siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs 1   3   4   5   6   7   31   35   36   37   80   84   85   86   87   88   131   142   143   144  
147   169   170   171   172   173   174   229   230   231   232   233   234   235   236   238   239   240   281   285  
286   287   295   296   299   300   360   361   362   363   364   368   386   390   393   396   397   403   404   405  
407   408   409   410   411   417   423   424   448   452   454   455   485   486   495   496   499   500   509   510  
512   516   517   521   547   548   549   550   551   552   553   570   578   579   580   581   588   589   590   591  
598   599   601   602   606   613   636   645   647   648   651   652   653   662   663   667   675   676   680   681  
690   693   694   695   729   730   740   741   742   743   744   745   746   747   748   749   750   753   754   755  
756   758   759   765   766   785   796   806   807   808   809   810   817   829   830   831   834   835   836   837  
842   843   844   866   870   873   924   925   927   928   929   931   932   933   942   943   946   949   950   951  
952   963   964   965   968   969   970   971   975   1002   1003   1004   1005   1006   1007   1008   1010   1015   1018   1024  
1036   1045   1050   1051   1054   1055   1056   1057   1058   1061   1062   1063   1064   1067   1068   1069   1070   1071   1072   1084  
1085   1088   1089   1091   1092   1093   1094   1095   1097   1098   1104   1105   1106   1107   1108   1122   1123   1125   1126   1129  
1130   1154   1159   1162   1165   1166   1167   1168   1171   1172   1185   1186   1187   1191   1192   1193   1198   1199   1201   1202  
1205   1206   1208   1209   1211   1219   1220   1230   1232   1233   1234   1235   1238   1239   1263   1264   1265   1266   1269   1270  
1271   1279   1288   1291   1300   1303   1304   1306   1307   1308   1310   1311   1312   1313   1314   1315   1322   1323   1325   1326  
1335   1336   1337   1338   1343   1345   1346   1347   1352   1353   1357   1359   1360   1363   1391   1394   1395   1396   1397   1402  
1403   1405   1406   1414   1415   1416   1417   1429   1430   1432   1460   1461   1469   1470   1471   1474   1483   1484   1485   1489  
1490   1498   1525   1528   1529   1530   1536   1542   1543   1565   1566   1567   1568   1569   1572   1591   1592   1595   1596   1597  
1598   1599   1604   1605   1610   1611   1616   1617   1622   1623   1624   1625   1640   1641   1642   1643   1650   1651   1653   1654  
1667   1668   1669   1670   1671   1672   1673   1674   1682   1685   1686   1687   1688   1689   1691   1692   1693   1694   1711   1712  
1713   1714   1734   1737   1738   1745   1750   1751   1752   1753   1756   1757   1760   1761   1763   1764   1770   1773   1788   1792  
1793   1795   1796   1797   1798   1805   1807   1808   1809   1817   1822   1823   1826   1827   1828   1829   1831   1832   1833   1834  
1835   1838   1839   1840   1841   1859   1860   1864   1868   1869   1870   1871   1872   1901   1902   1903   1920   1921   1922   1923  
1924   1928   1930   1933   1958   1961   1962   1965   1966   1967   1969   1970   1985   1986   1987   1988   1989   1996   2017   2018  
2056   2063   2064   2066   2067   2068   2071   2072   2075   2098   2099   2101   2105   2106   2107   2113   2118   2119   2120   2121  
2122   2126   2127   2128   2133   2134   2144   2145   2146   2147   2148   2149   2151   2152   2153   2157   2158   2159   2182   2183  
2184   2186   2193   2194   2195   2196   2198   2199   2200   2201   2202   2203   2206   2207   2208   2209   2210   2214   2223   2224  
2225   2237   2250   2251   2285   2287   2289   2293   2294   2295   2296   2298   2299   2304   2305   2307   2308   2316   2317   2336  
2337   2338   2339   2345   2346   2351   2352   2355   2356   2357   2370   2373   2374   2375   2376   2377   2379   2380   2407   2408  
2410   2411   2412   2413   2414   2415   2417   2424   2425   2426   2429   2430   2431   2433   2434   2435   2437   2438   2439   2442  
2443   2458   2459   2460   2461   2462   2463   2464   2465   2466   2490   2495   2496   2497   2499   2500   2502   2503   2504   2505  
2508   2512   2513   2514   2516   2523   2524   2525   2526   2527   2531   2532   2533   2534   2535   2539   2541   2544   2545   2548  
2549   2550   2551   2552   2562   2563   2564   2565   2569   2570   2571   2572   2573   2574   2575   2577   2578   2579   2583   2589  
2590   2591   2592   2593   2601   2607   2608   2610   2615   2618   2619   2620   2627   2628   2629   2632   2633   2638   2650   2669  
2679   2682   2683   2684   2692   2694   2696   2699   2706   2711   2712   2716   2717   2718   2725   2726   2729   2730   2737   2738  
2750   2751   2779   2780   2783   2784   2785   2787   2788   2789   2790   2791   2800   2801   2802   2803   2811   2832   2833   2834  
2859   2860   2862   2874   2877   2878   2879   2880   2884   2885   2886   2887   2929   2930   2931   2933   2935   2939   2940   2941  
2942   2943   2944   2948   2950   2951   2952   2953   2956   2957   2958   2959   2960   2962   2964   2971   2980   2996   2997   2998  
3000   3001   3003   3008   3028   3029   3030   3031   3032   3033   3035   3036   3037   3038   3041   3046   3047   3048   3049   3050  
3051   3052   3055   3056   3068   3069   3070  
Biltr, Ernai 596   1578  
Biltr, Ernai, Rnaxs 237   511   1037   1210   1618   2100   2286  
Biltr, Sidirect 488   515   603   610   757   760   910   1011   1119   1779   1806   1932   1955   2164   2484   2546   2555   2584   2689   2697  
2889  
Biltr, Ernai, Rnaxs, Sidirect 3043  
Biltr, Rnaxs, Sidirect 600   646   909   1009   1016   1065   1066   1774   2378   2416   2440   2501   2509   2510   2511   2515   2538   2540   2553   2680  
2693   2934   2961   2963   2994   2995   2999   3002   3004   3034   3042   3044   3071  


Target Position: 2584, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2584GUAAAAACAGCAUUGCUUU81.2572662

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2582-2604TTGTAAAAACAGCATTGCTTTGTAAAGCAAUGCUGUUUUUACAAGUAAAAACAGCAUUGCUUUGUU18.50.01


Target Position: 2618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2618AUUAAUAAUCAGCAAGAAU79.2755807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6682636ATTAATAATCAGCAAGAATATTCTTGCTGATTATTAAT0.151100.100300.500000.500001.000001.00000


Target Position: 2526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2526UAAAAUUUUCUACUCUUUU71.43741485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5522544TAAAATTTTCTACTCTTTTAAAAGAGTAGAAAATTTTA0.811600.167000.534500.500001.000001.00000


Target Position: 1670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1670ACAGGACCUCUUUCAAUGA82.4994578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7701688ACAGGACCTCTTTCAATGATCATTGAAAGAGGTCCTGT0.148900.014200.482800.500001.000001.00000


Target Position: 2509, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2509GCGAAUCUUUUUUAGCAUA90.134178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4562527GCGAATCTTTTTTAGCATATATGCTAAAAAAGATTCGC0.088000.022400.879301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2507-2529TTGCGAATCTTTTTTAGCATAAAUAUGCUAAAAAAGAUUCGCAAGCGAAUCUUUUUUAGCAUAAAU19.721.032


Target Position: 2930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2930UGAAGCUAUUUAUCUGUAG69.1791677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6832948TGAAGCTATTTATCTGTAGCTACAGATAAATAGCTTCA0.032800.004400.551700.500001.000001.00000


Target Position: 1015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1015UGAAGAAAAUGAAGAUGAA93.268493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5311033TGAAGAAAATGAAGATGAATTCATCTTCATTTTCTTCA0.504100.142400.551700.750001.000001.00000


Target Position: 1470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1470CUCAUACCAGCCAUCCAAU79.7479768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5801488CTCATACCAGCCATCCAATATTGGATGGCTGGTATGAG0.050100.013900.801700.750001.000001.00000


Target Position: 785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
785CCCAUCCCAGACGAAGACA71.7371462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
644803CCCATCCCAGACGAAGACATGTCTTCGTCTGGGATGGG0.067600.003900.784500.750000.902200.62500


Target Position: 925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
925UCUACCAUCAGAGUCAAAG57.00252575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
565943TCTACCATCAGAGTCAAAGCTTTGACTCTGATGGTAGA0.055600.009500.586200.500001.000001.00000


