAAGGACA0.103500.014200.569000.500001.000001.00000


Target Position: 3215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3215CGUAAUGCACUUAUCCACA90.0985265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7673233CGTAATGCACTTATCCACATGTGGATAAGTGCATTACG0.429000.062500.569000.750000.989100.62500


Target Position: 597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
597UGAAGGAUUACUACUCAAG69.30612450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
803615TGAAGGATTACTACTCAAGCTTGAGTAGTAATCCTTCA0.069200.014800.586200.500001.000001.00000


Target Position: 1809, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1809GCAUGUUUUGUGAAUAUUU88.1837382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1831827GCATGTTTTGTGAATATTTAAATATTCACAAAACATGC0.259900.074400.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1807-1829CAGCATGTTTTGTGAATATTTCTAAAUAUUCACAAAACAUGCUGGCAUGUUUUGUGAAUAUUUCUU1.812.112


Target Position: 3232, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3232CAAAUCAUCUGUUAAUUGU81.863923

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3230-3252CACAAATCATCTGTTAATTGTCCACAAUUAACAGAUGAUUUGUGCAAAUCAUCUGUUAAUUGUCCU-1.47.232


Target Position: 1670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1670CGAGGAAUCAGUCAUGUAA98.936417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8391688CGAGGAATCAGTCATGTAATTACATGACTGATTCCTCG0.063900.040000.758601.000001.000001.00000


Target Position: 4186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4186ACCACAGUUUGUAUUUUUU77.5641398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7864204ACCACAGTTTGTATTTTTTAAAAAATACAAACTGTGGT0.071800.021100.853400.750001.000001.00000


Target Position: 601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
601GGAUUACUACUCAAGAAAG86.5475497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
539619GGATTACTACTCAAGAAAGCTTTCTTGAGTAGTAATCC0.119000.040700.732800.750001.000001.00000


Target Position: 343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
343UGCUGCCAGAGACUUUGUU66.02582839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
767361TGCTGCCAGAGACTTTGTTAACAAAGTCTCTGGCAGCA0.181000.009400.706900.750000.994601.00000


Target Position: 3353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3353CCCCUGCAGUUGCUUCUCU73.00961938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7783371CCCCTGCAGTTGCTTCTCTAGAGAAGCAACTGCAGGGG0.205100.009100.767200.750000.956501.00000


Target Position: 591, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
591CCAACUUGAAGGAUUACUA92.3046164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
436609CCAACTTGAAGGATTACTATAGTAATCCTTCAAGTTGG0.660900.025000.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
589-611AGCCAACTTGAAGGATTACTACTUAGUAAUCCUUCAAGUUGGCUCCAACUUGAAGGAUUACUACUU14.516.723


Target Position: 1958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1958GAUGGUGGUGAGGAUGAUG75.8141597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9271976GATGGTGGTGAGGATGATGCATCATCCTCACCACCATC0.073900.028800.525900.500001.000001.00000


Target Position: 3071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3071CCAGAAGAUUGUUUGUUGA89.6914290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8513089CCAGAAGATTGTTTGTTGATCAACAAACAATCTTCTGG0.098000.007100.620700.750001.000001.00000


Target Position: 278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
278CAGGUGGAAGGUUAUAAUU83.1197798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
275296CAGGTGGAAGGTTATAATTAATTATAACCTTCCACCTG0.274600.044100.775900.750001.000001.00000


Target Position: 3529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3529CCAGUUGGACCCCGUAAAU75.98331581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4353547CCAGTTGGACCCCGTAAATATTTACGGGGTCCAACTGG0.333700.025100.836201.000000.913000.62500


Target Position: 2622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2622CAAUUGAACCUCCCCCUUU78.62671280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7582640CAATTGAACCTCCCCCTTTAAAGGGGGAGGTTCAATTG0.075600.040900.646600.750001.000001.00000


Target Position: 600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
600AGGAUUACUACUCAAGAAA86.6336488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
665618AGGATTACTACTCAAGAAATTTCTTGAGTAGTAATCCT0.106900.036700.844800.750001.000001.00000


Target Position: 944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
944GGACUUACAAAGAAGAAGG72.25882054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
922962GGACTTACAAAGAAGAAGGCCTTCTTCTTTGTAAGTCC0.301900.123300.525900.500001.000001.00000


Target Position: 4175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4175CUCUUAAAAAUACCACAGU72.40922035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7634193CTCTTAAAAATACCACAGTACTGTGGTATTTTTAAGAG0.092700.062700.603400.500001.000001.00000


Target Position: 4065, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4065CACCAAAAAGUAAAUGCAU83.6924746

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4063-4085GCCACCAAAAAGTAAATGCATTTAUGCAUUUACUUUUUGGUGGCCACCAAAAAGUAAAUGCAUUUU20.018.812


Target Position: 2073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2073UCGAGGCUCUACUUAAGUA87.6882411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6662091TCGAGGCTCTACTTAAGTATACTTAAGTAGAGCCTCGA0.091500.013200.612100.750001.000001.00000


Target Position: 1321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1321GUUACUGCCUGUGAAGAAA87.9286397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8191339GTTACTGCCTGTGAAGAAATTTCTTCACAGGCAGTAAC0.150200.008000.646600.750001.000001.00000


Target Position: 429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
429CCCCACUUACUGAUACUCC63.88933062

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
909447CCCCACTTACTGATACTCCGGAGTATCAGTAAGTGGGG0.175300.042700.620700.500001.000001.00000


Target Position: 1273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1273CCAGUUGGAACAGGAUCAU74.18961791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3221291CCAGTTGGAACAGGATCATATGATCCTGTTCCAACTGG0.209000.040300.689701.000001.000001.00000


Target Position: 1926, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1926CAAAAGACAAAAAGAAGAA90.2925254

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1924-1946ACCAAAAGACAAAAAGAAGAAGGUUCUUCUUUUUGUCUUUUGGUCAAAAGACAAAAAGAAGAAGGU19.113.311


Target Position: 4004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4004AGACAGUAAGGAAAAAAAG73.12291923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8844022AGACAGTAAGGAAAAAAAGCTTTTTTTCCTTACTGTCT0.174900.096000.586200.500001.000001.00000


Target Position: 3967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3967CGGCUAUUAAAACUUGGUU77.80391363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9963985CGGCTATTAAAACTTGGTTAACCAAGTTTTAATAGCCG0.042300.010300.767201.000001.000001.00000


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778UGAUCACAACAGGAGCUUU78.73571269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
882796TGATCACAACAGGAGCTTTAAAGCTCCTGTTGTGATCA0.058300.022500.724100.750000.989100.75000


Target Position: 652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
652AGAAGAAGUGGAUUUAAAU89.0469331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
523670AGAAGAAGTGGATTTAAATATTTAAATCCACTTCTTCT0.283600.022100.715500.750001.000001.00000


Target Position: 2935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2935CUGGGAUGAUGCUAGAAUG80.14261120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9382953CTGGGATGATGCTAGAATGCATTCTAGCATCATCCCAG0.057300.005200.629300.500001.000001.00000


Target Position: 1901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1901CAGAUGACCCACUUUGUUC74.69181720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8461919CAGATGACCCACTTTGTTCGAACAAAGTGGGTCATCTG0.075100.015100.612100.500001.000001.00000


Target Position: 2561, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2561GAAAUUGCUCUUAGCAUAA93.431115

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2559-2581ATGAAATTGCTCTTAGCATAAAAUUAUGCUAAGAGCAAUUUCAUGAAAUUGCUCUUAGCAUAAAAU20.914.033


Target Position: 4025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4025AUGCUAUGUGUUACGUGUU73.73251846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9934043ATGCTATGTGTTACGTGTTAACACGTAACACATAGCAT0.081100.010000.508600.500001.000001.00000


Target Position: 849, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
849GAGAACAUGGAUCAAAUAA93.0117131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
556867GAGAACATGGATCAAATAATTATTTGATCCATGTTCTC0.414000.268700.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
847-869ACGAGAACATGGATCAAATAAGAUUAUUUGAUCCAUGUUCUCGUGAGAACAUGGAUCAAAUAAGAU8.919.232


Target Position: 1184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1184CCUUGGACUAGUAGCAACA87.0366454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8831202CCTTGGACTAGTAGCAACATGTTGCTACTAGTCCAAGG0.093400.006400.637900.750001.000001.00000


Target Position: 4225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4225CCUUUAAAUAACUUGGUAU86.5767494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7254243CCTTTAAATAACTTGGTATATACCAAGTTATTTAAAGG0.088100.010800.801701.000001.000001.00000


Target Position: 1465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1465AGCAGCAGAGUGUAACAUC71.01572234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7921483AGCAGCAGAGTGTAACATCGATGTTACACTCTGCTGCT0.235600.014100.672400.500001.000001.00000


Target Position: 3423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3423GGAUUAAACUGCAAAUAUC87.7599406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5673441GGATTAAACTGCAAATATCGATATTTGCAGTTTAATCC0.112300.048200.689700.750001.000001.00000


Target Position: 3280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3280AUCUCCCUUCUUUGUAUUU67.45842668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8403298ATCTCCCTTCTTTGTATTTAAATACAAAGAAGGGAGAT0.116100.043500.681000.500001.000001.00000


Target Position: 2982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2982GUGAGCACAAAAGACUUAA82.9349806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4923000GTGAGCACAAAAGACTTAATTAAGTCTTTTGTGCTCAC0.590900.052700.758600.750001.000001.00000


Target Position: 2287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2287GGUUAUUUUGUCCACAAAU86.9547459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3202305GGTTATTTTGTCCACAAATATTTGTGGACAAAATAACC0.249300.038900.844801.000001.000001.00000


Target Position: 4090, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4090CCAUUCUGUGGUUCAUUGU73.92451824

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4088-4110ACCCATTCTGTGGTTCATTGTAGACAAUGAACCACAGAAUGGGUCCAUUCUGUGGUUCAUUGUAGU13.818.113


Target Position: 369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
369UGGUUCGAAUAAAUGAAAU74.03061808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
317387TGGTTCGAATAAATGAAATATTTCATTTATTCGAACCA0.241800.038900.836200.750001.000001.00000


Target Position: 1272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1272ACCAGUUGGAACAGGAUCA76.82221483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9151290ACCAGTTGGAACAGGATCATGATCCTGTTCCAACTGGT0.203600.014500.629300.500000.978300.75000


Target Position: 2863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2863GGGCUAUAUCCAUCGAAAU88.6979352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6862881GGGCTATATCCATCGAAATATTTCGATGGATATAGCCC0.107900.012100.982801.000001.000001.00000


Target Position: 1818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1818GUGAAUAUUUCUUCAAUUG75.75391604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7311836GTGAATATTTCTTCAATTGCAATTGAAGAAATATTCAC0.100000.039300.646600.500000.923900.62500


Target Position: 1037, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1037GAGCUAAAUCUUGAGAUUU85.5152590

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1035-1057AAGAGCTAAATCTTGAGATTTTGAAAUCUCAAGAUUUAGCUCUUGAGCUAAAUCUUGAGAUUUUGU20.418.322


Target Position: 2637, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2637CUUUGGAUGCUGUGAUUGA86.5262500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2635-2657CCCTTTGGATGCTGTGATTGAAGUCAAUCACAGCAUCCAAAGGGCUUUGGAUGCUGUGAUUGAAGU20.520.122


Target Position: 2089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2089GUACAUUGAAACCCUUAAU81.6695949

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9702107GTACATTGAAACCCTTAATATTAAGGGTTTCAATGTAC0.046200.005900.672400.750001.000001.00000


Target Position: 1783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1783UCUUAUGUCUGCUACUAUU82.543845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6521801TCTTATGTCTGCTACTATTAATAGTAGCAGACATAAGA0.263300.056100.715500.750001.000001.00000


Target Position: 1579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1579CGUUCGAUUUGAGUCUAUA97.22536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8141597CGTTCGATTTGAGTCTATATATAGACTCAAATCGAACG0.067600.011500.732801.000001.000001.00000


Target Position: 4141, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4141GUGAUUUUGUUUAUAUUAU85.514591

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4139-4161TAGTGATTTTGTTTATATTATGTAUAAUAUAAACAAAAUCACUAGUGAUUUUGUUUAUAUUAUGUU-5.97.422


Target Position: 457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
457AGCAAAUGCUGAAGGAGAU81.6163955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
904475AGCAAATGCTGAAGGAGATATCTCCTTCAGCATTTGCT0.070800.006000.672400.750000.934800.62500


Target Position: 277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
277UCAGGUGGAAGGUUAUAAU77.50411407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
259295TCAGGTGGAAGGTTATAATATTATAACCTTCCACCTGA0.282700.046400.715500.750001.000001.00000


Target Position: 274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
274GGUUCAGGUGGAAGGUUAU88.3954373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
704292GGTTCAGGTGGAAGGTTATATAACCTTCCACCTGAACC0.157600.011600.810301.000001.000001.00000


Target Position: 1522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1522GGCAGAGCGAGUUGCAUUU80.38541093

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6911540GGCAGAGCGAGTTGCATTTAAATGCAACTCGCTCTGCC0.132700.012001.000001.000000.929300.62500


Target Position: 1768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1768UGAAGUUCGCAUUGUUCUU72.79921977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7551786TGAAGTTCGCATTGTTCTTAAGAACAATGCGAACTTCA0.259200.009800.586200.750001.000001.00000


Target Position: 140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
140UGAUCUGAAGAAGACACUU76.1781547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
939158TGATCTGAAGAAGACACTTAAGTGTCTTCTTCAGATCA0.126900.005200.586200.750000.983700.75000


Target Position: 2255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2255GUGUUUGAUCCAGUACCAG70.78782263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9842273GTGTTTGATCCAGTACCAGCTGGTACTGGATCAAACAC0.290800.013100.508600.500000.983700.62500


Target Position: 4187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4187CCACAGUUUGUAUUUUUUC68.93232494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7144205CCACAGTTTGTATTTTTTCGAAAAAATACAAACTGTGG0.081800.024100.672400.750001.000001.00000


Target Position: 3030, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3030CCAAAGUUCAGCUCAAAGA82.9678803

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6913048CCAAAGTTCAGCTCAAAGATCTTTGAGCTGAACTTTGG0.085900.038200.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3028-3050AGCCAAAGTTCAGCTCAAAGAGAUCUUUGAGCUGAACUUUGGCUCCAAAGUUCAGCUCAAAGAGAU16.610.322


Target Position: 2595, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2595GAGGAAUUGGCCAAUUUCU80.4111091

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2593-2615AGGAGGAATTGGCCAATTTCTGGAGAAAUUGGCCAAUUCCUCCUGAGGAAUUGGCCAAUUUCUGGU7.418.722


Target Position: 2074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2074CGAGGCUCUACUUAAGUAC72.84181971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232092CGAGGCTCTACTTAAGTACGTACTTAAGTAGAGCCTCG0.066600.013400.612100.750001.000001.00000


Target Position: 2523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2523CCCACAUGACACCAGAGAU86.2995524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7272541CCCACATGACACCAGAGATATCTCTGGTGTCATGTGGG0.079900.052100.810301.000001.000001.00000


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049GAGAUUUUGCCCCCGCCUG59.99313438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9231067GAGATTTTGCCCCCGCCTGCAGGCGGGGGCAAAATCTC0.308000.011800.525900.500000.913000.87500


Target Position: 3355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3355CCUGCAGUUGCUUCUCUUU80.49351083

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8363373CCTGCAGTTGCTTCTCTTTAAAGAGAAGCAACTGCAGG0.404000.007600.844801.000000.956500.87500


Target Position: 1503, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1503GAAUCAGUGCGGUUUCUGU87.8445402

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1501-1523AAGAATCAGTGCGGTTTCTGTGGACAGAAACCGCACUGAUUCUUGAAUCAGUGCGGUUUCUGUGGU19.219.233


Target Position: 1640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1640GUGCUCCUGAGAAAAUUAG66.75432739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9991658GTGCTCCTGAGAAAATTAGCTAATTTTCTCAGGAGCAC0.055000.003800.620700.500001.000001.00000


Target Position: 3242, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3242GUUAAUUGUCCUUUUAGUA91.1508210

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3240-3262CTGTTAATTGTCCTTTTAGTAGCUACUAAAAGGACAAUUAACAGGUUAAUUGUCCUUUUAGUAGCU4.9-1.422


Target Position: 2282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2282ACCAAGGUUAUUUUGUCCA70.72172269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9982300ACCAAGGTTATTTTGTCCATGGACAAAATAACCTTGGT0.154300.019000.508600.500001.000001.00000


Target Position: 3689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3689GGAGGUUCUAGUUACAGUG80.15761119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8933707GGAGGTTCTAGTTACAGTGCACTGTAACTAGAACCTCC0.103600.006300.577600.750001.000001.00000


Target Position: 3647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3647CCCAAGAUGGCCCGAUACG55.71253758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8753665CCCAAGATGGCCCGATACGCGTATCGGGCCATCTTGGG0.058900.017600.715500.500000.951100.62500


Target Position: 2389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2389CAACAAUAUGACCAACUAU94.095394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6632407CAACAATATGACCAACTATATAGTTGGTCATATTGTTG0.136900.110500.603400.750001.000001.00000


Target Position: 2344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2344UGUCAUUGACUCCUGCAAG68.27742569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8432362TGTCATTGACTCCTGCAAGCTTGCAGGAGTCAATGACA0.063300.044200.569000.500000.962000.62500


Target Position: 2956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2956UGGAGAAGAAGCAGAGAUA88.4599367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3972974TGGAGAAGAAGCAGAGATATATCTCTGCTTCTTCTCCA0.160000.107700.801700.750001.000001.00000


Target Position: 2547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2547GAACACCAUUGCAUGAAAU89.0221333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9182565GAACACCATTGCATGAAATATTTCATGCAATGGTGTTC0.054400.026600.663800.750001.000001.00000


Target Position: 1807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1807CAGCAUGUUUUGUGAAUAU90.8474233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321825CAGCATGTTTTGTGAATATATATTCACAAAACATGCTG0.226800.025600.741400.750001.000001.00000


