Input target sequence

Length: 3091
GGGAGACCCAAGCTTCTAGAGATCCCTCGACCTCGAGATCCATTGTGCTCTAAAGAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGATCCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGATTTGAATATAACCTGCCGCTTTGCAGGTGTATTCCACGTGGAGAAAAATGGTCGCTACAGCATCTCTCGGACGGAGGCCGCTGACCTCTGCAAGGCTTTCAATAGCACCTTGCCCACAATGGCCCAGATGGAGAAAGCTCTGAGCATCGGATTTGAGACCTGCAGGTATGGGTTCATAGAAGGGCATGTGGTGATTCCCCGGATCCACCCCAACTCCATCTGTGCAGCAAACAACACAGGGGTGTACATCCTCACATACAACACCTCCCAGTATGACACATATTGCTTCAATGCTTCAGCTCCACCTGAAGAAGATTGTACATCAGTCACAGACCTGCCCAATGCCTTTGATGGACCAATTACCATAACTATTGTTAACCGTGATGGCACCCGCTATGTCCAGAAAGGAGAATACAGAACGAATCCTGAAGACATCTACCCCAGCAACCCTACTGATGATGACGTGAGCAGCGGCTCCTCCAGTGAAAGGAGCAGCACTTCAGGAGGTTACATCTTTTACACCTTTTCTACTGTACACCCCATCCCAGACGAAGACAGTCCCTGGATCACCGACAGCACAGACAGAATCCCTGCTACCACTTTGATGAGCACTAGTGCTACAGCAACTGAGACAGCAACCAAGAGGCAAGAAGCCTGGGATTGGTTTTCATGGTTGTTTCTACCATCAGAGTCAAAGAATCATCTTCACACAACAACACAAATGGCTGGTACGTCTTCAAATACCATCTCAGCAGGCTGGGAGCCAAATGAAGAAAATGAAGATGAAAGAGACAGACACCTCAGTTTTTCTGGATCAGGCATTGATGATGATGAAGATTTTATCTCCAGCACCATTTCAACCACACCACGGGCCTTTGACCACACAAAACAGAACCAGGACTGGACCCAGTGGAACCCAAGCCATTCAAATCCGGAAGTGCTACTTCAGACAACCACAAGGATGACTGATGTAGACAGAAATGGCACCACTGCTTATGAAGGAAACTGGAACCCAGAAGCACACCCTCCCCTCATTCACCATGAGCATCATGAGGAAGAAGAGACCCCACATTCTACAAGCACAATCCAGGCAACTCCTAGTAGTACAACGGAAGAAACAGCTACCCAGAAGGAACAGTGGTTTGGCAACAGATGGCATGAGGGATATCGCCAAACACCCAGAGAAGACTCCCATTCGACAACAGGGACAGCTGCAGCCTCAGCTCATACCAGCCATCCAATGCAAGGAAGGACAACACCAAGCCCAGAGGACAGTTCCTGGACTGATTTCTTCAACCCAATCTCACACCCCATGGGACGAGGTCATCAAGCAGGAAGAAGGATGGATATGGACTCCAGTCATAGTACAACGCTTCAGCCTACTGCAAATCCAAACACAGGTTTGGTGGAAAATTTGGACAGGACAGGACCTCTTTCAATGACAACGCAGCAGAGTAATTCTCAGAGCTTCTCTACATCACATGAAGGCTTGGAAGAAGATAAAGACCATCCAACAACTTCTACTCTGACATCAAGCAATAGGAATGATGTCACAGGTGGAAGAAGAGACCCAAATCATTCTGAAGGCTCAACTACTTTACTGGAAGGTTATACCTCTCATTACCCACACACGAAGGAAAGCAGGACCTTCATCCCAGTGACCTCAGCTAAGACTGGGTCCTTTGGAGTTACTGCAGTTACTGTTGGAGATTCCAACTCTAATGTCAATCGTTCCTTATCAGGAGACCAAGACACATTCCACCCCAGTGGGGGGTCCCATACCACTCATGGATCTGAATCAGATGGACACTCACATGGGAGTCAAGAAGGTGGAGCAAACACAACCTCTGGTCCTATAAGGACACCCCAAATTCCAGAATGGCTGATCATCTTGGCATCCCTCTTGGCCTTGGCTTTGATTCTTGCAGTTTGCATTGCAGTCAACAGTCGAAGAAGGTGTGGGCAGAAGAAAAAGCTAGTGATCAACAGTGGCAATGGAGCTGTGGAGGACAGAAAGCCAAGTGGACTCAACGGAGAGGCCAGCAAGTCTCAGGAAATGGTGCATTTGGTGAACAAGGAGTCGTCAGAAACTCCAGACCAGTTTATGACAGCTGATGAGACAAGGAACCTGCAGAATGTGGACATGAAGATTGGGGTGTAACACCTACACCATTATCTTGGAAAGAAACAACCGTTGGAAACATAACCATTACAGGGAGCTGGGACACTTAACAGATGCAATGTGCTACTGATTGTTTCATTGCGAATCTTTTTTAGCATAAAATTTTCTACTCTTTTTGTTTTTTGTGTTTTGTTCTTTAAAGTCAGGTCCAATTTGTAAAAACAGCATTGCTTTGTAAATTAGGGCCCAATTAATAATCAGCAAGAATTTGATCGTTCAGTTCCACTTGGAGGCCTTCATCCTCGGGTGTGCTATGGATGGCTTCTAACAAAAACTACACATATGTATTCCTGATCGCCAACCTTTCCCCCACCAGCTAAGGACATTTCCCAGGGTTAATAGGGCCTGGTCCCTGGGAGGAAATTTGAATGGGTCCATTTTGCCCTTCCATAGCCTAATCCCTGGGCATTGCTTTCCACTGAGGTTGGGGTGTACTAGTTACACATCTTCAACAGACCCCCTCTAGAAATTTTTCAGATGCTTCTGGGAGACACCAAAGGGTGAAGCTATTTATCTGTAGTAAACTATTTATCTGTGTTTTTGAAATATTAAACCCTGGATCAGTCCTTTGATCAGTATAATTTTTTAAAGTTACTTTGTCAGAGGCACAAAAGGGTTTAAACTGATTCATAATAAATATCTGTACTTCTTCGATCTTCAAAA