Target Position: 232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
232CCUGGCGCAGAUCGAUUUG59.7422412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484250CCTGGCGCAGATCGATTTGCAAATCGATCTGCGCCAGG0.270900.011300.698300.750000.983700.62500


Target Position: 2885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2885CCCCCUCUAGAAAUUUUUC64.31672070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6822903CCCCCTCTAGAAATTTTTCGAAAAATTTCTAGAGGGGG0.032900.004000.819000.750001.000001.00000


Target Position: 1685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1685AUGACAACGCAGCAGAGUA86.2072344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7791703ATGACAACGCAGCAGAGTATACTCTGCTGCGTTGTCAT0.120200.103900.474100.500001.000001.00000


Target Position: 2711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2711AUGUAUUCCUGAUCGCCAA83.9396481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6922729ATGTATTCCTGATCGCCAATTGGCGATCAGGAATACAT0.531000.101900.508600.500001.000001.00000


Target Position: 86, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
86CGCCAUCCUCGUCCCGUCC55.22052673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
650104CGCCATCCTCGTCCCGTCCGGACGGGACGAGGATGGCG0.230300.125400.551700.500001.000001.00000


Target Position: 2193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2193GUCGAAGAAGGUGUGGGCA75.10931150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8122211GTCGAAGAAGGTGTGGGCATGCCCACACCTTCTTCGAC0.179800.049200.465500.500001.000001.00000


Target Position: 591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
591CCUUUGAUGGACCAAUUAC71.69041464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
695609CCTTTGATGGACCAATTACGTAATTGGTCCATCAAAGG0.069900.002800.663800.750001.000001.00000


Target Position: 2953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2953CUAUUUAUCUGUGUUUUUG71.94191431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5762971CTATTTATCTGTGTTTTTGCAAAAACACAGATAAATAG0.197700.122800.525900.500001.000001.00000


Target Position: 2750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2750GACAUUUCCCAGGGUUAAU77.0769987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232768GACATTTCCCAGGGTTAATATTAACCCTGGGAAATGTC0.012700.001700.810300.750001.000001.00000


Target Position: 2879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2879AACAGACCCCCUCUAGAAA83.7158493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952897AACAGACCCCCTCTAGAAATTTCTAGAGGGGGTCTGTT0.473700.138800.646600.500000.934800.75000


Target Position: 1868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1868UACCCACACACGAAGGAAA79.9929753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6791886TACCCACACACGAAGGAAATTTCCTTCGTGTGTGGGTA0.043200.039900.681000.500000.918500.62500


Target Position: 2514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2514UCUUUUUUAGCAUAAAAUU70.33471577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4792532TCTTTTTTAGCATAAAATTAATTTTATGCTAAAAAAGA0.078700.065700.715500.750001.000001.00000


Target Position: 2293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2293GUCUCAGGAAAUGGUGCAU75.23431142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5822311GTCTCAGGAAATGGTGCATATGCACCATTTCCTGAGAC0.099200.006300.663800.750001.000001.00000


Target Position: 2431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2431GAAACAACCGUUGGAAACA83.8297488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8152449GAAACAACCGTTGGAAACATGTTTCCAACGGTTGTTTC0.065000.040500.465500.500001.000001.00000


Target Position: 2550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2550UUUGUGUUUUGUUCUUUAA76.75021020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8112568TTTGTGTTTTGTTCTTTAATTAAAGAACAAAACACAAA0.344900.072800.465500.500001.000001.00000


Target Position: 551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
551CCUGAAGAAGAUUGUACAU85.6376379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801569CCTGAAGAAGATTGTACATATGTACAATCTTCTTCAGG0.029800.001300.689701.000001.000001.00000


Target Position: 2619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2619UUAAUAAUCAGCAAGAAUU72.34221388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6312637TTAATAATCAGCAAGAATTAATTCTTGCTGATTATTAA0.105600.071800.525900.500001.000001.00000


Target Position: 2706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2706CACAUAUGUAUUCCUGAUC70.21531584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6982724CACATATGTATTCCTGATCGATCAGGAATACATATGTG0.408000.096400.612100.500001.000001.00000


Target Position: 1988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1988GGAGACCAAGACACAUUCC70.06471600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6542006GGAGACCAAGACACATTCCGGAATGTGTCTTGGTCTCC0.145100.034800.500000.500001.000001.00000


Target Position: 1920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1920CUGGGUCCUUUGGAGUUAC64.27062074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7651938CTGGGTCCTTTGGAGTTACGTAACTCCAAAGGACCCAG0.020900.002300.603400.500000.972801.00000


Target Position: 1154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1154CAGUGGAACCCAAGCCAUU82.1348603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8171172CAGTGGAACCCAAGCCATTAATGGCTTGGGTTCCACTG0.087100.001200.775900.750000.972800.62500


Target Position: 2512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2512AAUCUUUUUUAGCAUAAAA89.055211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6442530AATCTTTTTTAGCATAAAATTTTATGCTAAAAAAGATT0.071700.020300.508600.500001.000001.00000


Target Position: 1107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1107CCACACCACGGGCCUUUGA71.3581497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831125CCACACCACGGGCCTTTGATCAAAGGCCCGTGGTGTGG0.162600.011500.620700.750000.907600.87500


Target Position: 2407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2407ACACCUACACCAUUAUCUU82.7471563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7582425ACACCTACACCATTATCTTAAGATAATGGTGTAGGTGT0.038800.001800.569000.750001.000001.00000


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675AAGACAUCUACCCCAGCAA83.0526546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
734693AAGACATCTACCCCAGCAATTGCTGGGGTAGATGTCTT0.344600.053500.491400.500001.000001.00000


Target Position: 1595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1595AUGGACUCCAGUCAUAGUA76.9908998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7821613ATGGACTCCAGTCATAGTATACTATGACTGGAGTCCAT0.063900.004900.474100.500000.956500.87500


Target Position: 2378, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2378CAGAAUGUGGACAUGAAGA88.6305234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5252396CAGAATGTGGACATGAAGATCTTCATGTCCACATTCTG0.193200.018700.560300.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2376-2398TGCAGAATGTGGACATGAAGATTUCUUCAUGUCCACAUUCUGCACAGAAUGUGGACAUGAAGAUUU18.119.222


Target Position: 1084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1084UUUUAUCUCCAGCACCAUU69.58471645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8261102TTTTATCTCCAGCACCATTAATGGTGCTGGAGATAAAA0.237000.045300.491400.500001.000001.00000


Target Position: 2951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2951AACUAUUUAUCUGUGUUUU76.02261077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5782969AACTATTTATCTGTGTTTTAAAACACAGATAAATAGTT0.206500.123600.646600.500001.000001.00000


Target Position: 299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
299CGCUACAGCAUCUCUCGGA83.3179525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
732317CGCTACAGCATCTCTCGGATCCGAGAGATGCTGTAGCG0.038700.002100.551700.750000.983700.75000


Target Position: 1831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1831AGGCUCAACUACUUUACUG73.40511304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911849AGGCTCAACTACTTTACTGCAGTAAAGTAGTTGAGCCT0.074600.013700.560300.500001.000001.00000


Target Position: 2294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2294UCUCAGGAAAUGGUGCAUU63.3572146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5982312TCTCAGGAAATGGTGCATTAATGCACCATTTCCTGAGA0.060000.005500.715500.750001.000001.00000


Target Position: 2730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2730CCUUUCCCCCACCAGCUAA78.3753871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2772748CCTTTCCCCCACCAGCTAATTAGCTGGTGGGGGAAAGG0.193300.061600.810301.000001.000001.00000


Target Position: 2198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2198AGAAGGUGUGGGCAGAAGA81.341654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6802216AGAAGGTGTGGGCAGAAGATCTTCTGCCCACACCTTCT0.239500.124100.500000.500001.000001.00000


Target Position: 2484, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2484GCAAUGUGCUACUGAUUGU84.9332412

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2482-2504ATGCAATGTGCTACTGATTGTTTACAAUCAGUAGCACAUUGCAUGCAAUGUGCUACUGAUUGUUUU18.118.122


Target Position: 1569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1569GUCAUCAAGCAGGAAGAAG65.19241989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5931587GTCATCAAGCAGGAAGAAGCTTCTTCCTGCTTGATGAC0.142700.059100.681000.500001.000001.00000


Target Position: 1363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1363AACAGCUACCCAGAAGGAA76.03581075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7941381AACAGCTACCCAGAAGGAATTCCTTCTGGGTAGCTGTT0.182500.028500.474100.500000.923900.62500


Target Position: 2072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2072GAAGGUGGAGCAAACACAA96.056638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7392090GAAGGTGGAGCAAACACAATTGTGTTTGCTCCACCTTC0.104100.002000.525900.750000.994600.75000