Target Position: 1866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1866ACCCAGUUCAAGAAUAUUU74.66631726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8141884ACCCAGTTCAAGAATATTTAAATATTCTTGAACTGGGT0.253600.008100.853400.750001.000001.00000


Target Position: 2546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2546CGAACACCAUUGCAUGAAA96.971238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8472564CGAACACCATTGCATGAAATTTCATGCAATGGTGTTCG0.062700.040200.793101.000001.000001.00000


Target Position: 1286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1286GAUCAUGAUUUGCAAGCAA97.248135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8921304GATCATGATTTGCAAGCAATTGCTTGCAAATCATGATC0.134900.026300.534500.750001.000001.00000


Target Position: 1615, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1615CAGUAUAAUGUUUUGUACU85.6473583

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1613-1635GCCAGTATAATGTTTTGTACTGTAGUACAAAACAUUAUACUGGCCAGUAUAAUGUUUUGUACUGUU14.76.322


Target Position: 364, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
364CUAUUUGGUUCGAAUAAAU86.935460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
777382CTATTTGGTTCGAATAAATATTTATTCGAACCAAATAG0.399100.009100.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
362-384AACTATTTGGTTCGAATAAATGAAUUUAUUCGAACCAAAUAGUUCUAUUUGGUUCGAAUAAAUGAU2.112.822


Target Position: 2278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2278AGUAACCAAGGUUAUUUUG63.8793063

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9832296AGTAACCAAGGTTATTTTGCAAAATAACCTTGGTTACT0.066000.004300.560300.500001.000001.00000


Target Position: 853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
853ACAUGGAUCAAAUAAGAAA91.1428211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497871ACATGGATCAAATAAGAAATTTCTTATTTGATCCATGT0.421100.190700.706900.750001.000001.00000


Target Position: 3283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3283UCCCUUCUUUGUAUUUGGU62.44163212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583301TCCCTTCTTTGTATTTGGTACCAAATACAAAGAAGGGA0.052700.008300.517200.500001.000001.00000


Target Position: 847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
847ACGAGAACAUGGAUCAAAU87.3303440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
519865ACGAGAACATGGATCAAATATTTGATCCATGTTCTCGT0.346600.072500.767200.750001.000001.00000


Target Position: 2092, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2092CAUUGAAACCCUUAAUGUU90.3599252

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2090-2112TACATTGAAACCCTTAATGTTCCAACAUUAAGGGUUUCAAUGUACAUUGAAACCCUUAAUGUUCCU6.97.422


Target Position: 2006, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2006GAAUAUGGUCCAGAAACAA95.613862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9242024GAATATGGTCCAGAAACAATTGTTTCTGGACCATATTC0.231700.009500.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2004-2026ATGAATATGGTCCAGAAACAAGGUUGUUUCUGGACCAUAUUCAUGAAUAUGGUCCAGAAACAAGGU19.212.633


Target Position: 2621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2621GCAAUUGAACCUCCCCCUU71.30152203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5632639GCAATTGAACCTCCCCCTTAAGGGGGAGGTTCAATTGC0.113100.064800.715501.000001.000001.00000


Target Position: 4026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4026UGCUAUGUGUUACGUGUUU71.8522115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6834044TGCTATGTGTTACGTGTTTAAACACGTAACACATAGCA0.087400.014700.853400.750001.000001.00000


Target Position: 3190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3190GAGGAAGAUUCUCACCACU86.5935491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8063208GAGGAAGATTCTCACCACTAGTGGTGAGAATCTTCCTC0.097400.010900.603400.500000.989100.62500


Target Position: 1546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1546AGGAGAAGAGCCUGGAAAA89.2399320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6621564AGGAGAAGAGCCTGGAAAATTTTCCAGGCTCTTCTCCT0.091200.015700.844800.750001.000001.00000


Target Position: 1462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1462CCGAGCAGCAGAGUGUAAC63.01683155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9561480CCGAGCAGCAGAGTGTAACGTTACACTCTGCTGCTCGG0.048400.017700.767200.750001.000001.00000


Target Position: 4288, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4288CGAAAAAAAAAAAAAAAAA87.6012414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1874306CGAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTCG1.000000.059100.793101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4286-4308ACCGAAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUUCGGUCGAAAAAAAAAAAAAAAAAAAU-11.30.700


Target Position: 1317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1317GAGAGUUACUGCCUGUGAA100.20910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9311335GAGAGTTACTGCCTGTGAATTCACAGGCAGTAACTCTC0.051700.007100.637900.750001.000001.00000


Target Position: 4265, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4265CAAUAGAAAAUAAAGUAUU87.2554447

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4263-4285TACAATAGAAAATAAAGTATTACAAUACUUUAUUUUCUAUUGUACAAUAGAAAAUAAAGUAUUACU4.66.912


Target Position: 172, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
172CGUUAAAAAUUUUCUGUAU90.3538253

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
170-192GACGTTAAAAATTTTCTGTATGCAUACAGAAAAUUUUUAACGUCCGUUAAAAAUUUUCUGUAUGCU20.30.032


Target Position: 3165, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3165CCAAUGUAUGCUAUCAUAA94.351286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6333183CCAATGTATGCTATCATAATTATGATAGCATACATTGG0.098600.017500.810301.000000.978300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3163-3185CCCCAATGTATGCTATCATAAGGUUAUGAUAGCAUACAUUGGGGCCAAUGUAUGCUAUCAUAAGGU10.213.532


Target Position: 4205, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4205CUUUAAGGAGUAAAGAUUU81.7906934

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4203-4225TTCTTTAAGGAGTAAAGATTTGCAAAUCUUUACUCCUUAAAGAACUUUAAGGAGUAAAGAUUUGCU5.311.012


Target Position: 741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
741AGAUCCAAGGAGAAUAUAA94.707276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
313759AGATCCAAGGAGAATATAATTATATTCTCCTTGGATCT0.410200.106900.689700.750000.983700.75000


Target Position: 745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
745CCAAGGAGAAUAUAAGUAC76.5541512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
409763CCAAGGAGAATATAAGTACGTACTTATATTCTCCTTGG0.482900.142500.663800.750001.000001.00000


Target Position: 1664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1664GGCAUUCGAGGAAUCAGUC71.81012123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7981682GGCATTCGAGGAATCAGTCGACTGATTCCTCGAATGCC0.070300.067000.681000.750001.000001.00000


Target Position: 1528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1528GCGAGUUGCAUUUGAAAGA81.4108973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3711546GCGAGTTGCATTTGAAAGATCTTTCAAATGCAACTCGC0.169900.056400.698300.750001.000001.00000


Target Position: 134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
134GAAGGCUGAUCUGAAGAAG74.84421709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
923152GAAGGCTGATCTGAAGAAGCTTCTTCAGATCAGCCTTC0.056700.005700.534500.500001.000001.00000


Target Position: 1895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895UGCAUUCAGAUGACCCACU66.10932825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8971913TGCATTCAGATGACCCACTAGTGGGTCATCTGAATGCA0.161900.036600.646600.500001.000001.00000


Target Position: 1018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1018GCUGCAAAACAUCAUUCAA95.717757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6631036GCTGCAAAACATCATTCAATTGAATGATGTTTTGCAGC0.091000.033100.706901.000001.000001.00000


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975UGGAGCCUUACAAAGUAAA75.93781582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
636993TGGAGCCTTACAAAGTAAATTTACTTTGTAAGGCTCCA0.120200.039400.844800.750001.000001.00000


Target Position: 713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
713CGUCUAAACCAAUAUUUUC78.66151276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
673731CGTCTAAACCAATATTTTCGAAAATATTGGTTTAGACG0.130100.046400.603400.750001.000001.00000


Target Position: 640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
640GACUCUAGAAUCAGAAGAA100.7637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
807658GACTCTAGAATCAGAAGAATTCTTCTGATTCTAGAGTC0.080400.008300.646600.750000.929300.62500


Target Position: 3284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3284CCCUUCUUUGUAUUUGGUG61.32053326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9553302CCCTTCTTTGTATTTGGTGCACCAAATACAAAGAAGGG0.048400.008200.698300.750001.000001.00000


Target Position: 1650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1650GAAAAUUAGAAGCAGGCAU81.11011002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681668GAAAATTAGAAGCAGGCATATGCCTGCTTCTAATTTTC0.100600.047600.517200.750001.000001.00000


Target Position: 3528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3528GCCAGUUGGACCCCGUAAA79.34531198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6953546GCCAGTTGGACCCCGTAAATTTACGGGGTCCAACTGGC0.398900.011901.000001.000000.907600.75000


Target Position: 133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
133CGAAGGCUGAUCUGAAGAA92.9146133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
902151CGAAGGCTGATCTGAAGAATTCTTCAGATCAGCCTTCG0.062300.006100.620701.000001.000001.00000


Target Position: 2804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2804UGUACCAUUGCUGCUGCUA71.70042144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8872822TGTACCATTGCTGCTGCTATAGCAGCAGCAATGGTACA0.077000.032400.534500.750000.956500.75000


Target Position: 339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
339GCAAUGCUGCCAGAGACUU75.0461686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
961357GCAATGCTGCCAGAGACTTAAGTCTCTGGCAGCATTGC0.047800.010600.715501.000000.978300.62500


Target Position: 244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
244GAACAAAAACAGGCAGAAA94.676577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
361262GAACAAAAACAGGCAGAAATTTCTGCCTGTTTTTGTTC0.173700.149400.672400.750001.000001.00000


Target Position: 2864, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2864GGCUAUAUCCAUCGAAAUU86.4167515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5482882GGCTATATCCATCGAAATTAATTTCGATGGATATAGCC0.197200.018000.991401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2862-2884TGGGCTATATCCATCGAAATTTTAAUUUCGAUGGAUAUAGCCCAGGCUAUAUCCAUCGAAAUUUUU16.714.833


Target Position: 3424, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3424GAUUAAACUGCAAAUAUCU89.2714318

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3422-3444TGGATTAAACTGCAAATATCTCAAGAUAUUUGCAGUUUAAUCCAGAUUAAACUGCAAAUAUCUCAU1.8-0.322


Target Position: 1464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1464GAGCAGCAGAGUGUAACAU83.4819766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8071482GAGCAGCAGAGTGTAACATATGTTACACTCTGCTGCTC0.068600.014600.655200.750001.000001.00000


Target Position: 3214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3214GCGUAAUGCACUUAUCCAC75.34251656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5963232GCGTAATGCACTTATCCACGTGGATAAGTGCATTACGC0.377700.052000.629300.750001.000001.00000


Target Position: 2908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2908CGUAGCCCUUUUAUCAGUA90.1995260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6762926CGTAGCCCTTTTATCAGTATACTGATAAAAGGGCTACG0.115800.040200.594801.000001.000001.00000


Target Position: 1798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1798UAUUGAUACCAGCAUGUUU81.09371003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8921816TATTGATACCAGCATGTTTAAACATGCTGGTATCAATA0.057000.018600.543100.500001.000001.00000


Target Position: 1469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1469GCAGAGUGUAACAUCGUAG79.81841154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5531487GCAGAGTGTAACATCGTAGCTACGATGTTACACTCTGC0.311700.017800.681000.750001.000001.00000


Target Position: 2574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2574GCAUAAAACUUCUGCGUCU86.6508486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8852592GCATAAAACTTCTGCGTCTAGACGCAGAAGTTTTATGC0.058100.011600.629300.750000.967400.62500


Target Position: 1322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1322UUACUGCCUGUGAAGAAAU69.81482385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9301340TTACTGCCTGTGAAGAAATATTTCTTCACAGGCAGTAA0.185200.008000.525900.500001.000001.00000


Target Position: 1816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1816UUGUGAAUAUUUCUUCAAU77.80531361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9871834TTGTGAATATTTCTTCAATATTGAAGAAATATTCACAA0.098600.037900.637900.500000.923900.62500


Target Position: 3230, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3230CACAAAUCAUCUGUUAAUU83.1943791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3623248CACAAATCATCTGTTAATTAATTAACAGATGATTTGTG0.173000.129100.784500.750000.951100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3228-3250TCCACAAATCATCTGTTAATTGTAAUUAACAGAUGAUUUGUGGACACAAAUCAUCUGUUAAUUGUU6.914.833


Target Position: 1669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1669UCGAGGAAUCAGUCAUGUA87.6453412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7961687TCGAGGAATCAGTCATGTATACATGACTGATTCCTCGA0.070700.044900.612100.750001.000001.00000


Target Position: 1775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1775CGCAUUGUUCUUAUGUCUG71.34762196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211793CGCATTGTTCTTATGTCTGCAGACATAAGAACAATGCG0.140800.046700.637900.750001.000001.00000


Target Position: 2955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2955GUGGAGAAGAAGCAGAGAU82.209890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6352973GTGGAGAAGAAGCAGAGATATCTCTGCTTCTTCTCCAC0.160000.114300.612100.750001.000001.00000


Target Position: 1674, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1674GAAUCAGUCAUGUAAUUGU89.902278

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1672-1694AGGAATCAGTCATGTAATTGTAGACAAUUACAUGACUGAUUCCUGAAUCAGUCAUGUAAUUGUAGU6.919.222


Target Position: 3968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3968GGCUAUUAAAACUUGGUUA92.7239143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573986GGCTATTAAAACTTGGTTATAACCAAGTTTTAATAGCC0.048400.018400.965501.000001.000001.00000


Target Position: 1328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1328CCUGUGAAGAAAUUUGAAA87.458426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551346CCTGTGAAGAAATTTGAAATTTCAAATTTCTTCACAGG0.253900.023000.844801.000001.000001.00000


Target Position: 1782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1782UUCUUAUGUCUGCUACUAU78.39361297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7071800TTCTTATGTCTGCTACTATATAGTAGCAGACATAAGAA0.230400.066800.629300.500001.000001.00000


Target Position: 1697, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1697GAAAUACAUGAAAGAGAUA98.366523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7491715GAAATACATGAAAGAGATATATCTCTTTCATGTATTTC0.203400.010000.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1695-1717ATGAAATACATGAAAGAGATATTUAUCUCUUUCAUGUAUUUCAUGAAAUACAUGAAAGAGAUAUUU19.16.922


Target Position: 1860, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1860GGACUUACCCAGUUCAAGA94.473681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9401878GGACTTACCCAGTTCAAGATCTTGAACTGGGTAAGTCC0.129300.005200.646600.750000.983700.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1858-1880GAGGACTTACCCAGTTCAAGAATUCUUGAACUGGGUAAGUCCUCGGACUUACCCAGUUCAAGAAUU19.221.423


Target Position: 1282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1282ACAGGAUCAUGAUUUGCAA92.7762140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7921300ACAGGATCATGATTTGCAATTGCAAATCATGATCCTGT0.114100.032300.560300.750001.000001.00000


Target Position: 3236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3236UCAUCUGUUAAUUGUCCUU71.76512137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7133254TCATCTGTTAATTGTCCTTAAGGACAATTAACAGATGA0.359100.111400.586200.750001.000001.00000


Target Position: 97, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
97AGUCACACACGGUCCUAAG71.372190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
945115AGTCACACACGGTCCTAAGCTTAGGACCGTGTGTGACT0.050100.013400.569000.500001.000001.00000


Target Position: 2003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2003GAUGAAUAUGGUCCAGAAA95.685759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992021GATGAATATGGTCCAGAAATTTCTGGACCATATTCATC0.065700.006100.681000.750001.000001.00000


Target Position: 2996, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2996CUUAAUAUGGCUACACUAA91.0197222

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2994-3016GACTTAATATGGCTACACTAAGAUUAGUGUAGCCAUAUUAAGUCCUUAAUAUGGCUACACUAAGAU20.2-8.033


Target Position: 3276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3276ACCCAUCUCCCUUCUUUGU64.0453044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8073294ACCCATCTCCCTTCTTTGTACAAAGAAGGGAGATGGGT0.146700.038300.646600.500001.000001.00000


Target Position: 2309, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2309GCUGAAACAAGCAUUACCA90.0855267

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2307-2329TTGCTGAAACAAGCATTACCATAUGGUAAUGCUUGUUUCAGCAAGCUGAAACAAGCAUUACCAUAU20.019.233


Target Position: 428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
428CCCCCACUUACUGAUACUC62.81643175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
760446CCCCCACTTACTGATACTCGAGTATCAGTAAGTGGGGG0.225700.009700.681000.750001.000001.00000


Target Position: 3379, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3379CAAGAAAGUCCAAUCUGAU92.8988135

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3377-3399TCCAAGAAAGTCCAATCTGATGGAUCAGAUUGGACUUUCUUGGACAAGAAAGUCCAAUCUGAUGGU20.410.321


Target Position: 3364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3364GCUUCUCUUUGCCUCCAAG76.14421553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6013382GCTTCTCTTTGCCTCCAAGCTTGGAGGCAAAGAGAAGC0.104600.046100.715500.750000.994600.62500


Target Position: 1474, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1474GUGUAACAUCGUAGUAACU84.4323687

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1472-1494GAGTGTAACATCGTAGTAACTCAAGUUACUACGAUGUUACACUCGUGUAACAUCGUAGUAACUCAU14.320.433


Target Position: 1867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1867CCCAGUUCAAGAAUAUUUU78.19521312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7741885CCCAGTTCAAGAATATTTTAAAATATTCTTGAACTGGG0.084200.009300.991401.000001.000001.00000


Target Position: 4149, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4149GUUUAUAUUAUGUAAAAUA97.437132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9244167GTTTATATTATGTAAAATATATTTTACATAATATAAAC0.058200.005700.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4147-4169TTGTTTATATTATGTAAAATATAUAUUUUACAUAAUAUAAACAAGUUUAUAUUAUGUAAAAUAUAU-0.3-8.012


Target Position: 3034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3034AGUUCAGCUCAAAGAGAUU83.7807737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6133052AGTTCAGCTCAAAGAGATTAATCTCTTTGAGCTGAACT0.103300.024800.698300.750001.000001.00000