Target Position: 3, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3GAGACCCAAGCUUCUAGAG71.63951470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
76821GAGACCCAAGCTTCTAGAGCTCTAGAAGCTTGGGTCTC0.019800.020500.500000.500000.978300.62500


Target Position: 1304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1304GAAGAGACCCCACAUUCUA94.621962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6911322GAAGAGACCCCACATTCTATAGAATGTGGGGTCTCTTC0.517700.053500.500000.750001.000001.00000


Target Position: 3029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3029CAGAGGCACAAAAGGGUUU73.9531255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5893047CAGAGGCACAAAAGGGTTTAAACCCTTTTGTGCCTCTG0.146600.005800.784500.750001.000001.00000


Target Position: 238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
238GCAGAUCGAUUUGAAUAUA93.741379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
292256GCAGATCGATTTGAATATATATATTCAAATCGATCTGC0.185400.072900.810301.000001.000001.00000


Target Position: 552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
552CUGAAGAAGAUUGUACAUC64.28542072

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
825570CTGAAGAAGATTGTACATCGATGTACAATCTTCTTCAG0.022400.001000.603400.500000.972800.62500


Target Position: 2632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2632AGAAUUUGAUCGUUCAGUU84.8227422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5782650AGAATTTGATCGTTCAGTTAACTGAACGATCAAATTCT0.071400.006400.577600.750001.000001.00000


Target Position: 2146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2146CCUCUUGGCCUUGGCUUUG56.00272636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7932164CCTCTTGGCCTTGGCTTTGCAAAGCCAAGGCCAAGAGG0.016400.001400.698300.750000.940201.00000


Target Position: 1542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1542ACCCAAUCUCACACCCCAU75.32291133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4191560ACCCAATCTCACACCCCATATGGGGTGTGAGATTGGGT0.103600.026800.698300.750001.000001.00000


Target Position: 806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
806CCCUGGAUCACCGACAGCA79.3812797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
620824CCCTGGATCACCGACAGCATGCTGTCGGTGATCCAGGG0.225800.004600.637900.750000.956501.00000


Target Position: 2939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2939UUAUCUGUAGUAAACUAUU75.63321104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5792957TTATCTGTAGTAAACTATTAATAGTTTACTACAGATAA0.407800.022200.525900.500001.000001.00000


Target Position: 2465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2465GCUGGGACACUUAACAGAU87.6818274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3482483GCTGGGACACTTAACAGATATCTGTTAAGTGTCCCAGC0.142100.021800.672401.000001.000001.00000


Target Position: 171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
171CGGACACCAUGGACAAGUU89.0356213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
500189CGGACACCATGGACAAGTTAACTTGTCCATGGTGTCCG0.405800.010100.767201.000001.000001.00000


Target Position: 2545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2545UGUUUUUUGUGUUUUGUUC61.75232271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6902563TGTTTTTTGTGTTTTGTTCGAACAAAACACAAAAAACA0.178800.107000.534500.500001.000001.00000


Target Position: 1125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1125ACCACACAAAACAGAACCA78.9731832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6151143ACCACACAAAACAGAACCATGGTTCTGTTTTGTGTGGT0.334900.239300.508600.500001.000001.00000


Target Position: 2182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2182UGCAGUCAACAGUCGAAGA80.0512749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7702200TGCAGTCAACAGTCGAAGATCTTCGACTGTTGACTGCA0.036500.001600.629300.500001.000001.00000


Target Position: 870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
870CAACUGAGACAGCAACCAA99.31312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
677888CAACTGAGACAGCAACCAATTGGTTGCTGTCTCAGTTG0.082800.036500.500000.750000.929300.75000


Target Position: 2780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2780CCUGGGAGGAAAUUUGAAU78.9518833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7092798CCTGGGAGGAAATTTGAATATTCAAATTTCCTCCCAGG0.230800.002700.836201.000001.000001.00000


Target Position: 2669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2669CCUCGGGUGUGCUAUGGAU84.2784456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8182687CCTCGGGTGTGCTATGGATATCCATAGCACACCCGAGG0.024500.001100.663801.000001.000001.00000


Target Position: 1045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1045CCUCAGUUUUUCUGGAUCA87.4074283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8011063CCTCAGTTTTTCTGGATCATGATCCAGAAAAACTGAGG0.015400.002000.620700.750000.940200.87500


Target Position: 836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
836CCUGCUACCACUUUGAUGA83.103541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
702854CCTGCTACCACTTTGATGATCATCAAAGTGGTAGCAGG0.064000.002800.620700.750001.000001.00000


Target Position: 2692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2692UCUAACAAAAACUACACAU71.9381432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4662710TCTAACAAAAACTACACATATGTGTAGTTTTTGTTAGA0.235200.103500.569000.750001.000001.00000


Target Position: 636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
636CCCGCUAUGUCCAGAAAGG63.20952157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
818654CCCGCTATGTCCAGAAAGGCCTTTCTGGACATAGCGGG0.013200.003900.646600.500000.934800.62500


Target Position: 3036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3036ACAAAAGGGUUUAAACUGA80.6417704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7573054ACAAAAGGGTTTAAACTGATCAGTTTAAACCCTTTTGT0.069000.046400.482800.500001.000001.00000


Target Position: 2525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2525AUAAAAUUUUCUACUCUUU77.7386936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6052543ATAAAATTTTCTACTCTTTAAAGAGTAGAAAATTTTAT0.823800.162700.543100.500001.000001.00000


Target Position: 2101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2101UAUAAGGACACCCCAAAUU67.14461838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5942119TATAAGGACACCCCAAATTAATTTGGGGTGTCCTTATA0.583100.029000.534500.500000.902200.75000


Target Position: 817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
817CGACAGCACAGACAGAAUC73.85791264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
396835CGACAGCACAGACAGAATCGATTCTGTCTGTGCTGTCG0.141000.035300.612100.750001.000001.00000


Target Position: 837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
837CUGCUACCACUUUGAUGAG72.05381419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
791855CTGCTACCACTTTGATGAGCTCATCAAAGTGGTAGCAG0.060500.003400.474100.500001.000001.00000


Target Position: 1872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1872CACACACGAAGGAAAGCAG75.29511138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7311890CACACACGAAGGAAAGCAGCTGCTTTCCTTCGTGTGTG0.025700.016200.508600.500001.000001.00000


Target Position: 2285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2285GCCAGCAAGUCUCAGGAAA84.915413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7522303GCCAGCAAGTCTCAGGAAATTTCCTGAGACTTGCTGGC0.047000.001801.000001.000001.000001.00000


Target Position: 1068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1068UUGAUGAUGAUGAAGAUUU68.95331696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7551086TTGATGATGATGAAGATTTAAATCTTCATCATCATCAA0.022300.003300.646600.500001.000001.00000


Target Position: 1485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1485CAAUGCAAGGAAGGACAAC66.87681856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7021503CAATGCAAGGAAGGACAACGTTGTCCTTCCTTGCATTG0.071600.006400.500000.500001.000001.00000


Target Position: 2834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2834GCAUUGCUUUCCACUGAGG67.8941787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6192852GCATTGCTTTCCACTGAGGCCTCAGTGGAAAGCAATGC0.048900.022400.508600.500000.956500.75000


Target Position: 1860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1860CCUCUCAUUACCCACACAC65.75791955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261878CCTCTCATTACCCACACACGTGTGTGGGTAATGAGAGG0.692400.212500.551700.750001.000001.00000


Target Position: 1643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1643ACAGGUUUGGUGGAAAAUU69.59981643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8161661ACAGGTTTGGTGGAAAATTAATTTTCCACCAAACCTGT0.169000.001200.698300.750001.000001.00000


Target Position: 2460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2460AGGGAGCUGGGACACUUAA82.3455590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2892478AGGGAGCTGGGACACTTAATTAAGTGTCCCAGCTCCCT0.552400.028900.810300.750000.983700.87500


Target Position: 2415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2415ACCAUUAUCUUGGAAAGAA83.1684536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3212433ACCATTATCTTGGAAAGAATTCTTTCCAAGATAATGGT0.319300.025100.681000.750000.945700.62500


Target Position: 411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
411GGUAUGGGUUCAUAGAAGG72.56711374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
767429GGTATGGGTTCATAGAAGGCCTTCTATGAACCCATACC0.041400.001600.508600.500000.967400.75000


Target Position: 2067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2067GUCAAGAAGGUGGAGCAAA82.2328598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3272085GTCAAGAAGGTGGAGCAAATTTGCTCCACCTTCTTGAC0.248200.023200.819000.750001.000001.00000


Target Position: 1325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1325AGCACAAUCCAGGCAACUC65.73181959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6611343AGCACAATCCAGGCAACTCGAGTTGCCTGGATTGTGCT0.079800.068900.543100.500000.956500.75000