Target Position: 3548, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3548GAACGUAUGCUGAACAUGA96.886640

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3546-3568ATGAACGTATGCTGAACATGATCUCAUGUUCAGCAUACGUUCAUGAACGUAUGCUGAACAUGAUCU20.514.933


Target Position: 1117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1117CGAACCAUCUCAGCGACAA87.3314439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961135CGAACCATCTCAGCGACAATTGTCGCTGAGATGGTTCG0.162000.053800.646601.000000.962000.75000


Target Position: 1283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1283CAGGAUCAUGAUUUGCAAG76.09461561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9721301CAGGATCATGATTTGCAAGCTTGCAAATCATGATCCTG0.111000.029900.646600.500001.000001.00000


Target Position: 2901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2901CUGAUCACGUAGCCCUUUU72.91191958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5322919CTGATCACGTAGCCCTTTTAAAAGGGCTACGTGATCAG0.171400.058000.784500.750001.000001.00000


Target Position: 1771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1771AGUUCGCAUUGUUCUUAUG73.81041838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9781789AGTTCGCATTGTTCTTATGCATAAGAACAATGCGAACT0.222600.009100.551700.500001.000001.00000


Target Position: 2945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2945GCUAGAAUGGGUGGAGAAG69.50082422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4552963GCTAGAATGGGTGGAGAAGCTTCTCCACCCATTCTAGC0.331900.051800.715500.750001.000001.00000


Target Position: 1696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1696UGAAAUACAUGAAAGAGAU83.9158729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8771714TGAAATACATGAAAGAGATATCTCTTTCATGTATTTCA0.106700.010000.543100.750001.000001.00000


Target Position: 1660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1660AGCAGGCAUUCGAGGAAUC65.2922923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9031678AGCAGGCATTCGAGGAATCGATTCCTCGAATGCCTGCT0.239700.028000.672400.500001.000001.00000


Target Position: 2076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2076AGGCUCUACUUAAGUACAU79.89641145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6662094AGGCTCTACTTAAGTACATATGTACTTAAGTAGAGCCT0.090000.022100.689700.750001.000001.00000


Target Position: 1309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1309GCAGGAGAGAGAGUUACUG73.25321900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8521327GCAGGAGAGAGAGTTACTGCAGTAACTCTCTCTCCTGC0.070100.007100.569000.750001.000001.00000


Target Position: 516, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
516CUCUCAAAGCAGAAAAUAA97.385333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
812534CTCTCAAAGCAGAAAATAATTATTTTCTGCTTTGAGAG0.068000.015300.775900.750000.918500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
514-536GGCTCTCAAAGCAGAAAATAATTUUAUUUUCUGCUUUGAGAGCCCUCUCAAAGCAGAAAAUAAUUU2.120.421


Target Position: 1932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1932ACAAAAAGAAGAAGGAUAA85.7728574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3911950ACAAAAAGAAGAAGGATAATTATCCTTCTTCTTTTTGT0.314800.226900.672400.750001.000001.00000


Target Position: 1921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1921UCCACCAAAAGACAAAAAG52.91553936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9621939TCCACCAAAAGACAAAAAGCTTTTTGTCTTTTGGTGGA0.669700.515200.732800.500001.000001.00000


Target Position: 233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
233AGAGCAGUGGGGAACAAAA90.2863256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
925251AGAGCAGTGGGGAACAAAATTTTGTTCCCCACTGCTCT0.053500.029500.724100.750001.000001.00000


Target Position: 3035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3035GUUCAGCUCAAAGAGAUUU74.47011750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5823053GTTCAGCTCAAAGAGATTTAAATCTCTTTGAGCTGAAC0.108600.023800.646600.750001.000001.00000


Target Position: 697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
697GGAAAAUGCUAAAGCUCGU81.9222918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
677715GGAAAATGCTAAAGCTCGTACGAGCTTTAGCATTTTCC0.088900.019100.594800.750000.983701.00000


Target Position: 1769, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1769GAAGUUCGCAUUGUUCUUA86.8752466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7281787GAAGTTCGCATTGTTCTTATAAGAACAATGCGAACTTC0.230000.010800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1767-1789CTGAAGTTCGCATTGTTCTTATGUAAGAACAAUGCGAACUUCAGGAAGUUCGCAUUGUUCUUAUGU19.219.722


Target Position: 3041, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3041CUCAAAGAGAUUUUGAUUA84.7485665

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3039-3061AGCTCAAAGAGATTTTGATTAATUAAUCAAAAUCUCUUUGAGCUCUCAAAGAGAUUUUGAUUAAUU7.420.412


Target Position: 308, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
308GGAAAUUCCACCAAUAAAA92.7276142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
247326GGAAATTCCACCAATAAAATTTTATTGGTGGAATTTCC0.234700.047600.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
306-328TGGGAAATTCCACCAATAAAAAAUUUUAUUGGUGGAAUUUCCCAGGAAAUUCCACCAAUAAAAAAU-1.410.422


Target Position: 3070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3070UCCAGAAGAUUGUUUGUUG68.17582581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9343088TCCAGAAGATTGTTTGTTGCAACAAACAATCTTCTGGA0.089000.005400.724100.500001.000001.00000


Target Position: 3170, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3170GUAUGCUAUCAUAAGGAAA93.3175121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5263188GTATGCTATCATAAGGAAATTTCCTTATGATAGCATAC0.123200.031500.681000.750000.978300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3168-3190ATGTATGCTATCATAAGGAAAAGUUUCCUUAUGAUAGCAUACAUGUAUGCUAUCAUAAGGAAAAGU19.920.933


Target Position: 3410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3410CUUGUAGAUGACUGGAUUA92.4193159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7803428CTTGTAGATGACTGGATTATAATCCAGTCATCTACAAG0.257900.009000.603400.750001.000001.00000


Target Position: 1808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1808AGCAUGUUUUGUGAAUAUU76.08021563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241826AGCATGTTTTGTGAATATTAATATTCACAAAACATGCT0.233300.038600.844800.750001.000001.00000


Target Position: 2748, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2748CUCGUUUUGGCAAAAUGAU73.061931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7352766CTCGTTTTGGCAAAATGATATCATTTTGCCAAAACGAG0.146400.010500.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2746-2768GCCTCGTTTTGGCAAAATGATGAAUCAUUUUGCCAAAACGAGGCCUCGUUUUGGCAAAAUGAUGAU7.415.333


Target Position: 974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
974GUGGAGCCUUACAAAGUAA94.017395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
556992GTGGAGCCTTACAAAGTAATTACTTTGTAAGGCTCCAC0.115700.045200.758600.750001.000001.00000


Target Position: 2938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2938GGAUGAUGCUAGAAUGGGU92.3369161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9562956GGATGATGCTAGAATGGGTACCCATTCTAGCATCATCC0.085400.007700.517200.750001.000001.00000


Target Position: 2716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2716GGGACGAAUCCUGGCUAAA86.114531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3142734GGGACGAATCCTGGCTAAATTTAGCCAGGATTCGTCCC0.193600.050700.991401.000000.934800.62500


Target Position: 222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
222CCUAUGAAAUUAGAGCAGU74.70971718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
560240CCTATGAAATTAGAGCAGTACTGCTCTAATTTCATAGG0.114000.032300.637900.750001.000001.00000


Target Position: 3171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3171UAUGCUAUCAUAAGGAAAA82.3888865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8573189TATGCTATCATAAGGAAAATTTTCCTTATGATAGCATA0.136200.036800.543100.500001.000001.00000


Target Position: 362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
362AACUAUUUGGUUCGAAUAA81.434971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
921380AACTATTTGGTTCGAATAATTATTCGAACCAAATAGTT0.167300.005700.612100.500001.000001.00000


Target Position: 1016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1016CAGCUGCAAAACAUCAUUC72.22872059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811034CAGCTGCAAAACATCATTCGAATGATGTTTTGCAGCTG0.088700.004300.612100.500001.000001.00000


Target Position: 3251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3251CCUUUUAGUAGCCAAGACA86.3304521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7333269CCTTTTAGTAGCCAAGACATGTCTTGGCTACTAAAAGG0.079000.064000.637900.750001.000001.00000


Target Position: 1527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1527AGCGAGUUGCAUUUGAAAG66.94382719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7361545AGCGAGTTGCATTTGAAAGCTTTCAAATGCAACTCGCT0.246100.089100.715500.500000.978300.75000


Target Position: 4257, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4257GUUUAAUACAAUAGAAAAU85.6217587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6264275GTTTAATACAATAGAAAATATTTTCTATTGTATTAAAC0.335800.020400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4255-4277TCGTTTAATACAATAGAAAATAAAUUUUCUAUUGUAUUAAACGAGUUUAAUACAAUAGAAAAUAAU7.1-7.531


Target Position: 2081, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2081CUACUUAAGUACAUUGAAA97.572931

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2079-2101CTCTACTTAAGTACATTGAAACCUUUCAAUGUACUUAAGUAGAGCUACUUAAGUACAUUGAAACCU13.86.632


Target Position: 309, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
309GAAAUUCCACCAAUAAAAA93.1109126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
580327GAAATTCCACCAATAAAAATTTTTATTGGTGGAATTTC0.719900.061600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
307-329GGGAAATTCCACCAATAAAAAAGUUUUUAUUGGUGGAAUUUCCCGAAAUUCCACCAAUAAAAAAGU-9.714.221


Target Position: 3213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3213GGCGUAAUGCACUUAUCCA94.779175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4353231GGCGTAATGCACTTATCCATGGATAAGTGCATTACGCC0.356800.035500.655200.750000.983700.62500


Target Position: 1186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1186UUGGACUAGUAGCAACAUU69.55112418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7321204TTGGACTAGTAGCAACATTAATGTTGCTACTAGTCCAA0.094300.014300.637900.500001.000001.00000


Target Position: 3228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3228UCCACAAAUCAUCUGUUAA83.3469782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5583246TCCACAAATCATCTGTTAATTAACAGATGATTTGTGGA0.246500.173200.836200.750000.951100.75000


Target Position: 1930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1930AGACAAAAAGAAGAAGGAU80.78951035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8611948AGACAAAAAGAAGAAGGATATCCTTCTTCTTTTTGTCT0.291900.172400.543100.750001.000001.00000


Target Position: 1279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1279GGAACAGGAUCAUGAUUUG84.4331686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8961297GGAACAGGATCATGATTTGCAAATCATGATCCTGTTCC0.056700.025300.724100.750001.000001.00000


Target Position: 1318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1318AGAGUUACUGCCUGUGAAG72.41952033

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9311336AGAGTTACTGCCTGTGAAGCTTCACAGGCAGTAACTCT0.056200.007100.586200.500001.000001.00000


Target Position: 4192, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4192GUUUGUAUUUUUUCUUUAA93.5801109

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4190-4212CAGTTTGTATTTTTTCTTTAAGGUUAAAGAAAAAAUACAAACUGGUUUGUAUUUUUUCUUUAAGGU7.16.911


Target Position: 3420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3420ACUGGAUUAAACUGCAAAU79.05381234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4043438ACTGGATTAAACTGCAAATATTTGCAGTTTAATCCAGT0.226000.027900.698300.750001.000001.00000


Target Position: 3824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3824GUUUCCCGAGGUGGCUUUA73.17331914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9783842GTTTCCCGAGGTGGCTTTATAAAGCCACCTCGGGAAAC0.044700.004500.612100.750000.967401.00000


Target Position: 1896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1896GCAUUCAGAUGACCCACUU82.9235808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4271914GCATTCAGATGACCCACTTAAGTGGGTCATCTGAATGC0.149900.059600.715501.000001.000001.00000


Target Position: 3285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3285CCUUCUUUGUAUUUGGUGA85.4437599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9473303CCTTCTTTGTATTTGGTGATCACCAAATACAAAGAAGG0.049700.009200.620700.750001.000001.00000


Target Position: 2249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2249CGCAAAGUGUUUGAUCCAG70.26132325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9002267CGCAAAGTGTTTGATCCAGCTGGATCAAACACTTTGCG0.056500.009800.637900.750001.000001.00000


Target Position: 1577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1577AGCGUUCGAUUUGAGUCUA80.97681013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9071595AGCGTTCGATTTGAGTCTATAGACTCAAATCGAACGCT0.055600.011100.681000.750001.000001.00000


Target Position: 2135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2135CCUGGCUGGAAUCUGAUUU71.33252198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8712153CCTGGCTGGAATCTGATTTAAATCAGATTCCAGCCAGG0.120400.006700.844801.000001.000001.00000


Target Position: 2068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2068ACUCAUCGAGGCUCUACUU78.25371311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9122086ACTCATCGAGGCTCTACTTAAGTAGAGCCTCGATGAGT0.156800.005900.569000.750000.994600.62500


Target Position: 2648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2648GUGAUUGAAGCAGAACACA82.337868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8462666GTGATTGAAGCAGAACACATGTGTTCTGCTTCAATCAC0.080000.007300.586200.500001.000001.00000


Target Position: 2173, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2173GGAAAUGAAUCCACAUUUU89.3791312

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2171-2193TTGGAAATGAATCCACATTTTGGAAAAUGUGGAUUCAUUUCCAAGGAAAUGAAUCCACAUUUUGGU12.116.322


Target Position: 1678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1678CAGUCAUGUAAUUGUAGAU92.9335132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9011696CAGTCATGTAATTGTAGATATCTACAATTACATGACTG0.106700.006100.603400.750001.000001.00000


Target Position: 4041, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4041GUUUUUUCCAGUAUGUUUA85.4733596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6454059GTTTTTTCCAGTATGTTTATAAACATACTGGAAAAAAC0.133100.014800.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4039-4061GTGTTTTTTCCAGTATGTTTATTUAAACAUACUGGAAAAAACACGUUUUUUCCAGUAUGUUUAUUU6.90.712


Target Position: 2934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2934CCUGGGAUGAUGCUAGAAU81.3577980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932952CCTGGGATGATGCTAGAATATTCTAGCATCATCCCAGG0.043200.008500.836201.000001.000001.00000


Target Position: 3999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3999UGUGUAGACAGUAAGGAAA84.7389668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3544017TGTGTAGACAGTAAGGAAATTTCCTTACTGTCTACACA0.245500.039500.706900.750001.000001.00000


Target Position: 2933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2933GCCUGGGAUGAUGCUAGAA86.0706534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732951GCCTGGGATGATGCTAGAATTCTAGCATCATCCCAGGC0.046000.005100.827601.000001.000001.00000


Target Position: 1336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1336GAAAUUUGAAAGUGAGAUU84.9391646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8011354GAAATTTGAAAGTGAGATTAATCTCACTTTCAAATTTC0.069700.033500.663800.750001.000001.00000


Target Position: 306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
306UGGGAAAUUCCACCAAUAA82.6098839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
511324TGGGAAATTCCACCAATAATTATTGGTGGAATTTCCCA0.163800.019600.810300.750000.934800.62500


Target Position: 942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
942CCGGACUUACAAAGAAGAA84.8206658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
187960CCGGACTTACAAAGAAGAATTCTTCTTTGTAAGTCCGG0.383600.069100.741401.000001.000001.00000


Target Position: 3688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3688GGGAGGUUCUAGUUACAGU89.4111309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8383706GGGAGGTTCTAGTTACAGTACTGTAACTAGAACCTCCC0.107900.007500.784500.750001.000001.00000


Target Position: 2139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2139GCUGGAAUCUGAUUUAUAC85.3601610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5392157GCTGGAATCTGATTTATACGTATAAATCAGATTCCAGC0.140400.018400.672400.750001.000001.00000


Target Position: 3938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3938GGCUACUUUGGACAGGGAA84.0411718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5303956GGCTACTTTGGACAGGGAATTCCCTGTCCAAAGTAGCC0.522900.018800.827601.000001.000001.00000


Target Position: 2136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2136CUGGCUGGAAUCUGAUUUA86.4408508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8862154CTGGCTGGAATCTGATTTATAAATCAGATTCCAGCCAG0.133500.006400.750000.750001.000001.00000


Target Position: 158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
158UGAAUCAUGGGUGACGUUA73.37291884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
410176TGAATCATGGGTGACGTTATAACGTCACCCATGATTCA0.155700.050400.689700.750000.972800.87500


Target Position: 368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
368UUGGUUCGAAUAAAUGAAA71.42362182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
942386TTGGTTCGAATAAATGAAATTTCATTTATTCGAACCAA0.223000.026600.646600.500001.000001.00000


Target Position: 3527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3527AGCCAGUUGGACCCCGUAA76.85651479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8003545AGCCAGTTGGACCCCGTAATTACGGGGTCCAACTGGCT0.396900.008500.819000.750000.907600.75000


Target Position: 372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
372UUCGAAUAAAUGAAAUAAA77.55011399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
719390TTCGAATAAATGAAATAAATTTATTTCATTTATTCGAA0.135500.073700.672400.500001.000001.00000


Target Position: 638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
638GCGACUCUAGAAUCAGAAG76.40241523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
808656GCGACTCTAGAATCAGAAGCTTCTGATTCTAGAGTCGC0.105800.008300.784500.750000.929300.62500


Target Position: 1015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1015UCAGCUGCAAAACAUCAUU69.3452441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9601033TCAGCTGCAAAACATCATTAATGATGTTTTGCAGCTGA0.103500.004800.715500.750001.000001.00000


Target Position: 2985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2985AGCACAAAAGACUUAAUAU89.0511330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3103003AGCACAAAAGACTTAATATATATTAAGTCTTTTGTGCT0.194900.068700.810300.750001.000001.00000


Target Position: 619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
619GGAAGAACAAGAAGUGCAA95.666860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
429637GGAAGAACAAGAAGTGCAATTGCACTTCTTGTTCTTCC0.149600.137200.724101.000001.000001.00000


Target Position: 935, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
935GCUUACUCCGGACUUACAA86.0607536

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
933-955AAGCTTACTCCGGACTTACAAAGUUGUAAGUCCGGAGUAAGCUUGCUUACUCCGGACUUACAAAGU19.018.933


Target Position: 2903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2903GAUCACGUAGCCCUUUUAU81.3591979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5282921GATCACGTAGCCCTTTTATATAAAAGGGCTACGTGATC0.227200.067900.637900.750001.000001.00000


Target Position: 610, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
610CUCAAGAAAGGAAGAACAA85.6317586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
413628CTCAAGAAAGGAAGAACAATTGTTCTTCCTTTCTTGAG0.460000.051800.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
608-630TACTCAAGAAAGGAAGAACAAGAUUGUUCUUCCUUUCUUGAGUACUCAAGAAAGGAAGAACAAGAU19.220.422


Target Position: 837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
837GGAUUUUUGCACGAGAACA88.0302394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
839855GGATTTTTGCACGAGAACATGTTCTCGTGCAAAAATCC0.118500.007500.663800.750000.978300.62500


Target Position: 163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
163CAUGGGUGACGUUAAAAAU88.1392386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
477181CATGGGTGACGTTAAAAATATTTTTAACGTCACCCATG0.259600.028000.646600.750001.000001.00000


Target Position: 902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
902GUCAGACAACUGUACCAUC77.46531410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
919920GTCAGACAACTGTACCATCGATGGTACAGTTGTCTGAC0.054300.028300.637900.500000.929300.75000


Target Position: 1897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1897CAUUCAGAUGACCCACUUU88.3599375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671915CATTCAGATGACCCACTTTAAAGTGGGTCATCTGAATG0.138500.023300.655200.750001.000001.00000


Target Position: 1767, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1767CUGAAGUUCGCAUUGUUCU73.2431904

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1765-1787TCCTGAAGTTCGCATTGTTCTTAAGAACAAUGCGAACUUCAGGACUGAAGUUCGCAUUGUUCUUAU14.819.232


Target Position: 1471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1471AGAGUGUAACAUCGUAGUA90.4615248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8721489AGAGTGTAACATCGTAGTATACTACGATGTTACACTCT0.331900.036900.543100.750001.000001.00000


Target Position: 2909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2909GUAGCCCUUUUAUCAGUAU82.4939856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6182927GTAGCCCTTTTATCAGTATATACTGATAAAAGGGCTAC0.103100.042700.637900.750001.000001.00000


Target Position: 2195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2195AGCCAUCGGUAUCAGAUUC67.28632686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7462213AGCCATCGGTATCAGATTCGAATCTGATACCGATGGCT0.892400.013600.681000.500001.000001.00000


Target Position: 4260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4260UAAUACAAUAGAAAAUAAA85.9794550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9754278TAATACAATAGAAAATAAATTTATTTTCTATTGTATTA0.355400.011500.534500.500001.000001.00000


Target Position: 464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
464GCUGAAGGAGAUUUACCAA95.616461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
295482GCTGAAGGAGATTTACCAATTGGTAAATCTCCTTCAGC0.461100.040800.706901.000000.994600.75000


Target Position: 1888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1888GGAAGACUGCAUUCAGAUG82.2121888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711906GGAAGACTGCATTCAGATGCATCTGAATGCAGTCTTCC0.212400.021600.715500.750000.967400.87500


Target Position: 1153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1153UCCUUGGUCACCUCCACAA74.44621755

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7511171TCCTTGGTCACCTCCACAATTGTGGAGGTGACCAAGGA0.137300.009900.724100.750000.923900.87500


Target Position: 740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
740AAGAUCCAAGGAGAAUAUA79.59381174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
742758AAGATCCAAGGAGAATATATATATTCTCCTTGGATCTT0.279200.100000.594800.500000.983700.75000


Target Position: 272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
272GAGGUUCAGGUGGAAGGUU75.35051654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
716290GAGGTTCAGGTGGAAGGTTAACCTTCCACCTGAACCTC0.081600.013800.663800.750001.000001.00000


Target Position: 4246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4246UCCUGGCUUUCGUUUAAUA81.7779938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5904264TCCTGGCTTTCGTTTAATATATTAAACGAAAGCCAGGA0.218700.015900.827600.750001.000001.00000


Target Position: 646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
646AGAAUCAGAAGAAGUGGAU76.32091530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
985664AGAATCAGAAGAAGTGGATATCCACTTCTTCTGATTCT0.044100.018000.543100.750001.000001.00000


Target Position: 2375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2375CUCUUCACUGCUCACAACA79.9321139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8622393CTCTTCACTGCTCACAACATGTTGTGAGCAGTGAAGAG0.195100.039500.603400.500001.000001.00000


Target Position: 3351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3351CCCCCCUGCAGUUGCUUCU62.05053252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6773369CCCCCCTGCAGTTGCTTCTAGAAGCAACTGCAGGGGGG0.281400.012700.767200.750000.956501.00000


Target Position: 1922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1922CCACCAAAAGACAAAAAGA89.5361301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6211940CCACCAAAAGACAAAAAGATCTTTTTGTCTTTTGGTGG0.681200.520900.620700.750001.000001.00000


Target Position: 1278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1278UGGAACAGGAUCAUGAUUU70.41032308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8781296TGGAACAGGATCATGATTTAAATCATGATCCTGTTCCA0.058800.031100.844800.750001.000001.00000


Target Position: 970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
970GACAGUGGAGCCUUACAAA97.796928

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
542988GACAGTGGAGCCTTACAAATTTGTAAGGCTCCACTGTC0.241100.018300.819000.750000.951100.62500


Target Position: 777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777CUGAUCACAACAGGAGCUU65.18362932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
913795CTGATCACAACAGGAGCTTAAGCTCCTGTTGTGATCAG0.054800.017500.646600.750000.989100.62500


Target Position: 3536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3536GACCCCGUAAAUGAACGUA80.56051066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5203554GACCCCGTAAATGAACGTATACGTTCATTTACGGGGTC0.174100.085200.637900.750000.907600.75000


Target Position: 3656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3656GCCCGAUACGACAAUGGAA92.303165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4893674GCCCGATACGACAATGGAATTCCATTGTCGTATCGGGC0.133300.021200.827601.000000.945700.62500


Target Position: 459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
459CAAAUGCUGAAGGAGAUUU76.14881552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
703477CAAATGCTGAAGGAGATTTAAATCTCCTTCAGCATTTG0.084600.011900.646600.750001.000001.00000


Target Position: 791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791AGCUUUAUUGCAGAAAUGA77.8371356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
864809AGCTTTATTGCAGAAATGATCATTTCTGCAATAAAGCT0.198500.013800.629300.500000.962000.75000


Target Position: 2250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2250GCAAAGUGUUUGAUCCAGU82.4467861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8562268GCAAAGTGTTTGATCCAGTACTGGATCAAACACTTTGC0.061700.012100.646600.750001.000001.00000


Target Position: 2567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2567GCUCUUAGCAUAAAACUUC72.97881947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9362585GCTCTTAGCATAAAACTTCGAAGTTTTATGCTAAGAGC0.354900.005300.681000.750000.983700.75000


Target Position: 1358, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1358GAAGCAAUCAGCCAAAAUU87.4404430

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1356-1378TGGAAGCAATCAGCCAAAATTCAAAUUUUGGCUGAUUGCUUCCAGAAGCAAUCAGCCAAAAUUCAU11.318.512


Target Position: 1535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1535GCAUUUGAAAGAGGAGAAG66.92062725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3441553GCATTTGAAAGAGGAGAAGCTTCTCCTCTTTCAAATGC0.179000.076500.715500.750001.000001.00000


Target Position: 2747, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2747CCUCGUUUUGGCAAAAUGA82.7578824

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2745-2767AGCCTCGTTTTGGCAAAATGATGUCAUUUUGCCAAAACGAGGCUCCUCGUUUUGGCAAAAUGAUGU4.219.732


Target Position: 2511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2511AGAGACUUGAAACCCACAU71.91142109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7602529AGAGACTTGAAACCCACATATGTGGGTTTCAAGTCTCT0.212400.021400.569000.750000.951100.62500


Target Position: 2248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2248GCGCAAAGUGUUUGAUCCA87.1468451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9972266GCGCAAAGTGTTTGATCCATGGATCAAACACTTTGCGC0.042200.008000.577600.750001.000001.00000


Target Position: 168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
168GUGACGUUAAAAAUUUUCU73.7891843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
992186GTGACGTTAAAAATTTTCTAGAAAATTTTTAACGTCAC0.043200.019700.569000.500001.000001.00000


Target Position: 212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
212AUGACCCCAUCCUAUGAAA80.44411088

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
843230ATGACCCCATCCTATGAAATTTCATAGGATGGGGTCAT0.084700.042100.655200.500001.000001.00000


Target Position: 3279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3279CAUCUCCCUUCUUUGUAUU80.55281069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6553297CATCTCCCTTCTTTGTATTAATACAAAGAAGGGAGATG0.157900.034600.646600.750001.000001.00000


Target Position: 2336, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2336GUUGUUUAUGUCAUUGACU78.79041263

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2334-2356ATGTTGTTTATGTCATTGACTCCAGUCAAUGACAUAAACAACAUGUUGUUUAUGUCAUUGACUCCU20.57.222


Target Position: 98, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
98GUCACACACGGUCCUAAGA81.6481950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
998116GTCACACACGGTCCTAAGATCTTAGGACCGTGTGTGAC0.042100.011600.594800.500001.000001.00000


Target Position: 4247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4247CCUGGCUUUCGUUUAAUAC68.04812593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5734265CCTGGCTTTCGTTTAATACGTATTAAACGAAAGCCAGG0.178400.016800.663800.750001.000001.00000


Target Position: 95, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
95AGAGUCACACACGGUCCUA82.5411846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
828113AGAGTCACACACGGTCCTATAGGACCGTGTGTGACTCT0.105300.012800.551700.750001.000001.00000


Target Position: 159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
159GAAUCAUGGGUGACGUUAA99.218714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
543177GAATCATGGGTGACGTTAATTAACGTCACCCATGATTC0.191600.056800.637900.750000.972800.75000


Target Position: 3418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3418UGACUGGAUUAAACUGCAA85.6519582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7293436TGACTGGATTAAACTGCAATTGCAGTTTAATCCAGTCA0.233000.021000.577600.750001.000001.00000


Target Position: 3721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3721CGGUGGCUAUAGCAGUGGA89.6666292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8973739CGGTGGCTATAGCAGTGGATCCACTGCTATAGCCACCG0.088500.006200.543100.750001.000001.00000


Target Position: 3298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3298UGGUGAAAAGAUUCGAACU75.03071688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8463316TGGTGAAAAGATTCGAACTAGTTCGAATCTTTTCACCA0.062900.010000.637900.500000.978301.00000


Target Position: 4132, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4132GAUGCAUUAGUGAUUUUGU85.4414601

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4130-4152TAGATGCATTAGTGATTTTGTTTACAAAAUCACUAAUGCAUCUAGAUGCAUUAGUGAUUUUGUUUU7.419.923


Target Position: 2749, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2749UCGUUUUGGCAAAAUGAUG58.25453573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7252767TCGTTTTGGCAAAATGATGCATCATTTTGCCAAAACGA0.154500.021800.637900.500001.000001.00000


Target Position: 4055, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4055GUUUAUUUGCCACCAAAAA83.9679725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4894073GTTTATTTGCCACCAAAAATTTTTGGTGGCAAATAAAC0.411300.030000.646600.750000.956500.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4053-4075ATGTTTATTTGCCACCAAAAAGTUUUUUGGUGGCAAAUAAACAUGUUUAUUUGCCACCAAAAAGUU18.8-9.721


Target Position: 345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
345CUGCCAGAGACUUUGUUAA88.0532392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
908363CTGCCAGAGACTTTGTTAATTAACAAAGTCTCTGGCAG0.171800.006000.750000.750000.994600.75000


Target Position: 2316, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2316CAAGCAUUACCAUAAACGA88.94337

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2314-2336AACAAGCATTACCATAAACGATGUCGUUUAUGGUAAUGCUUGUUCAAGCAUUACCAUAAACGAUGU6.918.522


Target Position: 192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
192CCUGGUGUGGCAAAAGGAA84.0684715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
415210CCTGGTGTGGCAAAAGGAATTCCTTTTGCCACACCAGG0.159100.027200.672401.000001.000001.00000


Target Position: 702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
702AUGCUAAAGCUCGUCUAAA81.8918921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
960720ATGCTAAAGCTCGTCTAAATTTAGACGAGCTTTAGCAT0.311000.056500.655200.500000.983700.75000


Target Position: 1182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1182AUCCUUGGACUAGUAGCAA76.89251476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8951200ATCCTTGGACTAGTAGCAATTGCTACTAGTCCAAGGAT0.111500.006200.534500.500000.983700.62500


Target Position: 2717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2717GGACGAAUCCUGGCUAAAC76.02751572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4832735GGACGAATCCTGGCTAAACGTTTAGCCAGGATTCGTCC0.254600.079700.724100.750000.978300.62500


Target Position: 4126, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4126CAUAUAGAUGCAUUAGUGA93.1983124

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4124-4146AGCATATAGATGCATTAGTGATTUCACUAAUGCAUCUAUAUGCUCAUAUAGAUGCAUUAGUGAUUU11.68.232


Target Position: 2900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2900UCUGAUCACGUAGCCCUUU62.29813227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5612918TCTGATCACGTAGCCCTTTAAAGGGCTACGTGATCAGA0.171400.017800.724100.750001.000001.00000


Target Position: 518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
518CUCAAAGCAGAAAAUAAUU78.25491310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
616536CTCAAAGCAGAAAATAATTAATTATTTTCTGCTTTGAG0.122700.014900.801700.750001.000001.00000


Target Position: 2912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2912GCCCUUUUAUCAGUAUUCC63.01083157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8722930GCCCTTTTATCAGTATTCCGGAATACTGATAAAAGGGC0.059200.054900.629300.500001.000001.00000


Target Position: 144, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
144CUGAAGAAGACACUUGAAU77.54751400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
647162CTGAAGAAGACACTTGAATATTCAAGTGTCTTCTTCAG0.095100.076800.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
142-164ATCTGAAGAAGACACTTGAATCAAUUCAAGUGUCUUCUUCAGAUCUGAAGAAGACACUUGAAUCAU19.220.422


Target Position: 2793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2793GAGAUGCUAUCUGUACCAU88.1316389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7972811GAGATGCTATCTGTACCATATGGTACAGATAGCATCTC0.339700.008600.655200.750001.000001.00000


Target Position: 1324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1324ACUGCCUGUGAAGAAAUUU68.40632549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3251342ACTGCCTGTGAAGAAATTTAAATTTCTTCACAGGCAGT0.261800.051900.706900.750001.000001.00000


Target Position: 4177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4177CUUAAAAAUACCACAGUUU79.1881222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6374195CTTAAAAATACCACAGTTTAAACTGTGGTATTTTTAAG0.842700.051800.637900.750001.000001.00000


Target Position: 1923, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1923CACCAAAAGACAAAAAGAA91.422200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6151941CACCAAAAGACAAAAAGAATTCTTTTTGTCTTTTGGTG0.710500.535800.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1921-1943TCCACCAAAAGACAAAAAGAAGAUUCUUUUUGUCUUUUGGUGGACACCAAAAGACAAAAAGAAGAU5.518.822


Target Position: 283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
283GGAAGGUUAUAAUUACACU93.0913128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
543301GGAAGGTTATAATTACACTAGTGTAATTATAACCTTCC0.289700.018200.663800.750001.000001.00000


Target Position: 4238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4238UGGUAUUUUCCUGGCUUUC53.22263910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9584256TGGTATTTTCCTGGCTTTCGAAAGCCAGGAAAATACCA0.061400.008600.672400.500000.972800.75000


Target Position: 1470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1470CAGAGUGUAACAUCGUAGU78.98651241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8891488CAGAGTGTAACATCGTAGTACTACGATGTTACACTCTG0.320700.027400.577600.500001.000001.00000


Target Position: 4255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4255UCGUUUAAUACAAUAGAAA81.5196960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4174273TCGTTTAATACAATAGAAATTTCTATTGTATTAAACGA0.329700.026800.793100.750001.000001.00000


Target Position: 1691, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1691GUAGAUGAAAUACAUGAAA90.1325264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9201709GTAGATGAAATACATGAAATTTCATGTATTTCATCTAC0.054200.027400.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1689-1711TTGTAGATGAAATACATGAAAGAUUUCAUGUAUUUCAUCUACAAGUAGAUGAAAUACAUGAAAGAU20.521.422


Target Position: 4097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4097GUGGUUCAUUGUAGUUUAA91.6837187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8804115GTGGTTCATTGTAGTTTAATTAAACTACAATGAACCAC0.140100.006500.758600.750001.000001.00000


Target Position: 3675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3675GCGGAUAUAGAAGGGGAGG54.70753826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8423693GCGGATATAGAAGGGGAGGCCTCCCCTTCTATATCCGC0.112300.019000.577600.500001.000001.00000


Target Position: 2954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2954GGUGGAGAAGAAGCAGAGA86.5464498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5742972GGTGGAGAAGAAGCAGAGATCTCTGCTTCTTCTCCACC0.180100.122200.629300.750001.000001.00000


Target Position: 2967, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2967CAGAGAUACGUUUUUGUGA88.8586345

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2965-2987AGCAGAGATACGTTTTTGTGAGCUCACAAAAACGUAUCUCUGCUCAGAGAUACGUUUUUGUGAGCU12.220.222


Target Position: 307, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
307GGGAAAUUCCACCAAUAAA95.772556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
358325GGGAAATTCCACCAATAAATTTATTGGTGGAATTTCCC0.211600.033900.991401.000000.967400.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
305-327ATGGGAAATTCCACCAATAAAAAUUUAUUGGUGGAAUUUCCCAUGGGAAAUUCCACCAAUAAAAAU12.814.233


Target Position: 3222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3222CACUUAUCCACAAAUCAUC74.20241789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7163240CACTTATCCACAAATCATCGATGATTTGTGGATAAGTG0.531200.322700.612100.500001.000001.00000


Target Position: 1021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1021GCAAAACAUCAUUCAAGAG79.31721203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8761039GCAAAACATCATTCAAGAGCTCTTGAATGATGTTTTGC0.075200.018600.543100.750001.000001.00000