Target Position: 2251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2251GGAGGACAGAAAGCCAAGU74.58241198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7452269GGAGGACAGAAAGCCAAGTACTTGGCTTTCTGTCCTCC0.045700.002000.663800.750000.934801.00000


Target Position: 1123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1123UGACCACACAAAACAGAAC66.86111858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5711141TGACCACACAAAACAGAACGTTCTGTTTTGTGTGGTCA0.327200.119300.577600.500001.000001.00000


Target Position: 2563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2563CUUUAAAGUCAGGUCCAAU84.0926471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5372581CTTTAAAGTCAGGTCCAATATTGGACCTGACTTTAAAG0.064200.049500.629300.750001.000001.00000


Target Position: 951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951UUCACACAACAACACAAAU71.78951453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513969TTCACACAACAACACAAATATTTGTGTTGTTGTGTGAA0.505800.411500.663800.500001.000001.00000


Target Position: 2462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2462GGAGCUGGGACACUUAACA88.4817237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4112480GGAGCTGGGACACTTAACATGTTAAGTGTCCCAGCTCC0.162100.015700.663800.750000.983700.75000


Target Position: 3048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3048AAACUGAUUCAUAAUAAAU86.3245336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7403066AAACTGATTCATAATAAATATTTATTATGAATCAGTTT0.858300.131300.491400.500001.000001.00000


Target Position: 1835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1835UCAACUACUUUACUGGAAG64.812028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7581853TCAACTACTTTACTGGAAGCTTCCAGTAAAGTAGTTGA0.021700.006600.586200.500001.000001.00000


Target Position: 2064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2064GGAGUCAAGAAGGUGGAGC57.71732543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7772082GGAGTCAAGAAGGTGGAGCGCTCCACCTTCTTGACTCC0.046800.001500.517200.500001.000001.00000


Target Position: 1928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1928UUUGGAGUUACUGCAGUUA71.14111511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8221946TTTGGAGTTACTGCAGTTATAACTGCAGTAACTCCAAA0.060400.001100.465500.500001.000001.00000


Target Position: 2196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2196GAAGAAGGUGUGGGCAGAA90.0188179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7192214GAAGAAGGTGTGGGCAGAATTCTGCCCACACCTTCTTC0.216100.104000.500000.750001.000001.00000


Target Position: 410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410AGGUAUGGGUUCAUAGAAG76.76531018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
794428AGGTATGGGTTCATAGAAGCTTCTATGAACCCATACCT0.031300.001300.706900.500000.967400.87500


Target Position: 932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
932UCAGAGUCAAAGAAUCAUC64.33122067

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
533950TCAGAGTCAAAGAATCATCGATGATTCTTTGACTCTGA0.216200.030200.543100.500001.000001.00000


Target Position: 1069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1069UGAUGAUGAUGAAGAUUUU87.2572291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7061087TGATGATGATGAAGATTTTAAAATCTTCATCATCATCA0.028900.002800.724100.750001.000001.00000


Target Position: 2615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2615CCAAUUAAUAAUCAGCAAG70.84341536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3362633CCAATTAATAATCAGCAAGCTTGCTGATTATTAATTGG0.147900.127700.706900.750001.000001.00000


Target Position: 2607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2607AUUAGGGCCCAAUUAAUAA82.7648559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7932625ATTAGGGCCCAATTAATAATTATTAATTGGGCCCTAAT0.538600.033800.474100.500001.000001.00000


Target Position: 2790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2790AAUUUGAAUGGGUCCAUUU77.5391951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7322808AATTTGAATGGGTCCATTTAAATGGACCCATTCAAATT0.025600.007000.508600.500000.989100.62500


Target Position: 2153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2153GCCUUGGCUUUGAUUCUUG71.43731486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8252171GCCTTGGCTTTGATTCTTGCAAGAATCAAAGCCAAGGC0.012100.003100.853400.750000.983700.75000


Target Position: 2697, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2697CAAAAACUACACAUAUGUA102.0714

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2695-2717AACAAAAACTACACATATGTATTUACAUAUGUGUAGUUUUUGUUCAAAAACUACACAUAUGUAUUU13.33.222


Target Position: 1238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1238GCUUAUGAAGGAAACUGGA85.6257381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7581256GCTTATGAAGGAAACTGGATCCAGTTTCCTTCATAAGC0.097200.017000.482800.750001.000001.00000


Target Position: 240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
240AGAUCGAUUUGAAUAUAAC81.3252657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
521258AGATCGATTTGAATATAACGTTATATTCAAATCGATCT0.126900.120400.577600.500001.000001.00000


Target Position: 2712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2712UGUAUUCCUGAUCGCCAAC57.32622564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5352730TGTATTCCTGATCGCCAACGTTGGCGATCAGGAATACA0.399900.093800.560300.500001.000001.00000


Target Position: 2439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2439CGUUGGAAACAUAACCAUU88.8792222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4242457CGTTGGAAACATAACCATTAATGGTTATGTTTCCAACG0.102100.021100.767201.000000.902200.62500


Target Position: 2466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2466CUGGGACACUUAACAGAUG74.50711205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7942484CTGGGACACTTAACAGATGCATCTGTTAAGTGTCCCAG0.082800.035800.629300.500001.000001.00000


Target Position: 663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
663GAACGAAUCCUGAAGACAU95.695343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
672681GAACGAATCCTGAAGACATATGTCTTCAGGATTCGTTC0.034300.012700.517200.750001.000001.00000


Target Position: 2738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2738CCACCAGCUAAGGACAUUU78.5965855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6162756CCACCAGCTAAGGACATTTAAATGTCCTTAGCTGGTGG0.042800.008600.844801.000000.962000.87500


Target Position: 3000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3000AUCAGUAUAAUUUUUUAAA82.2452596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6413018ATCAGTATAATTTTTTAAATTTAAAAAATTATACTGAT0.291700.043800.681000.500001.000001.00000


Target Position: 2106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2106GGACACCCCAAAUUCCAGA80.2757729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4792124GGACACCCCAAATTCCAGATCTGGAATTTGGGGTGTCC0.145700.011700.646600.750001.000001.00000


Target Position: 1624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1624GCCUACUGCAAAUCCAAAC65.16281992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3781642GCCTACTGCAAATCCAAACGTTTGGATTTGCAGTAGGC0.122900.035300.853400.750001.000001.00000


Target Position: 1346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1346AGUAGUACAACGGAAGAAA85.9745360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2791364AGTAGTACAACGGAAGAAATTTCTTCCGTTGTACTACT0.469000.030000.706900.750001.000001.00000


Target Position: 834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
834UCCCUGCUACCACUUUGAU66.82191863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
662852TCCCTGCTACCACTTTGATATCAAAGTGGTAGCAGGGA0.129500.003500.689700.750001.000001.00000


Target Position: 1070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1070GAUGAUGAUGAAGAUUUUA93.658986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6981088GATGATGATGAAGATTTTATAAAATCTTCATCATCATC0.037900.002800.646600.750001.000001.00000


Target Position: 362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
362ACAAUGGCCCAGAUGGAGA74.92931168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
767380ACAATGGCCCAGATGGAGATCTCCATCTGGGCCATTGT0.024400.003300.482800.500000.951100.75000


Target Position: 1712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1712AGCUUCUCUACAUCACAUG66.69021873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7001730AGCTTCTCTACATCACATGCATGTGATGTAGAGAAGCT0.076500.007400.698300.500001.000001.00000


Target Position: 3038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3038AAAAGGGUUUAAACUGAUU77.2626971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7473056AAAAGGGTTTAAACTGATTAATCAGTTTAAACCCTTTT0.070800.033700.491400.500001.000001.00000


Target Position: 1605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1605GUCAUAGUACAACGCUUCA85.1438402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5831623GTCATAGTACAACGCTTCATGAAGCGTTGTACTATGAC0.121900.057300.594800.500001.000001.00000


Target Position: 759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
759UCUUUUACACCUUUUCUAC63.82962113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
662777TCTTTTACACCTTTTCTACGTAGAAAAGGTGTAAAAGA0.526300.443400.543100.500001.000001.00000


Target Position: 2307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2307UGCAUUUGGUGAACAAGGA74.87551172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7712325TGCATTTGGTGAACAAGGATCCTTGTTCACCAAATGCA0.041700.004100.482800.500001.000001.00000


Target Position: 404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
404ACCUGCAGGUAUGGGUUCA71.80351451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
824422ACCTGCAGGTATGGGTTCATGAACCCATACCTGCAGGT0.012600.003100.629300.500000.967400.62500


Target Position: 3055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3055UUCAUAAUAAAUAUCUGUA80.9781686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7423073TTCATAATAAATATCTGTATACAGATATTTATTATGAA0.615300.572100.491400.500001.000001.00000


Target Position: 1460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1460GCAGCCUCAGCUCAUACCA81.5725633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6281478GCAGCCTCAGCTCATACCATGGTATGAGCTGAGGCTGC0.164900.012400.508600.750000.913000.75000


Target Position: 397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
397AUUUGAGACCUGCAGGUAU78.2245890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
809415ATTTGAGACCTGCAGGTATATACCTGCAGGTCTCAAAT0.421700.002800.465500.500000.951100.75000


Target Position: 1004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1004UGGGAGCCAAAUGAAGAAA71.86541443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2211022TGGGAGCCAAATGAAGAAATTTCTTCATTTGGCTCCCA0.248300.040700.844800.750001.000001.00000


Target Position: 2126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2126UGGCUGAUCAUCUUGGCAU73.1961322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7992144TGGCTGATCATCTTGGCATATGCCAAGATGATCAGCCA0.068000.001300.689700.750001.000001.00000


Target Position: 1734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1734GCUUGGAAGAAGAUAAAGA90.6047161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7871752GCTTGGAAGAAGATAAAGATCTTTATCTTCTTCCAAGC0.729700.001400.629300.750001.000001.00000


Target Position: 510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
510CCUCCCAGUAUGACACAUA90.3691171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
719528CCTCCCAGTATGACACATATATGTGTCATACTGGGAGG0.043700.002400.801701.000001.000001.00000


Target Position: 2874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2874UCUUCAACAGACCCCCUCU68.53621727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6892892TCTTCAACAGACCCCCTCTAGAGGGGGTCTGTTGAAGA0.225300.076400.500000.500000.994600.62500


Target Position: 1498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1498GACAACACCAAGCCCAGAG66.88231855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6321516GACAACACCAAGCCCAGAGCTCTGGGCTTGGTGTTGTC0.040700.042800.508600.500000.967400.62500


Target Position: 747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
747CAGGAGGUUACAUCUUUUA89.647190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
706765CAGGAGGTTACATCTTTTATAAAAGATGTAACCTCCTG0.349900.002700.750000.750001.000001.00000


Target Position: 3030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3030AGAGGCACAAAAGGGUUUA73.69351283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5443048AGAGGCACAAAAGGGTTTATAAACCCTTTTGTGCCTCT0.133300.007700.689700.750001.000001.00000


Target Position: 360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
360CCACAAUGGCCCAGAUGGA82.7622560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
783378CCACAATGGCCCAGATGGATCCATCTGGGCCATTGTGG0.026000.004300.474100.750000.962000.75000


Target Position: 2811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2811CCCUUCCAUAGCCUAAUCC56.09692631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8252829CCCTTCCATAGCCTAATCCGGATTAGGCTATGGAAGGG0.124300.119200.620700.500001.000001.00000


Target Position: 830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
830AGAAUCCCUGCUACCACUU69.49911657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
538848AGAATCCCTGCTACCACTTAAGTGGTAGCAGGGATTCT0.072600.007900.586200.750001.000001.00000


Target Position: 1105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1105AACCACACCACGGGCCUUU57.6012548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8051123AACCACACCACGGGCCTTTAAAGGCCCGTGGTGTGGTT0.015200.014700.646600.500000.907600.87500


Target Position: 1291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1291GCAUCAUGAGGAAGAAGAG82.2189599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7401309GCATCATGAGGAAGAAGAGCTCTTCTTCCTCATGATGC0.044600.002000.543100.750001.000001.00000


Target Position: 1833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1833GCUCAACUACUUUACUGGA89.6023193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7741851GCTCAACTACTTTACTGGATCCAGTAAAGTAGTTGAGC0.054000.016900.482800.750001.000001.00000


Target Position: 2063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2063GGGAGUCAAGAAGGUGGAG68.27471746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7592081GGGAGTCAAGAAGGTGGAGCTCCACCTTCTTGACTCCC0.055600.001800.681000.750001.000001.00000


Target Position: 1955, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1955GAUUCCAACUCUAAUGUCA94.769461

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1953-1975GAGATTCCAACTCTAATGTCAATUGACAUUAGAGUUGGAAUCUCGAUUCCAACUCUAAUGUCAAUU16.120.122


Target Position: 744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
744CUUCAGGAGGUUACAUCUU75.99031080

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
793762CTTCAGGAGGTTACATCTTAAGATGTAACCTCCTGAAG0.280300.001300.500000.750001.000001.00000


Target Position: 237, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
237CGCAGAUCGAUUUGAAUAU83.7442492

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_223719CGCAGATCGATTTGAATAT1/1/0/097.75CD44NM_001001392.1+NM_001001390.1+NM_001001391.1+NM_000610.3+NM_001001389.11+1+1+1+1NANANANA00CD44(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
274255CGCAGATCGATTTGAATATATATTCAAATCGATCTGCG0.196300.077600.879301.000001.000001.00000


Target Position: 2495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2495CUGAUUGUUUCAUUGCGAA87.846266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6732513CTGATTGTTTCATTGCGAATTCGCAATGAAACAATCAG0.059800.003300.612100.750001.000001.00000


Target Position: 1108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1108CACACCACGGGCCUUUGAC62.02732252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8271126CACACCACGGGCCTTTGACGTCAAAGGCCCGTGGTGTG0.049400.007300.474100.500000.907600.75000


Target Position: 1686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1686UGACAACGCAGCAGAGUAA87.7804270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3881704TGACAACGCAGCAGAGTAATTACTCTGCTGCGTTGTCA0.117300.102000.689700.750001.000001.00000


Target Position: 1489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1489GCAAGGAAGGACAACACCA89.5855194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6421507GCAAGGAAGGACAACACCATGGTGTTGTCCTTCCTTGC0.436000.014700.508600.750000.962000.75000


Target Position: 1618, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1618GCUUCAGCCUACUGCAAAU90.7832152

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1161819GCTTCAGCCTACTGCAAAT1/1/0/0100.00CD44NM_001001390.1+NM_000610.3+NM_001001389.1+NM_001001392.1+NM_001001391.11+1+1+0+0NANANANA00CD44(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3761636GCTTCAGCCTACTGCAAATATTTGCAGTAGGCTGAAGC0.226000.017900.844801.000000.945701.00000


Target Position: 172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
172GGACACCAUGGACAAGUUU81.2007669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
531190GGACACCATGGACAAGTTTAAACTTGTCCATGGTGTCC0.397100.008400.870701.000001.000001.00000


Target Position: 613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
613AACUAUUGUUAACCGUGAU79.9179760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
827631AACTATTGTTAACCGTGATATCACGGTTAACAATAGTT0.042300.009700.465500.500001.000001.00000


Target Position: 2553, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2553GUGUUUUGUUCUUUAAAGU78.8522839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8132571GTGTTTTGTTCTTTAAAGTACTTTAAAGAACAAAACAC0.358000.095000.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2551-2573TTGTGTTTTGTTCTTTAAAGTCAACUUUAAAGAACAAAACACAAGUGUUUUGUUCUUUAAAGUCAU-3.812.222


Target Position: 2718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2718CCUGAUCGCCAACCUUUCC58.45772490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7852736CCTGATCGCCAACCTTTCCGGAAAGGTTGGCGATCAGG0.597800.253100.474100.500001.000001.00000


Target Position: 1986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1986CAGGAGACCAAGACACAUU86.0433354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5082004CAGGAGACCAAGACACATTAATGTGTCTTGGTCTCCTG0.168800.009800.775900.750001.000001.00000


Target Position: 581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
581CUGCCCAAUGCCUUUGAUG63.09112169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
730599CTGCCCAATGCCTTTGATGCATCAAAGGCATTGGGCAG0.025900.012400.629300.500000.972800.75000


Target Position: 1598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1598GACUCCAGUCAUAGUACAA98.107321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3801616GACTCCAGTCATAGTACAATTGTACTATGACTGGAGTC0.185400.017500.672400.750001.000001.00000


Target Position: 1969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1969UGUCAAUCGUUCCUUAUCA84.1114469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7551987TGTCAATCGTTCCTTATCATGATAAGGAACGATTGACA0.039700.016100.482800.500001.000001.00000


Target Position: 1967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1967AAUGUCAAUCGUUCCUUAU77.1518980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8071985AATGTCAATCGTTCCTTATATAAGGAACGATTGACATT0.046900.023900.465500.500001.000001.00000


Target Position: 1271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1271CCUCCCCUCAUUCACCAUG59.26412440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7001289CCTCCCCTCATTCACCATGCATGGTGAATGAGGGGAGG0.030100.005000.689700.750000.994600.62500