Target Position: 138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
138GCUGAUCUGAAGAAGACAC74.2481783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
941156GCTGATCTGAAGAAGACACGTGTCTTCTTCAGATCAGC0.146300.005200.560300.750000.983700.75000


Target Position: 634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
634GCAAGCGACUCUAGAAUCA88.7733350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
729652GCAAGCGACTCTAGAATCATGATTCTAGAGTCGCTTGC0.079800.010900.629300.750000.972800.62500


Target Position: 1862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1862ACUUACCCAGUUCAAGAAU69.78642388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8491880ACTTACCCAGTTCAAGAATATTCTTGAACTGGGTAAGT0.147900.007200.698300.750001.000001.00000


Target Position: 1609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1609UCAUGCCAGUAUAAUGUUU74.00721815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9951627TCATGCCAGTATAATGTTTAAACATTATACTGGCATGA0.042700.004900.724100.750001.000001.00000


Target Position: 2792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2792GGAGAUGCUAUCUGUACCA92.5291155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9682810GGAGATGCTATCTGTACCATGGTACAGATAGCATCTCC0.333000.004600.525900.750001.000001.00000


Target Position: 1933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1933CAAAAAGAAGAAGGAUAAG71.71942140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9971951CAAAAAGAAGAAGGATAAGCTTATCCTTCTTCTTTTTG0.288800.208200.508600.500001.000001.00000


Target Position: 4143, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4143GAUUUUGUUUAUAUUAUGU86.8291469

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4141-4163GTGATTTTGTTTATATTATGTAAACAUAAUAUAAACAAAAUCACGAUUUUGUUUAUAUUAUGUAAU0.05.322


Target Position: 3278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3278CCAUCUCCCUUCUUUGUAU88.114390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4483296CCATCTCCCTTCTTTGTATATACAAAGAAGGGAGATGG0.142800.038900.801701.000001.000001.00000


Target Position: 4285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4285CACCGAAAAAAAAAAAAAA88.0283395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8124303CACCGAAAAAAAAAAAAAATTTTTTTTTTTTTTCGGTG1.000000.008100.793100.750001.000001.00000


Target Position: 1861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1861GACUUACCCAGUUCAAGAA94.147591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8961879GACTTACCCAGTTCAAGAATTCTTGAACTGGGTAAGTC0.140900.006200.646600.750000.983700.62500


Target Position: 4188, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4188CACAGUUUGUAUUUUUUCU82.515851

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4186-4208ACCACAGTTTGTATTTTTTCTTTAGAAAAAAUACAAACUGUGGUCACAGUUUGUAUUUUUUCUUUU0.717.832


Target Position: 3646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3646UCCCAAGAUGGCCCGAUAC53.29583906

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8373664TCCCAAGATGGCCCGATACGTATCGGGCCATCTTGGGA0.064100.021400.689700.500000.951100.75000


Target Position: 989, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
989GUAAACCUCUCUCAAGAUU78.65621277

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
987-1009AAGTAAACCTCTCTCAAGATTTAAAUCUUGAGAGAGGUUUACUUGUAAACCUCUCUCAAGAUUUAU20.418.622


Target Position: 2685, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2685CAUUAGAUGCCAAUGAUGA91.1593209

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2683-2705TGCATTAGATGCCAATGATGAGTUCAUCAUUGGCAUCUAAUGCACAUUAGAUGCCAAUGAUGAGUU13.66.623


Target Position: 1681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1681UCAUGUAAUUGUAGAUGAA92.4496157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8401699TCATGTAATTGTAGATGAATTCATCTACAATTACATGA0.127000.008600.551700.750001.000001.00000


Target Position: 2470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2470GCCUGGAUUCUGCUUUCAC72.62762003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9702488GCCTGGATTCTGCTTTCACGTGAAAGCAGAATCCAGGC0.056900.004600.706900.750001.000001.00000


Target Position: 3237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3237CAUCUGUUAAUUGUCCUUU76.25371537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4423255CATCTGTTAATTGTCCTTTAAAGGACAATTAACAGATG0.223700.117400.655200.750001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051GAUUUUGCCCCCGCCUGAA79.31581204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9881069GATTTTGCCCCCGCCTGAATTCAGGCGGGGGCAAAATC0.187200.016500.508600.750000.913001.00000


Target Position: 1432, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1432GUUCAUUCUAGAUGACUUU82.2222887

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1430-1452CAGTTCATTCTAGATGACTTTATAAAGUCAUCUAGAAUGAACUGGUUCAUUCUAGAUGACUUUAUU19.216.332


Target Position: 2312, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2312GAAACAAGCAUUACCAUAA97.644729

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2310-2332CTGAAACAAGCATTACCATAAACUUAUGGUAAUGCUUGUUUCAGGAAACAAGCAUUACCAUAAACU21.110.332


Target Position: 2137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2137UGGCUGGAAUCUGAUUUAU73.20081910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5872155TGGCTGGAATCTGATTTATATAAATCAGATTCCAGCCA0.124400.016000.801700.750001.000001.00000


Target Position: 4054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4054UGUUUAUUUGCCACCAAAA82.2391886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4254072TGTTTATTTGCCACCAAAATTTTGGTGGCAAATAAACA0.413100.032700.706900.750000.956500.62500


Target Position: 2894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2894AGAUUUUCUGAUCACGUAG71.9422103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9462912AGATTTTCTGATCACGTAGCTACGTGATCAGAAAATCT0.304000.040600.551700.500001.000001.00000


Target Position: 647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
647GAAUCAGAAGAAGUGGAUU86.0883532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
942665GAATCAGAAGAAGTGGATTAATCCACTTCTTCTGATTC0.050300.015500.663800.750001.000001.00000


Target Position: 1547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1547GGAGAAGAGCCUGGAAAAA89.1112327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5311565GGAGAAGAGCCTGGAAAAATTTTTCCAGGCTCTTCTCC0.143600.018800.870701.000001.000001.00000


Target Position: 1525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1525AGAGCGAGUUGCAUUUGAA96.658446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8191543AGAGCGAGTTGCATTTGAATTCAAATGCAACTCGCTCT0.150900.016800.551700.750000.978300.87500


Target Position: 2116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2116AGCUGUGUUGGUUUUUUUG67.08392705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9812134AGCTGTGTTGGTTTTTTTGCAAAAAAACCAACACAGCT0.044300.028600.706900.500001.000001.00000


Target Position: 2545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2545CCGAACACCAUUGCAUGAA75.89911588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5762563CCGAACACCATTGCATGAATTCATGCAATGGTGTTCGG0.109800.063000.741401.000001.000001.00000


Target Position: 2290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2290UAUUUUGUCCACAAAUAUU78.36081302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8842308TATTTTGTCCACAAATATTAATATTTGTGGACAAAATA0.140200.027400.534500.500001.000001.00000


Target Position: 1908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1908CCCACUUUGUUCCUCCACC59.9693441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9221926CCCACTTTGTTCCTCCACCGGTGGAGGAACAAAGTGGG0.142600.025800.637900.500001.000001.00000


Target Position: 3535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3535GGACCCCGUAAAUGAACGU71.8122122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6843553GGACCCCGTAAATGAACGTACGTTCATTTACGGGGTCC0.171300.087300.594800.750000.907600.62500


Target Position: 1287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1287AUCAUGAUUUGCAAGCAAU77.71781375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621305ATCATGATTTGCAAGCAATATTGCTTGCAAATCATGAT0.060800.008700.672400.500001.000001.00000


Target Position: 2058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2058CUCCUUUUGAACUCAUCGA77.16521440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9602076CTCCTTTTGAACTCATCGATCGATGAGTTCAAAAGGAG0.075500.008000.517200.500001.000001.00000


Target Position: 1463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1463CGAGCAGCAGAGUGUAACA96.245350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6931481CGAGCAGCAGAGTGTAACATGTTACACTCTGCTGCTCG0.110700.020900.586200.750001.000001.00000


Target Position: 2715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2715UGGGACGAAUCCUGGCUAA77.33331422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6512733TGGGACGAATCCTGGCTAATTAGCCAGGATTCGTCCCA0.162600.014300.810300.750000.934800.75000


Target Position: 1672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1672AGGAAUCAGUCAUGUAAUU82.0943903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8331690AGGAATCAGTCATGTAATTAATTACATGACTGATTCCT0.064300.028000.836200.750001.000001.00000


Target Position: 2279, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2279GUAACCAAGGUUAUUUUGU70.11222345

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2277-2299GAGTAACCAAGGTTATTTTGTCCACAAAAUAACCUUGGUUACUCGUAACCAAGGUUAUUUUGUCCU-1.420.022


Target Position: 1472, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1472GAGUGUAACAUCGUAGUAA98.305124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3901490GAGTGTAACATCGTAGTAATTACTACGATGTTACACTC0.176900.050200.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1470-1492CAGAGTGTAACATCGTAGTAACTUUACUACGAUGUUACACUCUGGAGUGUAACAUCGUAGUAACUU20.819.033


Target Position: 1188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1188GGACUAGUAGCAACAUUGA93.954298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5271206GGACTAGTAGCAACATTGATCAATGTTGCTACTAGTCC0.122700.047200.646600.750001.000001.00000


Target Position: 1027, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1027CAUCAUUCAAGAGCUAAAU80.18521116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9881045CATCATTCAAGAGCTAAATATTTAGCTCTTGAATGATG0.043800.010300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1025-1047AACATCATTCAAGAGCTAAATCTAUUUAGCUCUUGAAUGAUGUUCAUCAUUCAAGAGCUAAAUCUU18.316.221


Target Position: 744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
744UCCAAGGAGAAUAUAAGUA78.06721328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
438762TCCAAGGAGAATATAAGTATACTTATATTCTCCTTGGA0.485600.143300.689700.750001.000001.00000


Target Position: 651, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
651CAGAAGAAGUGGAUUUAAA98.841118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
493669CAGAAGAAGTGGATTTAAATTTAAATCCACTTCTTCTG0.337100.020400.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
649-671ATCAGAAGAAGTGGATTTAAATGUUUAAAUCCACUUCUUCUGAUCAGAAGAAGUGGAUUUAAAUGU2.119.122


Target Position: 1682, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682CAUGUAAUUGUAGAUGAAA93.4092117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6361700CATGTAATTGTAGATGAAATTTCATCTACAATTACATG0.136800.014100.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1680-1702GTCATGTAATTGTAGATGAAATAUUUCAUCUACAAUUACAUGACCAUGUAAUUGUAGAUGAAAUAU20.46.721


Target Position: 722, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
722CAAUAUUUUCAGAAAGAAA99.082515

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
720-742ACCAATATTTTCAGAAAGAAAAGUUUCUUUCUGAAAAUAUUGGUCAAUAUUUUCAGAAAGAAAAGU14.8-10.321


Target Position: 2914, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2914CCUUUUAUCAGUAUUCCAA91.0975215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8742932CCTTTTATCAGTATTCCAATTGGAATACTGATAAAAGG0.058900.041900.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2912-2934GCCCTTTTATCAGTATTCCAAGCUUGGAAUACUGAUAAAAGGGCCCUUUUAUCAGUAUUCCAAGCU21.2-4.333


Target Position: 3610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3610GAUUGGCAGUACACGGUAU91.6447189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8313628GATTGGCAGTACACGGTATATACCGTGTACTGCCAATC0.117700.007700.637900.750001.000001.00000


Target Position: 196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
196GUGUGGCAAAAGGAAGAUG66.70732745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
808214GTGTGGCAAAAGGAAGATGCATCTTCCTTTTGCCACAC0.224300.066800.637900.500001.000001.00000


Target Position: 1253, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1253CUCAAGAAUGAAUUGAUGU75.4881636

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1251-1273ACCTCAAGAATGAATTGATGTACACAUCAAUUCAUUCUUGAGGUCUCAAGAAUGAAUUGAUGUACU13.620.422


Target Position: 363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
363ACUAUUUGGUUCGAAUAAA82.6278834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
822381ACTATTTGGTTCGAATAAATTTATTCGAACCAAATAGT0.149600.007900.706900.750001.000001.00000


Target Position: 4289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4289GAAAAAAAAAAAAAAAAAA89.0835328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4334307GAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTC1.000000.245600.672400.750001.000001.00000


Target Position: 246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
246ACAAAAACAGGCAGAAAUU76.69191498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
687264ACAAAAACAGGCAGAAATTAATTTCTGCCTGTTTTTGT0.086800.081800.698300.750001.000001.00000


Target Position: 4135, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4135GCAUUAGUGAUUUUGUUUA91.31205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9754153GCATTAGTGATTTTGTTTATAAACAAAATCACTAATGC0.045200.033100.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4133-4155ATGCATTAGTGATTTTGTTTATAUAAACAAAAUCACUAAUGCAUGCAUUAGUGAUUUUGUUUAUAU5.611.622


Target Position: 234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
234GAGCAGUGGGGAACAAAAA91.0465220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
375252GAGCAGTGGGGAACAAAAATTTTTGTTCCCCACTGCTC0.484500.031200.810300.750001.000001.00000


Target Position: 4185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4185UACCACAGUUUGUAUUUUU75.04361687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7264203TACCACAGTTTGTATTTTTAAAAATACAAACTGTGGTA0.079900.022800.681000.500001.000001.00000


Target Position: 1887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1887UGGAAGACUGCAUUCAGAU77.94031340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6701905TGGAAGACTGCATTCAGATATCTGAATGCAGTCTTCCA0.177900.013100.663800.750000.967400.75000


Target Position: 3648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3648CCAAGAUGGCCCGAUACGA79.11271226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8333666CCAAGATGGCCCGATACGATCGTATCGGGCCATCTTGG0.104100.020100.551700.750000.978300.62500


Target Position: 4245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4245UUCCUGGCUUUCGUUUAAU60.70663382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7544263TTCCTGGCTTTCGTTTAATATTAAACGAAAGCCAGGAA0.192100.009800.663800.500001.000001.00000


Target Position: 2984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2984GAGCACAAAAGACUUAAUA90.6242242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4983002GAGCACAAAAGACTTAATATATTAAGTCTTTTGTGCTC0.572300.073500.767200.750001.000001.00000


Target Position: 705, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
705CUAAAGCUCGUCUAAACCA81.7875936

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
703-725TGCTAAAGCTCGTCTAAACCAATUGGUUUAGACGAGCUUUAGCACUAAAGCUCGUCUAAACCAAUU18.618.333


Target Position: 4091, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4091CAUUCUGUGGUUCAUUGUA91.6939186

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4089-4111CCCATTCTGTGGTTCATTGTAGTUACAAUGAACCACAGAAUGGGCAUUCUGUGGUUCAUUGUAGUU20.519.223


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737GAAAAGAUCCAAGGAGAAU82.8509818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
405755GAAAAGATCCAAGGAGAATATTCTCCTTGGATCTTTTC0.158800.069100.663800.750001.000001.00000


Target Position: 351, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
351GAGACUUUGUUAACUAUUU88.2056380

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
349-371CAGAGACTTTGTTAACTATTTGGAAAUAGUUAACAAAGUCUCUGGAGACUUUGUUAACUAUUUGGU4.617.733


Target Position: 259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
259GAAAUUCAUGUGUGAGGUU84.8079661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
936277GAAATTCATGTGTGAGGTTAACCTCACACATGAATTTC0.074400.011000.525900.750001.000001.00000


Target Position: 4251, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4251GCUUUCGUUUAAUACAAUA91.9803178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4424269GCTTTCGTTTAATACAATATATTGTATTAAACGAAAGC0.146200.074000.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4249-4271TGGCTTTCGTTTAATACAATAGAUAUUGUAUUAAACGAAAGCCAGCUUUCGUUUAAUACAAUAGAU6.719.733


Target Position: 4214, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4214GUAAAGAUUUGCCUUUAAA92.7002144

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4212-4234GAGTAAAGATTTGCCTTTAAATAUUUAAAGGCAAAUCUUUACUCGUAAAGAUUUGCCUUUAAAUAU11.06.922


Target Position: 3040, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3040GCUCAAAGAGAUUUUGAUU87.3114444

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3038-3060CAGCTCAAAGAGATTTTGATTAAAAUCAAAAUCUCUUUGAGCUGGCUCAAAGAGAUUUUGAUUAAU7.416.622


Target Position: 423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
423CUCCGCCCCCACUUACUGA74.61791730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
868441CTCCGCCCCCACTTACTGATCAGTAAGTGGGGGCGGAG0.427800.047900.586200.500001.000001.00000


Target Position: 1523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1523GCAGAGCGAGUUGCAUUUG66.2852795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6781541GCAGAGCGAGTTGCATTTGCAAATGCAACTCGCTCTGC0.133000.012700.706900.750000.972800.62500


Target Position: 506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
506CCACAUCUGGCUCUCAAAG69.91772376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
813524CCACATCTGGCTCTCAAAGCTTTGAGAGCCAGATGTGG0.154900.008100.706900.750000.940200.62500


Target Position: 4001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4001UGUAGACAGUAAGGAAAAA85.2784617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2474019TGTAGACAGTAAGGAAAAATTTTTCCTTACTGTCTACA0.243200.119000.706900.750001.000001.00000


Target Position: 3221, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3221GCACUUAUCCACAAAUCAU92.1592172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3063239GCACTTATCCACAAATCATATGATTTGTGGATAAGTGC0.607700.343000.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3219-3241ATGCACTTATCCACAAATCATCTAUGAUUUGUGGAUAAGUGCAUGCACUUAUCCACAAAUCAUCUU13.811.632


Target Position: 2325, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2325CCAUAAACGAUGUUGUUUA92.7281141

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2323-2345TACCATAAACGATGTTGTTTATGUAAACAACAUCGUUUAUGGUACCAUAAACGAUGUUGUUUAUGU13.36.921


Target Position: 431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
431CCACUUACUGAUACUCCUG74.34471768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
798449CCACTTACTGATACTCCTGCAGGAGTATCAGTAAGTGG0.236300.167500.560300.750001.000001.00000