Target Position: 1347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1347GUAGUACAACGGAAGAAAC76.46021042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8081365GTAGTACAACGGAAGAAACGTTTCTTCCGTTGTACTAC0.461600.030100.534500.500001.000001.00000


Target Position: 1264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1264AGCACACCCUCCCCUCAUU74.75381179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6631282AGCACACCCTCCCCTCATTAATGAGGGGAGGGTGTGCT0.035500.019300.844800.750001.000001.00000


Target Position: 2183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2183GCAGUCAACAGUCGAAGAA86.9924302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6142201GCAGTCAACAGTCGAAGAATTCTTCGACTGTTGACTGC0.045400.004900.681001.000001.000001.00000


Target Position: 1625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1625CCUACUGCAAAUCCAAACA80.1629738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4021643CCTACTGCAAATCCAAACATGTTTGGATTTGCAGTAGG0.109500.061600.637900.750000.983700.62500


Target Position: 831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831GAAUCCCUGCUACCACUUU79.804765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
624849GAATCCCTGCTACCACTTTAAAGTGGTAGCAGGGATTC0.175300.004500.672400.750001.000001.00000


Target Position: 1205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1205AGGAUGACUGAUGUAGACA83.5355507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6261223AGGATGACTGATGTAGACATGTCTACATCAGTCATCCT0.090500.018100.637900.500001.000001.00000


Target Position: 1062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1062CAGGCAUUGAUGAUGAUGA89.9354185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7801080CAGGCATTGATGATGATGATCATCATCATCAATGCCTG0.018900.005800.560300.500001.000001.00000


Target Position: 1543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1543CCCAAUCUCACACCCCAUG59.69942416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7841561CCCAATCTCACACCCCATGCATGGGGTGTGAGATTGGG0.018200.016100.836200.750001.000001.00000


Target Position: 2957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2957UUAUCUGUGUUUUUGAAAU73.48231299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6082975TTATCTGTGTTTTTGAAATATTTCAAAAACACAGATAA0.254700.123700.525900.500001.000001.00000


Target Position: 1933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1933AGUUACUGCAGUUACUGUU78.4607865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8211951AGTTACTGCAGTTACTGTTAACAGTAACTGCAGTAACT0.013000.008000.560300.750001.000001.00000


Target Position: 2880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2880ACAGACCCCCUCUAGAAAU73.33921310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3752898ACAGACCCCCTCTAGAAATATTTCTAGAGGGGGTCTGT0.215200.048600.698300.750000.934800.62500


Target Position: 1484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1484CCAAUGCAAGGAAGGACAA83.312526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6011502CCAATGCAAGGAAGGACAATTGTCCTTCCTTGCATTGG0.059500.005400.698301.000001.000001.00000


Target Position: 1591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1591GGAUAUGGACUCCAGUCAU92.5277107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6371609GGATATGGACTCCAGTCATATGACTGGAGTCCATATCC0.048200.004100.715501.000000.951100.62500


Target Position: 1987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1987AGGAGACCAAGACACAUUC68.14791762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5482005AGGAGACCAAGACACATTCGAATGTGTCTTGGTCTCCT0.147800.016300.672400.500001.000001.00000


Target Position: 1395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1395ACAGAUGGCAUGAGGGAUA81.1841671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701413ACAGATGGCATGAGGGATATATCCCTCATGCCATCTGT0.082200.022400.663800.750001.000001.00000


Target Position: 2287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2287CAGCAAGUCUCAGGAAAUG73.54561294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6452305CAGCAAGTCTCAGGAAATGCATTTCCTGAGACTTGCTG0.201000.003900.629300.500001.000001.00000


Target Position: 1209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1209UGACUGAUGUAGACAGAAA93.984477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3091227TGACTGATGTAGACAGAAATTTCTGTCTACATCAGTCA0.169200.030700.724100.750000.972800.75000


Target Position: 1270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1270CCCUCCCCUCAUUCACCAU73.03851337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7821288CCCTCCCCTCATTCACCATATGGTGAATGAGGGGAGGG0.018500.007500.836201.000001.000001.00000


Target Position: 2144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2144UCCCUCUUGGCCUUGGCUU52.4642781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7632162TCCCTCTTGGCCTTGGCTTAAGCCAAGGCCAAGAGGGA0.021200.002200.732800.750000.940200.75000


Target Position: 1567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1567AGGUCAUCAAGCAGGAAGA82.7265565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6201585AGGTCATCAAGCAGGAAGATCTTCCTGCTTGATGACCT0.179000.031400.620700.500001.000001.00000


Target Position: 1797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1797UCACAGGUGGAAGAAGAGA69.55331654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6691815TCACAGGTGGAAGAAGAGATCTCTTCTTCCACCTGTGA0.168200.004200.500000.500001.000001.00000


Target Position: 2999, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2999GAUCAGUAUAAUUUUUUAA97.354926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4753017GATCAGTATAATTTTTTAATTAAAAAATTATACTGATC0.259800.012000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2997-3019TTGATCAGTATAATTTTTTAAAGUUAAAAAAUUAUACUGAUCAAGAUCAGUAUAAUUUUUUAAAGU-9.120.322


Target Position: 1822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1822UCAUUCUGAAGGCUCAACU64.91352022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6001840TCATTCTGAAGGCTCAACTAGTTGAGCCTTCAGAATGA0.330700.006800.517200.500000.983700.75000


Target Position: 7, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7CCCAAGCUUCUAGAGAUCC57.22032568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
71325CCCAAGCTTCTAGAGATCCGGATCTCTAGAAGCTTGGG0.028000.018700.620700.500000.994600.62500


Target Position: 2627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2627CAGCAAGAAUUUGAUCGUU82.1847601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7122645CAGCAAGAATTTGATCGTTAACGATCAAATTCTTGCTG0.028100.007700.637900.750001.000001.00000


Target Position: 1007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1007GAGCCAAAUGAAGAAAAUG75.76711097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821025GAGCCAAATGAAGAAAATGCATTTTCTTCATTTGGCTC0.310400.080700.655200.500001.000001.00000


Target Position: 2555, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2555GUUUUGUUCUUUAAAGUCA86.6435322

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2553-2575GTGTTTTGTTCTTTAAAGTCAGGUGACUUUAAAGAACAAAACACGUUUUGUUCUUUAAAGUCAGGU14.65.612


Target Position: 2944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2944UGUAGUAAACUAUUUAUCU80.6535703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7652962TGTAGTAAACTATTTATCTAGATAAATAGTTTACTACA0.440700.042300.482800.500001.000001.00000


Target Position: 2501, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2501GUUUCAUUGCGAAUCUUUU82.4738581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3712519GTTTCATTGCGAATCTTTTAAAAGATTCGCAATGAAAC0.281300.041000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2499-2521TTGTTTCATTGCGAATCTTTTTTAAAAGAUUCGCAAUGAAACAAGUUUCAUUGCGAAUCUUUUUUU5.37.422


Target Position: 2149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2149CUUGGCCUUGGCUUUGAUU69.85891619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8092167CTTGGCCTTGGCTTTGATTAATCAAAGCCAAGGCCAAG0.030600.001200.629300.750000.940201.00000


Target Position: 2490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2490UGCUACUGAUUGUUUCAUU77.6768942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8192508TGCTACTGATTGTTTCATTAATGAAACAATCAGTAGCA0.023700.001100.844800.750001.000001.00000


Target Position: 1199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1199ACCACAAGGAUGACUGAUG66.68121875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7521217ACCACAAGGATGACTGATGCATCAGTCATCCTTGTGGT0.027500.005100.698300.500000.972800.75000


Target Position: 2376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2376UGCAGAAUGUGGACAUGAA92.7647100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6942394TGCAGAATGTGGACATGAATTCATGTCCACATTCTGCA0.030800.013500.681000.750001.000001.00000


Target Position: 2682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2682AUGGAUGGCUUCUAACAAA87.8404267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7352700ATGGATGGCTTCTAACAAATTTGTTAGAAGCCATCCAT0.236600.002800.655200.500001.000001.00000


Target Position: 2186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2186GUCAACAGUCGAAGAAGGU71.68571465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8042204GTCAACAGTCGAAGAAGGTACCTTCTTCGACTGTTGAC0.291700.001800.465500.500001.000001.00000


Target Position: 1805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1805GGAAGAAGAGACCCAAAUC79.6722776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5321823GGAAGAAGAGACCCAAATCGATTTGGGTCTCTTCTTCC0.065400.041100.689700.750000.983700.62500


Target Position: 2209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2209GCAGAAGAAAAAGCUAGUG68.7321714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562227GCAGAAGAAAAAGCTAGTGCACTAGCTTTTTCTTCTGC0.022100.019900.560300.750001.000001.00000