Target Position: 3299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3299GGUGAAAAGAUUCGAACUC70.46412298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9053317GGTGAAAAGATTCGAACTCGAGTTCGAATCTTTTCACC0.056100.038800.543100.750000.978300.87500


Target Position: 430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
430CCCACUUACUGAUACUCCU81.4894963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
616448CCCACTTACTGATACTCCTAGGAGTATCAGTAAGTGGG0.249700.119500.646600.750001.000001.00000


Target Position: 4190, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4190CAGUUUGUAUUUUUUCUUU84.9618644

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4188-4210CACAGTTTGTATTTTTTCTTTAAAAAGAAAAAAUACAAACUGUGCAGUUUGUAUUUUUUCUUUAAU5.517.822


Target Position: 383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
383GAAAUAAAGAGUGAAGAAG75.07331682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
879401GAAATAAAGAGTGAAGAAGCTTCTTCACTCTTTATTTC0.123200.046100.534500.500001.000001.00000


Target Position: 216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
216CCCCAUCCUAUGAAAUUAG70.03152357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
656234CCCCATCCTATGAAATTAGCTAATTTCATAGGATGGGG0.155800.013500.819000.750001.000001.00000


Target Position: 803, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
803GAAAUGACCAUUUAUAUCA92.5617152

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
801-823CAGAAATGACCATTTATATCAAGUGAUAUAAAUGGUCAUUUCUGGAAAUGACCAUUUAUAUCAAGU3.514.821


Target Position: 4226, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4226CUUUAAAUAACUUGGUAUU79.33471199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7804244CTTTAAATAACTTGGTATTAATACCAAGTTATTTAAAG0.073400.011600.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4224-4246GCCTTTAAATAACTTGGTATTTTAAUACCAAGUUAUUUAAAGGCCUUUAAAUAACUUGGUAUUUUU20.0-9.722


Target Position: 4256, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4256CGUUUAAUACAAUAGAAAA101.266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4474274CGTTTAATACAATAGAAAATTTTCTATTGTATTAAACG0.333200.023600.775901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4254-4276TTCGTTTAATACAATAGAAAATAUUUUCUAUUGUAUUAAACGAACGUUUAAUACAAUAGAAAAUAU6.9-0.332


Target Position: 1118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1118GAACCAUCUCAGCGACAAA99.721211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3771136GAACCATCTCAGCGACAAATTTGTCGCTGAGATGGTTC0.281900.053300.672400.750000.962000.87500


Target Position: 838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
838GAUUUUUGCACGAGAACAU85.4726597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
934856GATTTTTGCACGAGAACATATGTTCTCGTGCAAAAATC0.156700.011500.525900.750000.978300.62500


Target Position: 2986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2986GCACAAAAGACUUAAUAUG78.51291287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5813004GCACAAAAGACTTAATATGCATATTAAGTCTTTTGTGC0.108700.049700.698300.750001.000001.00000


Target Position: 279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
279AGGUGGAAGGUUAUAAUUA91.4612198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
319297AGGTGGAAGGTTATAATTATAATTATAACCTTCCACCT0.293300.038900.810300.750001.000001.00000


Target Position: 3787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3787AGGAUAUGGUGCAGGUGUU81.1502998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8173805AGGATATGGTGCAGGTGTTAACACCTGCACCATATCCT0.068000.008000.698300.750001.000001.00000


Target Position: 1325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1325CUGCCUGUGAAGAAAUUUG68.83482502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6931343CTGCCTGTGAAGAAATTTGCAAATTTCTTCACAGGCAG0.211600.052300.637900.500001.000001.00000


Target Position: 170, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
170GACGUUAAAAAUUUUCUGU76.33191528

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
168-190GTGACGTTAAAAATTTTCTGTATACAGAAAAUUUUUAACGUCACGACGUUAAAAAUUUUCUGUAUU12.215.022


Target Position: 4242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4242AUUUUCCUGGCUUUCGUUU59.55883471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9954260ATTTTCCTGGCTTTCGTTTAAACGAAAGCCAGGAAAAT0.246000.016200.508600.500001.000001.00000


Target Position: 424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
424UCCGCCCCCACUUACUGAU57.60383626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
310442TCCGCCCCCACTTACTGATATCAGTAAGTGGGGGCGGA0.422100.051700.689700.750001.000001.00000


Target Position: 1534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1534UGCAUUUGAAAGAGGAGAA78.49591290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5651552TGCATTTGAAAGAGGAGAATTCTCCTCTTTCAAATGCA0.226400.089700.681000.750001.000001.00000


Target Position: 2196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2196GCCAUCGGUAUCAGAUUCU71.67982147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7202214GCCATCGGTATCAGATTCTAGAATCTGATACCGATGGC0.096000.011000.775900.750001.000001.00000


Target Position: 3413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3413GUAGAUGACUGGAUUAAAC80.55961067

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8863431GTAGATGACTGGATTAAACGTTTAATCCAGTCATCTAC0.135100.014900.534500.500001.000001.00000


Target Position: 4039, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4039GUGUUUUUUCCAGUAUGUU76.7971486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4914057GTGTTTTTTCCAGTATGTTAACATACTGGAAAAAACAC0.188000.020900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4037-4059ACGTGTTTTTTCCAGTATGTTTAAACAUACUGGAAAAAACACGUGUGUUUUUUCCAGUAUGUUUAU19.05.632


Target Position: 1120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1120ACCAUCUCAGCGACAAAAC57.84753606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9251138ACCATCTCAGCGACAAAACGTTTTGTCGCTGAGATGGT0.504600.054500.706900.500000.962000.87500


Target Position: 419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
419GCAUCUCCGCCCCCACUUA85.3625609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
300437GCATCTCCGCCCCCACTTATAAGTGGGGGCGGAGATGC0.200800.060900.819001.000000.989100.62500


Target Position: 4028, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4028CUAUGUGUUACGUGUUUUU81.08911004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5504046CTATGTGTTACGTGTTTTTAAAAACACGTAACACATAG0.116200.045300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4026-4048TGCTATGTGTTACGTGTTTTTTCAAAAACACGUAACACAUAGCACUAUGUGUUACGUGUUUUUUCU13.320.432


Target Position: 3037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3037UCAGCUCAAAGAGAUUUUG56.99783680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9683055TCAGCTCAAAGAGATTTTGCAAAATCTCTTTGAGCTGA0.081100.020400.577600.500001.000001.00000


Target Position: 61, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
61GCUGUGCGUUUCUCUGUUG74.54221742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88679GCTGTGCGTTTCTCTGTTGCAACAGAGAAACGCACAGC0.058100.012400.706900.750001.000001.00000


Target Position: 1957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1957UGAUGGUGGUGAGGAUGAU78.54171285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8631975TGATGGTGGTGAGGATGATATCATCCTCACCACCATCA0.079800.036300.543100.750001.000001.00000


Target Position: 943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
943CGGACUUACAAAGAAGAAG69.87372380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
547961CGGACTTACAAAGAAGAAGCTTCTTCTTTGTAAGTCCG0.313800.097800.775900.750001.000001.00000


Target Position: 4103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4103CAUUGUAGUUUAAGGAAAC78.79811261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9944121CATTGTAGTTTAAGGAAACGTTTCCTTAAACTACAATG0.127600.039200.508600.500001.000001.00000


Target Position: 650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
650UCAGAAGAAGUGGAUUUAA80.70971046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
656668TCAGAAGAAGTGGATTTAATTAAATCCACTTCTTCTGA0.182100.016900.689700.750001.000001.00000


Target Position: 2164, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2164GAAGCAUUUGGAAAUGAAU88.906341

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2162-2184CAGAAGCATTTGGAAATGAATCCAUUCAUUUCCAAAUGCUUCUGGAAGCAUUUGGAAAUGAAUCCU7.418.512


Target Position: 2831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2831CCAGAGCCUUUCAUCAAUG74.55671739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5842849CCAGAGCCTTTCATCAATGCATTGATGAAAGGCTCTGG0.108000.109800.689700.750001.000001.00000


Target Position: 1057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1057GCCCCCGCCUGAAGAUCCU64.36153012

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4331075GCCCCCGCCTGAAGATCCTAGGATCTTCAGGCGGGGGC0.185400.103000.655200.750000.913000.62500


Target Position: 2718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2718GACGAAUCCUGGCUAAACU85.0696635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6802736GACGAATCCTGGCTAAACTAGTTTAGCCAGGATTCGTC0.296300.085100.612100.500001.000001.00000


Target Position: 2070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2070UCAUCGAGGCUCUACUUAA89.3984311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5702088TCATCGAGGCTCTACTTAATTAAGTAGAGCCTCGATGA0.128100.016900.689700.750001.000001.00000


Target Position: 854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
854CAUGGAUCAAAUAAGAAAU88.0044396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
454872CATGGATCAAATAAGAAATATTTCTTATTTGATCCATG0.331900.180600.646600.750001.000001.00000


Target Position: 4134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4134UGCAUUAGUGAUUUUGUUU73.09731928

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9624152TGCATTAGTGATTTTGTTTAAACAAAATCACTAATGCA0.047700.039900.853400.750001.000001.00000


Target Position: 3720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3720GCGGUGGCUAUAGCAGUGG52.98523931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9843738GCGGTGGCTATAGCAGTGGCCACTGCTATAGCCACCGC0.074600.004300.577600.500001.000001.00000


Target Position: 1665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1665GCAUUCGAGGAAUCAGUCA84.8442656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8401683GCATTCGAGGAATCAGTCATGACTGATTCCTCGAATGC0.063900.060300.629300.750001.000001.00000


Target Position: 3537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3537ACCCCGUAAAUGAACGUAU71.77382133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5753555ACCCCGTAAATGAACGTATATACGTTCATTTACGGGGT0.178500.083300.810300.750000.907600.87500


Target Position: 2326, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2326CAUAAACGAUGUUGUUUAU90.2878255

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2324-2346ACCATAAACGATGTTGTTTATGTAUAAACAACAUCGUUUAUGGUCAUAAACGAUGUUGUUUAUGUU7.26.922


Target Position: 1582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1582UCGAUUUGAGUCUAUACUU74.24751784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361600TCGATTTGAGTCTATACTTAAGTATAGACTCAAATCGA0.391400.030700.655200.750001.000001.00000


Target Position: 146, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
146GAAGAAGACACUUGAAUCA93.906999

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
144-166CTGAAGAAGACACTTGAATCATGUGAUUCAAGUGUCUUCUUCAGGAAGAAGACACUUGAAUCAUGU16.319.121


Target Position: 1701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1701UACAUGAAAGAGAUAUUAA89.8517280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7541719TACATGAAAGAGATATTAATTAATATCTCTTTCATGTA0.393000.032600.646600.500001.000001.00000


Target Position: 1910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1910CACUUUGUUCCUCCACCAA87.1355452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831928CACTTTGTTCCTCCACCAATTGGTGGAGGAACAAAGTG0.191200.021100.646600.750001.000001.00000


Target Position: 2812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2812UGCUGCUGCUACCUGCUUU72.88051966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9692830TGCTGCTGCTACCTGCTTTAAAGCAGGTAGCAGCAGCA0.069000.004600.853400.750000.934800.62500


Target Position: 3421, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3421CUGGAUUAAACUGCAAAUA79.40111195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5993439CTGGATTAAACTGCAAATATATTTGCAGTTTAATCCAG0.122400.029700.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3419-3441GACTGGATTAAACTGCAAATATCUAUUUGCAGUUUAAUCCAGUCCUGGAUUAAACUGCAAAUAUCU20.021.222


Target Position: 4176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4176UCUUAAAAAUACCACAGUU79.52491184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7174194TCTTAAAAATACCACAGTTAACTGTGGTATTTTTAAGA0.084900.064000.577600.750001.000001.00000


Target Position: 2504, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2504CGUUUUGAGAGACUUGAAA89.1716326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8792522CGTTTTGAGAGACTTGAAATTTCAAGTCTCTCAAAACG0.079500.006500.775901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2502-2524CTCGTTTTGAGAGACTTGAAACCUUUCAAGUCUCUCAAAACGAGCGUUUUGAGAGACUUGAAACCU19.214.923


Target Position: 221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
221UCCUAUGAAAUUAGAGCAG58.34793567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
756239TCCTATGAAATTAGAGCAGCTGCTCTAATTTCATAGGA0.112800.024500.586200.500000.983700.62500


Target Position: 1817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1817UGUGAAUAUUUCUUCAAUU82.866815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6921835TGTGAATATTTCTTCAATTAATTGAAGAAATATTCACA0.085700.034100.698300.750000.923900.62500


Target Position: 1709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1709AGAGAUAUUAAUACUGACU81.6898947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9621727AGAGATATTAATACTGACTAGTCAGTATTAATATCTCT0.106300.066300.517200.500001.000001.00000


Target Position: 4239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4239GGUAUUUUCCUGGCUUUCG62.19123241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9184257GGTATTTTCCTGGCTTTCGCGAAAGCCAGGAAAATACC0.056200.007800.560300.500001.000001.00000


Target Position: 132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
132GCGAAGGCUGAUCUGAAGA80.25381106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
975150GCGAAGGCTGATCTGAAGATCTTCAGATCAGCCTTCGC0.055200.004500.698300.750001.000001.00000


Target Position: 1797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1797CUAUUGAUACCAGCAUGUU79.76031159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9331815CTATTGATACCAGCATGTTAACATGCTGGTATCAATAG0.051600.018500.525900.750001.000001.00000


Target Position: 1663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1663AGGCAUUCGAGGAAUCAGU71.51532163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8431681AGGCATTCGAGGAATCAGTACTGATTCCTCGAATGCCT0.124000.007400.637900.500001.000001.00000


Target Position: 242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
242GGGAACAAAAACAGGCAGA79.24061214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
628260GGGAACAAAAACAGGCAGATCTGCCTGTTTTTGTTCCC0.192500.172400.767200.750001.000001.00000


Target Position: 1369, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1369CCAAAAUUCAGUUGUCAUU79.95291138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3111387CCAAAATTCAGTTGTCATTAATGACAACTGAATTTTGG0.194600.096100.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1367-1389AGCCAAAATTCAGTTGTCATTATAAUGACAACUGAAUUUUGGCUCCAAAAUUCAGUUGUCAUUAUU20.5-3.322


Target Position: 2388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2388ACAACAAUAUGACCAACUA92.1854171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9102406ACAACAATATGACCAACTATAGTTGGTCATATTGTTGT0.150900.132300.534500.750001.000001.00000


Target Position: 318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
318CCAAUAAAAAAGAUGCACA88.1022391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
519336CCAATAAAAAAGATGCACATGTGCATCTTTTTTATTGG0.160500.160700.637900.750001.000001.00000


Target Position: 1179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1179GGAAUCCUUGGACUAGUAG73.02351936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9781197GGAATCCTTGGACTAGTAGCTACTAGTCCAAGGATTCC0.046700.004400.698300.750000.940200.75000


Target Position: 801, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
801CAGAAAUGACCAUUUAUAU92.8182139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
442819CAGAAATGACCATTTATATATATAAATGGTCATTTCTG0.195100.097300.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
799-821TGCAGAAATGACCATTTATATCAAUAUAAAUGGUCAUUUCUGCACAGAAAUGACCAUUUAUAUCAU-8.012.022


Target Position: 280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
280GGUGGAAGGUUAUAAUUAC86.5581496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
440298GGTGGAAGGTTATAATTACGTAATTATAACCTTCCACC0.314200.035800.672400.750001.000001.00000


Target Position: 1346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1346AGUGAGAUUCUGGAAGCAA87.2557446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8871364AGTGAGATTCTGGAAGCAATTGCTTCCAGAATCTCACT0.117800.006400.560300.750001.000001.00000


Target Position: 2286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2286AGGUUAUUUUGUCCACAAA90.6802240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2832304AGGTTATTTTGTCCACAAATTTGTGGACAAAATAACCT0.328100.042600.844800.750001.000001.00000


Target Position: 1673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1673GGAAUCAGUCAUGUAAUUG75.78861599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021691GGAATCAGTCATGTAATTGCAATTACATGACTGATTCC0.056200.022800.724100.750001.000001.00000


Target Position: 1583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1583CGAUUUGAGUCUAUACUUC81.363977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6071601CGATTTGAGTCTATACTTCGAAGTATAGACTCAAATCG0.441500.032600.620700.750001.000001.00000


Target Position: 2798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2798GCUAUCUGUACCAUUGCUG68.50142539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7552816GCTATCTGTACCATTGCTGCAGCAATGGTACAGATAGC0.093400.033000.569000.750001.000001.00000


Target Position: 3212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3212GGGCGUAAUGCACUUAUCC70.03022359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9383230GGGCGTAATGCACTTATCCGGATAAGTGCATTACGCCC0.218600.027500.620700.500000.983700.75000


Target Position: 1954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1954UGAUGAUGGUGGUGAGGAU86.8794465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8491972TGATGATGGTGGTGAGGATATCCTCACCACCATCATCA0.074800.060700.543100.750001.000001.00000


Target Position: 612, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
612CAAGAAAGGAAGAACAAGA91.1021214

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
610-632CTCAAGAAAGGAAGAACAAGAAGUCUUGUUCUUCCUUUCUUGAGCAAGAAAGGAAGAACAAGAAGU19.210.311


Target Position: 1703, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1703CAUGAAAGAGAUAUUAAUA102.7123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6441721CATGAAAGAGATATTAATATATTAATATCTCTTTCATG0.326100.045700.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1701-1723TACATGAAAGAGATATTAATACTUAUUAAUAUCUCUUUCAUGUACAUGAAAGAGAUAUUAAUACUU-8.012.032


Target Position: 1710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1710GAGAUAUUAAUACUGACUU86.5623495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7541728GAGATATTAATACTGACTTAAGTCAGTATTAATATCTC0.076000.058900.672400.750001.000001.00000


Target Position: 736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
736AGAAAAGAUCCAAGGAGAA88.4383369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
836754AGAAAAGATCCAAGGAGAATTCTCCTTGGATCTTTTCT0.150800.061000.551700.750001.000001.00000


Target Position: 3663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3663ACGACAAUGGAAGCGGAUA76.0821562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6743681ACGACAATGGAAGCGGATATATCCGCTTCCATTGTCGT0.088600.052100.732800.750001.000001.00000


Target Position: 3378, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3378CCAAGAAAGUCCAAUCUGA93.118125

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3376-3398CTCCAAGAAAGTCCAATCTGATGUCAGAUUGGACUUUCUUGGAGCCAAGAAAGUCCAAUCUGAUGU18.112.232


Target Position: 273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
273AGGUUCAGGUGGAAGGUUA85.8641563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
683291AGGTTCAGGTGGAAGGTTATAACCTTCCACCTGAACCT0.141500.012300.810300.750001.000001.00000


Target Position: 2310, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2310CUGAAACAAGCAUUACCAU82.2858875

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2308-2330TGCTGAAACAAGCATTACCATAAAUGGUAAUGCUUGUUUCAGCACUGAAACAAGCAUUACCAUAAU20.020.522


Target Position: 3327, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3327CUGCUAAAGGCAUGACUUU79.29731206

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3325-3347CTCTGCTAAAGGCATGACTTTAGAAAGUCAUGCCUUUAGCAGAGCUGCUAAAGGCAUGACUUUAGU19.219.722


Target Position: 1690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1690UGUAGAUGAAAUACAUGAA90.4679247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9481708TGTAGATGAAATACATGAATTCATGTATTTCATCTACA0.049700.020200.534500.750001.000001.00000


Target Position: 716, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
716CUAAACCAAUAUUUUCAGA82.2104889

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
714-736GTCTAAACCAATATTTTCAGAAAUCUGAAAAUAUUGGUUUAGACCUAAACCAAUAUUUUCAGAAAU12.220.022


Target Position: 3261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3261GCCAAGACAUGAAGUACCC66.7832735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9913279GCCAAGACATGAAGTACCCGGGTACTTCATGTCTTGGC0.070100.021400.508600.500001.000001.00000


Target Position: 714, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
714GUCUAAACCAAUAUUUUCA87.8668400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
951732GTCTAAACCAATATTTTCATGAAAATATTGGTTTAGAC0.111000.047000.594800.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
712-734TCGTCTAAACCAATATTTTCAGAUGAAAAUAUUGGUUUAGACGAGUCUAAACCAAUAUUUUCAGAU2.114.632


Target Position: 710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
710GCUCGUCUAAACCAAUAUU83.7546740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
600728GCTCGTCTAAACCAATATTAATATTGGTTTAGACGAGC0.104800.051400.844801.000001.000001.00000


Target Position: 1659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1659AAGCAGGCAUUCGAGGAAU71.80712124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8491677AAGCAGGCATTCGAGGAATATTCCTCGAATGCCTGCTT0.241900.031100.629300.500001.000001.00000


Target Position: 845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
845GCACGAGAACAUGGAUCAA93.3199120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
274863GCACGAGAACATGGATCAATTGATCCATGTTCTCGTGC0.481100.105000.706901.000000.913000.62500


Target Position: 218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
218CCAUCCUAUGAAAUUAGAG75.25481664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
908236CCATCCTATGAAATTAGAGCTCTAATTTCATAGGATGG0.171400.011100.534500.750000.983700.62500


Target Position: 2522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2522ACCCACAUGACACCAGAGA68.50712538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7502540ACCCACATGACACCAGAGATCTCTGGTGTCATGTGGGT0.107300.073300.629300.500001.000001.00000


Target Position: 139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
139CUGAUCUGAAGAAGACACU72.60652010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
930157CTGATCTGAAGAAGACACTAGTGTCTTCTTCAGATCAG0.137200.005500.577600.500000.983700.75000


Target Position: 1327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1327GCCUGUGAAGAAAUUUGAA92.322162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2001345GCCTGTGAAGAAATTTGAATTCAAATTTCTTCACAGGC0.310300.055900.827601.000001.000001.00000


Target Position: 2866, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2866CUAUAUCCAUCGAAAUUUU86.6401487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5412884CTATATCCATCGAAATTTTAAAATTTCGATGGATATAG0.248100.018300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2864-2886GGCTATATCCATCGAAATTTTGCAAAAUUUCGAUGGAUAUAGCCCUAUAUCCAUCGAAAUUUUGCU0.416.732


Target Position: 3277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3277CCCAUCUCCCUUCUUUGUA76.59831505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4193295CCCATCTCCCTTCTTTGTATACAAAGAAGGGAGATGGG0.151100.042300.810301.000001.000001.00000


Target Position: 1931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1931GACAAAAAGAAGAAGGAUA93.7413103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5461949GACAAAAAGAAGAAGGATATATCCTTCTTCTTTTTGTC0.303500.204000.775900.750001.000001.00000


Target Position: 3363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3363UGCUUCUCUUUGCCUCCAA75.04941684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6303381TGCTTCTCTTTGCCTCCAATTGGAGGCAAAGAGAAGCA0.099500.045500.706900.750000.956500.75000


Target Position: 4249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4249UGGCUUUCGUUUAAUACAA81.2176994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6024267TGGCTTTCGTTTAATACAATTGTATTAAACGAAAGCCA0.162300.044600.698300.750001.000001.00000


Target Position: 60, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
60UGCUGUGCGUUUCUCUGUU72.98841945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
88878TGCTGTGCGTTTCTCTGTTAACAGAGAAACGCACAGCA0.063200.006400.706900.750001.000001.00000


Target Position: 2981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2981UGUGAGCACAAAAGACUUA82.2068891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3592999TGTGAGCACAAAAGACTTATAAGTCTTTTGTGCTCACA0.518200.039500.672400.750001.000001.00000


Target Position: 1187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1187UGGACUAGUAGCAACAUUG70.42652306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9371205TGGACTAGTAGCAACATTGCAATGTTGCTACTAGTCCA0.090800.021100.698300.500001.000001.00000


Target Position: 382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382UGAAAUAAAGAGUGAAGAA89.2364321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
821400TGAAATAAAGAGTGAAGAATTCTTCACTCTTTATTTCA0.117000.047500.551700.750001.000001.00000


Target Position: 1765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1765UCCUGAAGUUCGCAUUGUU77.00881460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8351783TCCTGAAGTTCGCATTGTTAACAATGCGAACTTCAGGA0.064200.008900.724100.750001.000001.00000


Target Position: 355, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
355CUUUGUUAACUAUUUGGUU80.36181096

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
353-375GACTTTGTTAACTATTTGGTTCGAACCAAAUAGUUAACAAAGUCCUUUGUUAACUAUUUGGUUCGU18.87.222


Target Position: 2953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2953GGGUGGAGAAGAAGCAGAG77.9551338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5742971GGGTGGAGAAGAAGCAGAGCTCTGCTTCTTCTCCACCC0.187500.122000.681000.750001.000001.00000


Target Position: 275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
275GUUCAGGUGGAAGGUUAUA81.2991983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
707293GTTCAGGTGGAAGGTTATATATAACCTTCCACCTGAAC0.193500.011500.603400.750001.000001.00000


Target Position: 1806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1806CCAGCAUGUUUUGUGAAUA90.9333229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001824CCAGCATGTTTTGTGAATATATTCACAAAACATGCTGG0.230000.020300.801701.000001.000001.00000


Target Position: 3166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3166CAAUGUAUGCUAUCAUAAG86.0607537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9833184CAATGTATGCTATCATAAGCTTATGATAGCATACATTG0.066900.014400.508600.500000.978300.75000


Target Position: 1460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1460GACCGAGCAGCAGAGUGUA90.4972246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9911478GACCGAGCAGCAGAGTGTATACACTCTGCTGCTCGGTC0.043500.015900.637900.750001.000001.00000


Target Position: 799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
799UGCAGAAAUGACCAUUUAU80.19651113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
246817TGCAGAAATGACCATTTATATAAATGGTCATTTCTGCA0.261000.125200.810300.750001.000001.00000


Target Position: 3609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3609UGAUUGGCAGUACACGGUA79.75061161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8523627TGATTGGCAGTACACGGTATACCGTGTACTGCCAATCA0.128500.007400.543100.750001.000001.00000


Target Position: 1320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1320AGUUACUGCCUGUGAAGAA89.3552313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8781338AGTTACTGCCTGTGAAGAATTCTTCACAGGCAGTAACT0.127000.007400.534500.750001.000001.00000


Target Position: 245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
245AACAAAAACAGGCAGAAAU75.82191596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
947263AACAAAAACAGGCAGAAATATTTCTGCCTGTTTTTGTT0.107400.092900.637900.500001.000001.00000


Target Position: 2299, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2299CACAAAUAUUGCUGAAACA94.360585

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2297-2319TCCACAAATATTGCTGAAACAAGUGUUUCAGCAAUAUUUGUGGACACAAAUAUUGCUGAAACAAGU19.26.912


Target Position: 848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
848CGAGAACAUGGAUCAAAUA98.714219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
180866CGAGAACATGGATCAAATATATTTGATCCATGTTCTCG0.366600.079600.750001.000001.000001.00000


Target Position: 2077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2077GGCUCUACUUAAGUACAUU91.5222196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7082095GGCTCTACTTAAGTACATTAATGTACTTAAGTAGAGCC0.083700.019400.991401.000001.000001.00000


Target Position: 2283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2283CCAAGGUUAUUUUGUCCAC69.98582370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8272301CCAAGGTTATTTTGTCCACGTGGACAAAATAACCTTGG0.197300.023800.551700.750001.000001.00000


Target Position: 317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
317ACCAAUAAAAAAGAUGCAC55.39193780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
838335ACCAATAAAAAAGATGCACGTGCATCTTTTTTATTGGT0.172400.149400.560300.500001.000001.00000


Target Position: 1945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1945GGAUAAGGAUGAUGAUGGU90.966226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9781963GGATAAGGATGATGATGGTACCATCATCATCCTTATCC0.296300.139800.517200.750001.000001.00000


Target Position: 425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
425CCGCCCCCACUUACUGAUA77.32111423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197443CCGCCCCCACTTACTGATATATCAGTAAGTGGGGGCGG0.419100.056400.870701.000001.000001.00000


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590GCCAACUUGAAGGAUUACU66.98722713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
639608GCCAACTTGAAGGATTACTAGTAATCCTTCAAGTTGGC0.096800.015300.793100.750000.978300.75000


Target Position: 370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
370GGUUCGAAUAAAUGAAAUA96.968139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
218388GGTTCGAATAAATGAAATATATTTCATTTATTCGAACC0.241400.092900.810301.000001.000001.00000


Target Position: 3192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3192GGAAGAUUCUCACCACUGA95.60363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6823210GGAAGATTCTCACCACTGATCAGTGGTGAGAATCTTCC0.311900.012400.646600.750000.983700.62500


Target Position: 2944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2944UGCUAGAAUGGGUGGAGAA83.7071743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6012962TGCTAGAATGGGTGGAGAATTCTCCACCCATTCTAGCA0.367000.015400.681000.750001.000001.00000


Target Position: 1099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1099UGGCAAAUUGGCUCAGUUC64.08963040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8631117TGGCAAATTGGCTCAGTTCGAACTGAGCCAATTTGCCA0.093100.006900.672400.500001.000001.00000


Target Position: 1702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1702ACAUGAAAGAGAUAUUAAU88.3002377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3131720ACATGAAAGAGATATTAATATTAATATCTCTTTCATGT0.321900.039300.698300.750001.000001.00000


Target Position: 1951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1951GGAUGAUGAUGGUGGUGAG89.8541279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7881969GGATGATGATGGTGGTGAGCTCACCACCATCATCATCC0.148500.107300.560300.750001.000001.00000


Target Position: 164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
164AUGGGUGACGUUAAAAAUU70.64532277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
734182ATGGGTGACGTTAAAAATTAATTTTTAACGTCACCCAT0.205600.017600.646600.500001.000001.00000


Target Position: 1827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1827UCUUCAAUUGCCCCAUCAU72.96621951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9351845TCTTCAATTGCCCCATCATATGATGGGGCAATTGAAGA0.051600.009300.569000.750001.000001.00000


Target Position: 3652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3652GAUGGCCCGAUACGACAAU74.32181772

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6443670GATGGCCCGATACGACAATATTGTCGTATCGGGCCATC0.178300.013900.672400.750000.902200.87500


Target Position: 4279, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4279GUAUUACACCGAAAAAAAA94.11993

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4277-4299AAGTATTACACCGAAAAAAAAAAUUUUUUUUCGGUGUAAUACUUGUAUUACACCGAAAAAAAAAAU-11.38.522


Target Position: 721, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
721CCAAUAUUUUCAGAAAGAA90.9125231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
394739CCAATATTTTCAGAAAGAATTCTTTCTGAAAATATTGG0.223500.031400.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
719-741AACCAATATTTTCAGAAAGAAAAUUCUUUCUGAAAAUAUUGGUUCCAAUAUUUUCAGAAAGAAAAU19.1-1.822


Target Position: 694, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
694CUUGGAAAAUGCUAAAGCU81.6384951

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
692-714ACCTTGGAAAATGCTAAAGCTCGAGCUUUAGCAUUUUCCAAGGUCUUGGAAAAUGCUAAAGCUCGU18.320.122


Target Position: 1766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1766CCUGAAGUUCGCAUUGUUC71.83712117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771784CCTGAAGTTCGCATTGTTCGAACAATGCGAACTTCAGG0.073800.010000.672400.750001.000001.00000


Target Position: 2750, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2750CGUUUUGGCAAAAUGAUGA83.0588800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8382768CGTTTTGGCAAAATGATGATCATCATTTTGCCAAAACG0.165300.033400.551700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2748-2770CTCGTTTTGGCAAAATGATGATAUCAUCAUUUUGCCAAAACGAGCGUUUUGGCAAAAUGAUGAUAU13.618.832


Target Position: 1919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1919CCUCCACCAAAAGACAAAA83.3928775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801937CCTCCACCAAAAGACAAAATTTTGTCTTTTGGTGGAGG0.804600.148800.844801.000000.962000.62500


Target Position: 2374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2374ACUCUUCACUGCUCACAAC73.00671940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7812392ACTCTTCACTGCTCACAACGTTGTGAGCAGTGAAGAGT0.156000.034000.560300.500001.000001.00000


Target Position: 3657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3657CCCGAUACGACAAUGGAAG64.3393013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5233675CCCGATACGACAATGGAAGCTTCCATTGTCGTATCGGG0.123800.053300.853400.750001.000001.00000


Target Position: 1370, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1370CAAAAUUCAGUUGUCAUUA86.8956464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6431388CAAAATTCAGTTGTCATTATAATGACAACTGAATTTTG0.209000.104700.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1368-1390GCCAAAATTCAGTTGTCATTATTUAAUGACAACUGAAUUUUGGCCAAAAUUCAGUUGUCAUUAUUU20.50.422


Target Position: 1900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1900UCAGAUGACCCACUUUGUU70.49262289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7901918TCAGATGACCCACTTTGTTAACAAAGTGGGTCATCTGA0.088100.008700.577600.750001.000001.00000


Target Position: 4027, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4027GCUAUGUGUUACGUGUUUU82.4632860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6514045GCTATGTGTTACGTGTTTTAAAACACGTAACACATAGC0.094700.039400.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4025-4047ATGCTATGTGTTACGTGTTTTTTAAAACACGUAACACAUAGCAUGCUAUGUGUUACGUGUUUUUUU19.817.933


Target Position: 1683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1683AUGUAAUUGUAGAUGAAAU85.8916561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9791701ATGTAATTGTAGATGAAATATTTCATCTACAATTACAT0.049600.006500.646600.500001.000001.00000


Target Position: 4032, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4032GUGUUACGUGUUUUUUCCA84.9451645

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4030-4052ATGTGTTACGTGTTTTTTCCAGTUGGAAAAAACACGUAACACAUGUGUUACGUGUUUUUUCCAGUU14.321.022


Target Position: 1110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1110CUCAGUUCGAACCAUCUCA82.0243909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9221128CTCAGTTCGAACCATCTCATGAGATGGTTCGAACTGAG0.180300.005700.586200.500001.000001.00000


Target Position: 1680, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1680GUCAUGUAAUUGUAGAUGA89.7792286

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1678-1700CAGTCATGTAATTGTAGATGAAAUCAUCUACAAUUACAUGACUGGUCAUGUAAUUGUAGAUGAAAU20.321.521


Target Position: 1491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1491CUCAGCCCAGAAGAAUCAG59.83683453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9331509CTCAGCCCAGAAGAATCAGCTGATTCTTCTGGGCTGAG0.121300.005400.525900.500001.000001.00000


Target Position: 1476, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1476GUAACAUCGUAGUAACUCA99.367113

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1474-1496GTGTAACATCGTAGTAACTCAGCUGAGUUACUACGAUGUUACACGUAACAUCGUAGUAACUCAGCU21.416.133


Target Position: 1154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1154CCUUGGUCACCUCCACAAU80.491084

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9521172CCTTGGTCACCTCCACAATATTGTGGAGGTGACCAAGG0.120300.005000.836201.000000.923900.87500


Target Position: 2134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2134GCCUGGCUGGAAUCUGAUU78.15711319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262152GCCTGGCTGGAATCTGATTAATCAGATTCCAGCCAGGC0.120800.007800.991401.000001.000001.00000


Target Position: 711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
711CUCGUCUAAACCAAUAUUU72.62832001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
743729CTCGTCTAAACCAATATTTAAATATTGGTTTAGACGAG0.077300.050600.810300.750001.000001.00000


Target Position: 615, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
615GAAAGGAAGAACAAGAAGU81.7875935

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
613-635AAGAAAGGAAGAACAAGAAGTGCACUUCUUGUUCUUCCUUUCUUGAAAGGAAGAACAAGAAGUGCU16.618.712


Target Position: 344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
344GCUGCCAGAGACUUUGUUA91.8116183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
698362GCTGCCAGAGACTTTGTTATAACAAAGTCTCTGGCAGC0.186100.011800.819001.000000.994600.87500