Target Position: 1674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1674GACCUCUUUCAAUGACAAC72.08511416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7581692GACCTCTTTCAATGACAACGTTGTCATTGAAAGAGGTC0.315700.015300.672400.500001.000001.00000


Target Position: 285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
285UGGAGAAAAAUGGUCGCUA76.57791033

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
648303TGGAGAAAAATGGTCGCTATAGCGACCATTTTTCTCCA0.037300.007200.672400.750001.000001.00000


Target Position: 693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
693ACCCUACUGAUGAUGACGU68.26151747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
612711ACCCTACTGATGATGACGTACGTCATCATCAGTAGGGT0.089400.015500.577600.500001.000001.00000


Target Position: 1219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1219AGACAGAAAUGGCACCACU82.4788580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7141237AGACAGAAATGGCACCACTAGTGGTGCCATTTCTGTCT0.053100.016100.517200.500001.000001.00000


Target Position: 1172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1172UCAAAUCCGGAAGUGCUAC52.27252792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8001190TCAAATCCGGAAGTGCTACGTAGCACTTCCGGATTTGA0.088100.001300.543100.500001.000001.00000


Target Position: 2203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2203GUGUGGGCAGAAGAAAAAG67.98021777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4632221GTGTGGGCAGAAGAAAAAGCTTTTTCTTCTGCCCACAC0.085700.028100.655200.500001.000001.00000


Target Position: 1651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1651GGUGGAAAAUUUGGACAGG67.44411815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6551669GGTGGAAAATTTGGACAGGCCTGTCCAAATTTTCCACC0.043600.034700.508600.500001.000001.00000


Target Position: 1654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1654GGAAAAUUUGGACAGGACA87.8002269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5871672GGAAAATTTGGACAGGACATGTCCTGTCCAAATTTTCC0.048600.012900.663800.750001.000001.00000


Target Position: 963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
963CACAAAUGGCUGGUACGUC68.90291701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
781981CACAAATGGCTGGTACGTCGACGTACCAGCCATTTGTG0.021600.009800.474100.500001.000001.00000


Target Position: 2374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2374CCUGCAGAAUGUGGACAUG72.39131384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4102392CCTGCAGAATGTGGACATGCATGTCCACATTCTGCAGG0.106800.027200.689700.750001.000001.00000


Target Position: 174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
174ACACCAUGGACAAGUUUUG65.20131987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
704192ACACCATGGACAAGTTTTGCAAAACTTGTCCATGGTGT0.043400.004500.560300.500001.000001.00000


Target Position: 2699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2699AAAACUACACAUAUGUAUU84.9993405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7992717AAAACTACACATATGTATTAATACATATGTGTAGTTTT0.161100.141600.491400.500000.945700.62500


Target Position: 1827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1827CUGAAGGCUCAACUACUUU78.3808869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2951845CTGAAGGCTCAACTACTTTAAAGTAGTTGAGCCTTCAG0.253300.030800.784500.750001.000001.00000


Target Position: 1751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1751GACCAUCCAACAACUUCUA88.7849226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6531769GACCATCCAACAACTTCTATAGAAGTTGTTGGATGGTC0.036500.028300.646600.750001.000001.00000


Target Position: 2994, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2994CCUUUGAUCAGUAUAAUUU84.7795431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7983012CCTTTGATCAGTATAATTTAAATTATACTGATCAAAGG0.220400.001300.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2992-3014GTCCTTTGATCAGTATAATTTTTAAAUUAUACUGAUCAAAGGACCCUUUGAUCAGUAUAAUUUUUU-8.012.022


Target Position: 2551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2551UUGUGUUUUGUUCUUUAAA74.61391192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5362569TTGTGTTTTGTTCTTTAAATTTAAAGAACAAAACACAA0.354900.072600.646600.500001.000001.00000


Target Position: 495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
495UCCUCACAUACAACACCUC61.21492304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
534513TCCTCACATACAACACCTCGAGGTGTTGTATGTGAGGA0.417500.153700.560300.500001.000001.00000


Target Position: 829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
829CAGAAUCCCUGCUACCACU84.1446467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
733847CAGAATCCCTGCTACCACTAGTGGTAGCAGGGATTCTG0.089700.014900.577600.500000.989100.62500


Target Position: 1834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1834CUCAACUACUUUACUGGAA83.2842527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6741852CTCAACTACTTTACTGGAATTCCAGTAAAGTAGTTGAG0.034200.012800.637900.750001.000001.00000


Target Position: 1091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1091UCCAGCACCAUUUCAACCA65.41041977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6351109TCCAGCACCATTTCAACCATGGTTGAAATGGTGCTGGA0.633800.127700.525900.500001.000001.00000


Target Position: 2118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2118UUCCAGAAUGGCUGAUCAU70.59381557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6912136TTCCAGAATGGCTGATCATATGATCAGCCATTCTGGAA0.050700.005900.517200.500000.956500.75000


Target Position: 142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
142CUCCUUUCGCCCGCGCCCU50.62322847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
800160CTCCTTTCGCCCGCGCCCTAGGGCGCGGGCGAAAGGAG0.075200.040400.465500.500000.902200.87500


Target Position: 942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
942AGAAUCAUCUUCACACAAC73.30411311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
748960AGAATCATCTTCACACAACGTTGTGTGAAGATGATTCT0.700000.192000.577600.500001.000001.00000


Target Position: 235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
235GGCGCAGAUCGAUUUGAAU87.7467271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
374253GGCGCAGATCGATTTGAATATTCAAATCGATCTGCGCC0.219000.018000.991401.000001.000001.00000


Target Position: 2693, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2693CUAACAAAAACUACACAUA92.4035110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3612711CTAACAAAAACTACACATATATGTGTAGTTTTTGTTAG0.256300.206200.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2691-2713TTCTAACAAAAACTACACATATGUAUGUGUAGUUUUUGUUAGAACUAACAAAAACUACACAUAUGU20.47.232


Target Position: 35, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
35GAGAUCCAUUGUGCUCUAA89.6192192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
26853GAGATCCATTGTGCTCTAATTAGAGCACAATGGATCTC0.315700.168400.775900.750001.000001.00000


Target Position: 1829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1829GAAGGCUCAACUACUUUAC70.78631540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7481847GAAGGCTCAACTACTTTACGTAAAGTAGTTGAGCCTTC0.258300.043600.491400.500001.000001.00000


Target Position: 2516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2516UUUUUUAGCAUAAAAUUUU65.12331999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7122534TTTTTTAGCATAAAATTTTAAAATTTTATGCTAAAAAA0.153200.057500.500000.500001.000001.00000


Target Position: 1234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1234CACUGCUUAUGAAGGAAAC71.85491444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771252CACTGCTTATGAAGGAAACGTTTCCTTCATAAGCAGTG0.078300.002200.646600.500001.000001.00000


Target Position: 2784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2784GGAGGAAAUUUGAAUGGGU85.5382387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6102802GGAGGAAATTTGAATGGGTACCCATTCAAATTTCCTCC0.048000.009200.517200.750001.000001.00000


Target Position: 2510, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2510CGAAUCUUUUUUAGCAUAA88.7309227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4732528CGAATCTTTTTTAGCATAATTATGCTAAAAAAGATTCG0.081100.021300.758601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2508-2530TGCGAATCTTTTTTAGCATAAAAUUAUGCUAAAAAAGAUUCGCACGAAUCUUUUUUAGCAUAAAAU20.914.832


Target Position: 1903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1903AGUGACCUCAGCUAAGACU74.58461197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8211921AGTGACCTCAGCTAAGACTAGTCTTAGCTGAGGTCACT0.024200.001500.500000.500001.000001.00000


Target Position: 753, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
753GUUACAUCUUUUACACCUU84.4071450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
640771GTTACATCTTTTACACCTTAAGGTGTAAAAGATGTAAC0.452600.033000.508600.750001.000001.00000


Target Position: 1745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1745GAUAAAGACCAUCCAACAA95.82341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5691763GATAAAGACCATCCAACAATTGTTGGATGGTCTTTATC0.365600.259700.534500.750001.000001.00000


Target Position: 3043, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3043GGUUUAAACUGAUUCAUAA106.5412

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5304319GGTTTAAACTGATTCATAA1/1/0/096.22CD44NM_001001391.1+NM_001001390.1+NM_001001392.1+NM_000610.3+NM_001001389.11+1+1+1+1NANANA11:35251529..35251547(+)00CD44(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3023061GGTTTAAACTGATTCATAATTATGAATCAGTTTAAACC0.178200.037300.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3041-3063AGGGTTTAAACTGATTCATAATAUUAUGAAUCAGUUUAAACCCUGGUUUAAACUGAUUCAUAAUAU8.70.033