Target Position: 3043, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3043CAAAGAGAUUUUGAUUAAU87.5232417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9083061CAAAGAGATTTTGATTAATATTAATCAAAATCTCTTTG0.055500.017900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3041-3063CTCAAAGAGATTTTGATTAATTCAUUAAUCAAAAUCUCUUUGAGCAAAGAGAUUUUGAUUAAUUCU8.919.123


Target Position: 2197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2197CCAUCGGUAUCAGAUUCUA92.0506176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8032215CCATCGGTATCAGATTCTATAGAATCTGATACCGATGG0.094800.008500.672401.000001.000001.00000


Target Position: 4224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4224GCCUUUAAAUAACUUGGUA90.9475228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7454242GCCTTTAAATAACTTGGTATACCAAGTTATTTAAAGGC0.094900.010000.819001.000001.000001.00000


Target Position: 2865, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2865GCUAUAUCCAUCGAAAUUU79.10041229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4962883GCTATATCCATCGAAATTTAAATTTCGATGGATATAGC0.177900.020400.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2863-2885GGGCTATATCCATCGAAATTTTGAAAUUUCGAUGGAUAUAGCCCGCUAUAUCCAUCGAAAUUUUGU7.48.232


Target Position: 3003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3003UGGCUACACUAAGAAUGAC68.04912592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9793021TGGCTACACTAAGAATGACGTCATTCTTAGTGTAGCCA0.190600.004400.525900.500001.000001.00000


Target Position: 165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
165UGGGUGACGUUAAAAAUUU72.89721964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
872183TGGGTGACGTTAAAAATTTAAATTTTTAACGTCACCCA0.143100.006700.844800.750001.000001.00000


Target Position: 1030, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1030CAUUCAAGAGCUAAAUCUU91.1171213

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1028-1050ATCATTCAAGAGCTAAATCTTGAAAGAUUUAGCUCUUGAAUGAUCAUUCAAGAGCUAAAUCUUGAU6.912.022


Target Position: 2037, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2037CUCAAUUGAACGAAAAGGA77.81991359

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2035-2057GTCTCAATTGAACGAAAAGGAAAUCCUUUUCGUUCAAUUGAGACCUCAAUUGAACGAAAAGGAAAU18.713.832


Target Position: 3216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3216GUAAUGCACUUAUCCACAA92.6942145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8833234GTAATGCACTTATCCACAATTGTGGATAAGTGCATTAC0.671200.072600.534500.750000.983700.62500


Target Position: 3722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3722GGUGGCUAUAGCAGUGGAG72.30572046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8703740GGTGGCTATAGCAGTGGAGCTCCACTGCTATAGCCACC0.101200.008400.543100.750001.000001.00000


Target Position: 2376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2376UCUUCACUGCUCACAACAA86.673483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7142394TCTTCACTGCTCACAACAATTGTTGTGAGCAGTGAAGA0.322400.044600.577600.750001.000001.00000


Target Position: 4023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4023GCAUGCUAUGUGUUACGUG77.80821360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9634041GCATGCTATGTGTTACGTGCACGTAACACATAGCATGC0.067000.004700.560300.750001.000001.00000


Target Position: 320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
320AAUAAAAAAGAUGCACAAA83.6948745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
990338AATAAAAAAGATGCACAAATTTGTGCATCTTTTTTATT0.084400.086000.508600.500001.000001.00000


Target Position: 2142, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2142GGAAUCUGAUUUAUACUAU93.6882105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6842160GGAATCTGATTTATACTATATAGTATAAATCAGATTCC0.087100.026700.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2140-2162CTGGAATCTGATTTATACTATGCAUAGUAUAAAUCAGAUUCCAGGGAAUCUGAUUUAUACUAUGCU7.920.423


Target Position: 2078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2078GCUCUACUUAAGUACAUUG80.26681104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9682096GCTCTACTTAAGTACATTGCAATGTACTTAAGTAGAGC0.046600.015100.706900.750001.000001.00000


Target Position: 941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
941UCCGGACUUACAAAGAAGA70.70812272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
933959TCCGGACTTACAAAGAAGATCTTCTTTGTAAGTCCGGA0.306500.043500.646600.500001.000001.00000


Target Position: 2913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2913CCCUUUUAUCAGUAUUCCA88.2197379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9412931CCCTTTTATCAGTATTCCATGGAATACTGATAAAAGGG0.050400.051000.646600.750001.000001.00000


Target Position: 850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
850AGAACAUGGAUCAAAUAAG76.6321503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
952868AGAACATGGATCAAATAAGCTTATTTGATCCATGTTCT0.371900.230400.586200.500001.000001.00000


Target Position: 3645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3645CUCCCAAGAUGGCCCGAUA85.2325621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9873663CTCCCAAGATGGCCCGATATATCGGGCCATCTTGGGAG0.085300.004100.767200.750000.951100.87500


Target Position: 2005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2005UGAAUAUGGUCCAGAAACA85.9249556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9662023TGAATATGGTCCAGAAACATGTTTCTGGACCATATTCA0.156200.005900.517200.500001.000001.00000


Target Position: 241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
241GGGGAACAAAAACAGGCAG67.942615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
947259GGGGAACAAAAACAGGCAGCTGCCTGTTTTTGTTCCCC0.206500.005100.706900.750001.000001.00000


Target Position: 4037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4037ACGUGUUUUUUCCAGUAUG68.05572589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7944055ACGTGTTTTTTCCAGTATGCATACTGGAAAAAACACGT0.070700.021400.620700.500001.000001.00000


Target Position: 4100, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4100GUUCAUUGUAGUUUAAGGA82.3239870

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4098-4120TGGTTCATTGTAGTTTAAGGAAAUCCUUAAACUACAAUGAACCAGUUCAUUGUAGUUUAAGGAAAU11.013.823


Target Position: 2343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2343AUGUCAUUGACUCCUGCAA79.8881146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9822361ATGTCATTGACTCCTGCAATTGCAGGAGTCAATGACAT0.080000.058800.508600.500000.962000.75000


Target Position: 3411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3411UUGUAGAUGACUGGAUUAA74.3811764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8663429TTGTAGATGACTGGATTAATTAATCCAGTCATCTACAA0.208100.009700.612100.500001.000001.00000


Target Position: 1925, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1925CCAAAAGACAAAAAGAAGA81.854925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6091943CCAAAAGACAAAAAGAAGATCTTCTTTTTGTCTTTTGG0.412100.289500.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1923-1945CACCAAAAGACAAAAAGAAGAAGUCUUCUUUUUGUCUUUUGGUGCCAAAAGACAAAAAGAAGAAGU10.312.211


Target Position: 4024, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4024CAUGCUAUGUGUUACGUGU85.3543612

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4022-4044GGCATGCTATGTGTTACGTGTTTACACGUAACACAUAGCAUGCCCAUGCUAUGUGUUACGUGUUUU21.019.723


Target Position: 1979, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1979GCAAAUUGCAACUUGAUCU80.68141049

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1977-1999ATGCAAATTGCAACTTGATCTGTAGAUCAAGUUGCAAUUUGCAUGCAAAUUGCAACUUGAUCUGUU20.44.222


Target Position: 946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
946ACUUACAAAGAAGAAGGAA78.95981245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
906964ACTTACAAAGAAGAAGGAATTCCTTCTTCTTTGTAAGT0.283600.127800.534500.750001.000001.00000


Target Position: 1335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1335AGAAAUUUGAAAGUGAGAU74.12021797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8531353AGAAATTTGAAAGTGAGATATCTCACTTTCAAATTTCT0.076100.039800.543100.750001.000001.00000


Target Position: 4250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4250GGCUUUCGUUUAAUACAAU89.4412306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3924268GGCTTTCGTTTAATACAATATTGTATTAAACGAAAGCC0.161600.086500.991401.000001.000001.00000


Target Position: 4287, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4287CCGAAAAAAAAAAAAAAAA82.255881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6534305CCGAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTCGG1.000000.013600.913801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4285-4307CACCGAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUCGGUGCCGAAAAAAAAAAAAAAAAAAU-11.37.700


Target Position: 84, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
84GGUAGAAGGCCAGAGUCAC75.12721674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
995102GGTAGAAGGCCAGAGTCACGTGACTCTGGCCTTCTACC0.077600.003900.560300.750001.000001.00000


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779GAUCACAACAGGAGCUUUA91.5485194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
787797GATCACAACAGGAGCTTTATAAAGCTCCTGTTGTGATC0.071700.026900.646600.750000.989100.87500


Target Position: 4040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4040UGUUUUUUCCAGUAUGUUU76.52361519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6254058TGTTTTTTCCAGTATGTTTAAACATACTGGAAAAAACA0.150300.017100.706900.750001.000001.00000


Target Position: 4286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4286ACCGAAAAAAAAAAAAAAA76.85321480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8014304ACCGAAAAAAAAAAAAAAATTTTTTTTTTTTTTTCGGT1.000000.008500.853400.750001.000001.00000


Target Position: 2948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2948AGAAUGGGUGGAGAAGAAG64.81092973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7412966AGAATGGGTGGAGAAGAAGCTTCTTCTCCACCCATTCT0.248700.015400.586200.500001.000001.00000


Target Position: 1326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1326UGCCUGUGAAGAAAUUUGA73.52941871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8881344TGCCTGTGAAGAAATTTGATCAAATTTCTTCACAGGCA0.252100.055400.629300.500001.000001.00000


Target Position: 2656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2656AGCAGAACACACUCUUAGA90.1537262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6712674AGCAGAACACACTCTTAGATCTAAGAGTGTGTTCTGCT0.128300.026400.629300.500000.989100.87500


Target Position: 3655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3655GGCCCGAUACGACAAUGGA85.4851594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6993673GGCCCGATACGACAATGGATCCATTGTCGTATCGGGCC0.139800.011800.629300.750000.902200.62500


Target Position: 348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
348CCAGAGACUUUGUUAACUA98.388922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
988366CCAGAGACTTTGTTAACTATAGTTAACAAAGTCTCTGG0.149000.004100.672401.000001.000001.00000


Target Position: 3352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3352CCCCCUGCAGUUGCUUCUC53.44313901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6273370CCCCCTGCAGTTGCTTCTCGAGAAGCAACTGCAGGGGG0.266300.014400.681000.750000.956501.00000


Target Position: 1367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1367AGCCAAAAUUCAGUUGUCA82.5211850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7001385AGCCAAAATTCAGTTGTCATGACAACTGAATTTTGGCT0.161300.065400.629300.500001.000001.00000


Target Position: 4038, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4038CGUGUUUUUUCCAGUAUGU79.7671158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8554056CGTGTTTTTTCCAGTATGTACATACTGGAAAAAACACG0.061700.018500.569000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4036-4058TACGTGTTTTTTCCAGTATGTTTACAUACUGGAAAAAACACGUACGUGUUUUUUCCAGUAUGUUUU17.913.322


Target Position: 1012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1012GCAUCAGCUGCAAAACAUC77.18281438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9101030GCATCAGCTGCAAAACATCGATGTTTTGCAGCTGATGC0.103200.005900.672400.750000.945700.62500


Target Position: 2069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2069CUCAUCGAGGCUCUACUUA79.46671188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7572087CTCATCGAGGCTCTACTTATAAGTAGAGCCTCGATGAG0.153700.009800.775900.750001.000001.00000


Target Position: 427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
427GCCCCCACUUACUGAUACU79.24931213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
772445GCCCCCACTTACTGATACTAGTATCAGTAAGTGGGGGC0.234700.009300.793100.750001.000001.00000


Target Position: 712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
712UCGUCUAAACCAAUAUUUU75.43431642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
688730TCGTCTAAACCAATATTTTAAAATATTGGTTTAGACGA0.086400.047100.793100.750001.000001.00000


Target Position: 371, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
371GUUCGAAUAAAUGAAAUAA90.5781243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
650389GTTCGAATAAATGAAATAATTATTTCATTTATTCGAAC0.164400.067400.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
369-391TGGTTCGAATAAATGAAATAAAGUUAUUUCAUUUAUUCGAACCAGUUCGAAUAAAUGAAAUAAAGU8.916.732


Target Position: 973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
973AGUGGAGCCUUACAAAGUA91.725185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
947991AGTGGAGCCTTACAAAGTATACTTTGTAAGGCTCCACT0.117700.044100.525900.750001.000001.00000


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742GAUCCAAGGAGAAUAUAAG84.7707664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
904760GATCCAAGGAGAATATAAGCTTATATTCTCCTTGGATC0.440600.119300.543100.500000.983700.62500


Target Position: 3239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3239UCUGUUAAUUGUCCUUUUA80.00581132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4003257TCTGTTAATTGTCCTTTTATAAAAGGACAATTAACAGA0.255600.136200.689700.750001.000001.00000


Target Position: 2071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2071CAUCGAGGCUCUACUUAAG82.4793857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9612089CATCGAGGCTCTACTTAAGCTTAAGTAGAGCCTCGATG0.132700.015800.517200.500001.000001.00000


Target Position: 3493, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3493GGUUGUUGAAGUAACCAAA97.183237

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3491-3513TTGGTTGTTGAAGTAACCAAACAUUUGGUUACUUCAACAACCAAGGUUGUUGAAGUAACCAAACAU20.019.333


Target Position: 792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792GCUUUAUUGCAGAAAUGAC78.68791274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
917810GCTTTATTGCAGAAATGACGTCATTTCTGCAATAAAGC0.189600.016500.534500.750001.000001.00000


Target Position: 438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
438CUGAUACUCCUGACACUAC76.23181539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
989456CTGATACTCCTGACACTACGTAGTGTCAGGAGTATCAG0.080600.064600.603400.500001.000001.00000


Target Position: 1368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1368GCCAAAAUUCAGUUGUCAU87.3501438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3561386GCCAAAATTCAGTTGTCATATGACAACTGAATTTTGGC0.174700.083300.844801.000001.000001.00000


Target Position: 3604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3604CCUUAUGAUUGGCAGUACA91.0023223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6983622CCTTATGATTGGCAGTACATGTACTGCCAATCATAAGG0.085100.014000.637900.750001.000001.00000


Target Position: 87, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
87AGAAGGCCAGAGUCACACA88.1747383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
964105AGAAGGCCAGAGTCACACATGTGTGACTCTGGCCTTCT0.169300.007200.517200.500001.000001.00000


Target Position: 2907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2907ACGUAGCCCUUUUAUCAGU71.4862172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8092925ACGTAGCCCTTTTATCAGTACTGATAAAAGGGCTACGT0.133700.045800.569000.500001.000001.00000


Target Position: 2957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2957GGAGAAGAAGCAGAGAUAC76.95511466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3142975GGAGAAGAAGCAGAGATACGTATCTCTGCTTCTTCTCC0.710100.097800.689700.750001.000001.00000


Target Position: 1805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1805ACCAGCAUGUUUUGUGAAU71.53972159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5321823ACCAGCATGTTTTGTGAATATTCACAAAACATGCTGGT0.236900.018700.844800.750001.000001.00000


Target Position: 3169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3169UGUAUGCUAUCAUAAGGAA89.2109324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8953187TGTATGCTATCATAAGGAATTCCTTATGATAGCATACA0.096600.026700.534500.750000.978300.75000


Target Position: 1285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1285GGAUCAUGAUUUGCAAGCA94.41383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9541303GGATCATGATTTGCAAGCATGCTTGCAAATCATGATCC0.118200.027200.517200.750001.000001.00000


Target Position: 1705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1705UGAAAGAGAUAUUAAUACU84.3156695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9651723TGAAAGAGATATTAATACTAGTATTAATATCTCTTTCA0.353800.130300.517200.500001.000001.00000


Target Position: 648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
648AAUCAGAAGAAGUGGAUUU77.90031347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
996666AATCAGAAGAAGTGGATTTAAATCCACTTCTTCTGATT0.059000.014100.508600.500001.000001.00000


Target Position: 1468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1468AGCAGAGUGUAACAUCGUA93.4375114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5061486AGCAGAGTGTAACATCGTATACGATGTTACACTCTGCT0.304700.019800.672400.750001.000001.00000


Target Position: 2568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2568CUCUUAGCAUAAAACUUCU81.8045929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9622586CTCTTAGCATAAAACTTCTAGAAGTTTTATGCTAAGAG0.276100.004700.586200.500000.983700.87500


Target Position: 3788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3788GGAUAUGGUGCAGGUGUUG71.49352169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7163806GGATATGGTGCAGGTGTTGCAACACCTGCACCATATCC0.152300.011100.724100.750001.000001.00000


Target Position: 374, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
374CGAAUAAAUGAAAUAAAGA92.6695148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
761392CGAATAAATGAAATAAAGATCTTTATTTCATTTATTCG0.117600.065200.569000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
372-394TTCGAATAAATGAAATAAAGAGTUCUUUAUUUCAUUUAUUCGAACGAAUAAAUGAAAUAAAGAGUU-4.32.112


Target Position: 1347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1347GUGAGAUUCUGGAAGCAAU90.8187234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8811365GTGAGATTCTGGAAGCAATATTGCTTCCAGAATCTCAC0.151600.006500.784500.750001.000001.00000


Target Position: 1361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1361GCAAUCAGCCAAAAUUCAG71.59722155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7731379GCAATCAGCCAAAATTCAGCTGAATTTTGGCTGATTGC0.107400.019800.569000.750001.000001.00000


Target Position: 1190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1190ACUAGUAGCAACAUUGAUG72.20032063

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8791208ACTAGTAGCAACATTGATGCATCAATGTTGCTACTAGT0.506100.025200.551700.500001.000001.00000


Target Position: 3005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3005GCUACACUAAGAAUGACCU81.8672922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9893023GCTACACTAAGAATGACCTAGGTCATTCTTAGTGTAGC0.084600.008400.508600.750001.000001.00000


Target Position: 2141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2141UGGAAUCUGAUUUAUACUA82.6141838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5792159TGGAATCTGATTTATACTATAGTATAAATCAGATTCCA0.109100.022500.672400.750001.000001.00000