Target Position: 964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
964ACAAAUGGCUGGUACGUCU76.84431014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
762982ACAAATGGCTGGTACGTCTAGACGTACCAGCCATTTGT0.033000.008500.482800.500001.000001.00000


Target Position: 5, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5GACCCAAGCUUCUAGAGAU95.797442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
79423GACCCAAGCTTCTAGAGATATCTCTAGAAGCTTGGGTC0.016400.015400.637900.750000.978300.62500


Target Position: 234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
234UGGCGCAGAUCGAUUUGAA84.9437411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
496252TGGCGCAGATCGATTTGAATTCAAATCGATCTGCGCCA0.231300.010200.672400.750001.000001.00000


Target Position: 1753, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1753CCAUCCAACAACUUCUACU80.3788721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7411771CCATCCAACAACTTCTACTAGTAGAAGTTGTTGGATGG0.023900.017500.637900.750001.000001.00000


Target Position: 2122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2122AGAAUGGCUGAUCAUCUUG68.86641704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7122140AGAATGGCTGATCATCTTGCAAGATGATCAGCCATTCT0.082000.002600.577600.500000.956500.62500


Target Position: 933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
933CAGAGUCAAAGAAUCAUCU83.8998484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
773951CAGAGTCAAAGAATCATCTAGATGATTCTTTGACTCTG0.219300.031500.560300.500001.000001.00000


Target Position: 3042, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3042GGGUUUAAACUGAUUCAUA100.2676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3043060GGGTTTAAACTGATTCATATATGAATCAGTTTAAACCC0.176500.032000.948301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3040-3062AAGGGTTTAAACTGATTCATAATUAUGAAUCAGUUUAAACCCUUGGGUUUAAACUGAUUCAUAAUU16.214.022


Target Position: 2884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2884ACCCCCUCUAGAAAUUUUU64.4212057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5452902ACCCCCTCTAGAAATTTTTAAAAATTTCTAGAGGGGGT0.063000.007700.853400.750001.000001.00000


Target Position: 2194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2194UCGAAGAAGGUGUGGGCAG54.58572697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8162212TCGAAGAAGGTGTGGGCAGCTGCCCACACCTTCTTCGA0.191700.106200.508600.500001.000001.00000


Target Position: 408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
408GCAGGUAUGGGUUCAUAGA89.0568210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
622426GCAGGTATGGGTTCATAGATCTATGAACCCATACCTGC0.042000.006900.629300.750000.967400.75000


Target Position: 931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
931AUCAGAGUCAAAGAAUCAU73.64311287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
819949ATCAGAGTCAAAGAATCATATGATTCTTTGACTCTGAT0.218100.030300.525900.500001.000001.00000


Target Position: 1003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1003CUGGGAGCCAAAUGAAGAA85.485391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3991021CTGGGAGCCAAATGAAGAATTCTTCATTTGGCTCCCAG0.237400.028900.612100.750000.972800.62500


Target Position: 2425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2425UGGAAAGAAACAACCGUUG57.28822565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5962443TGGAAAGAAACAACCGTTGCAACGGTTGTTTCTTTCCA0.075000.073600.698300.500001.000001.00000


Target Position: 2206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2206UGGGCAGAAGAAAAAGCUA81.2796658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5822224TGGGCAGAAGAAAAAGCTATAGCTTTTTCTTCTGCCCA0.049600.009900.672400.750001.000001.00000


Target Position: 2424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2424UUGGAAAGAAACAACCGUU67.8631788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7592442TTGGAAAGAAACAACCGTTAACGGTTGTTTCTTTCCAA0.103700.061900.500000.500001.000001.00000


Target Position: 2430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2430AGAAACAACCGUUGGAAAC62.0912245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5532448AGAAACAACCGTTGGAAACGTTTCCAACGGTTGTTTCT0.065600.045200.577600.500001.000001.00000


Target Position: 1336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1336GGCAACUCCUAGUAGUACA92.6607103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3891354GGCAACTCCTAGTAGTACATGTACTACTAGGAGTTGCC0.115400.028300.793100.750001.000001.00000


Target Position: 2638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2638UGAUCGUUCAGUUCCACUU74.85151173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6702656TGATCGTTCAGTTCCACTTAAGTGGAACTGAACGATCA0.035000.006600.586200.750001.000001.00000


Target Position: 2960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2960UCUGUGUUUUUGAAAUAUU74.63241190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2282978TCTGTGTTTTTGAAATATTAATATTTCAAAAACACAGA0.492200.145400.715500.750001.000001.00000


Target Position: 694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
694CCCUACUGAUGAUGACGUG72.91261346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
617712CCCTACTGATGATGACGTGCACGTCATCATCAGTAGGG0.042600.005500.698300.750001.000001.00000


Target Position: 2544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2544UUGUUUUUUGUGUUUUGUU64.82052027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6562562TTGTTTTTTGTGTTTTGTTAACAAAACACAAAAAACAA0.154600.102000.500000.500001.000001.00000


Target Position: 547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
547UCCACCUGAAGAAGAUUGU57.92822529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
749565TCCACCTGAAGAAGATTGTACAATCTTCTTCAGGTGGA0.064400.001900.663800.500001.000001.00000


Target Position: 553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
553UGAAGAAGAUUGUACAUCA95.191750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
795571TGAAGAAGATTGTACATCATGATGTACAATCTTCTTCA0.019700.001300.500000.500000.972800.62500


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623AGCCUACUGCAAAUCCAAA87.3735285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3241641AGCCTACTGCAAATCCAAATTTGGATTTGCAGTAGGCT0.160400.038400.853400.750000.983700.75000


Target Position: 3046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3046UUAAACUGAUUCAUAAUAA83.2388530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7643064TTAAACTGATTCATAATAATTATTATGAATCAGTTTAA0.475100.050600.500000.500001.000001.00000


Target Position: 2787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2787GGAAAUUUGAAUGGGUCCA76.09351072

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7892805GGAAATTTGAATGGGTCCATGGACCCATTCAAATTTCC0.017300.017100.525900.750001.000001.00000


Target Position: 2098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2098UCCUAUAAGGACACCCCAA78.1305903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5162116TCCTATAAGGACACCCCAATTGGGGTGTCCTTATAGGA0.204500.009100.724100.750000.902200.62500


Target Position: 2943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2943CUGUAGUAAACUAUUUAUC71.31961501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5072961CTGTAGTAAACTATTTATCGATAAATAGTTTACTACAG0.427800.036900.603400.500001.000001.00000


Target Position: 2570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2570GUCAGGUCCAAUUUGUAAA86.1601349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4832588GTCAGGTCCAATTTGTAAATTTACAAATTGGACCTGAC0.077800.017100.819000.750001.000001.00000


Target Position: 1798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1798CACAGGUGGAAGAAGAGAC73.35171307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7961816CACAGGTGGAAGAAGAGACGTCTCTTCTTCCACCTGTG0.142900.004200.474100.500001.000001.00000


Target Position: 599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
599GGACCAAUUACCAUAACUA102.2683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
776617GGACCAATTACCATAACTATAGTTATGGTAATTGGTCC0.019300.008100.698301.000001.000001.00000


Target Position: 2158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2158GGCUUUGAUUCUUGCAGUU84.0167473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7852176GGCTTTGATTCTTGCAGTTAACTGCAAGAATCAAAGCC0.018000.002900.853401.000001.000001.00000


Target Position: 1323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1323CAAGCACAAUCCAGGCAAC76.84761013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7011341CAAGCACAATCCAGGCAACGTTGCCTGGATTGTGCTTG0.192800.111100.500000.500000.956500.75000


Target Position: 1067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1067AUUGAUGAUGAUGAAGAUU71.94461430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6961085ATTGATGATGATGAAGATTAATCTTCATCATCATCAAT0.448400.004200.500000.500001.000001.00000


Target Position: 2729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2729ACCUUUCCCCCACCAGCUA69.93821611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2822747ACCTTTCCCCCACCAGCTATAGCTGGTGGGGGAAAGGT0.293000.162200.681000.750001.000001.00000


Target Position: 87, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
87GCCAUCCUCGUCCCGUCCU59.72522414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
283105GCCATCCTCGTCCCGTCCTAGGACGGGACGAGGATGGC0.222600.197900.655200.750001.000001.00000


Target Position: 1307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1307GAGACCCCACAUUCUACAA90.9617146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2661325GAGACCCCACATTCTACAATTGTAGAATGTGGGGTCTC0.527900.425500.663800.750001.000001.00000


Target Position: 844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844CACUUUGAUGAGCACUAGU80.4288718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
816862CACTTTGATGAGCACTAGTACTAGTGCTCATCAAAGTG0.013300.003900.586200.500001.000001.00000


Target Position: 548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
548CCACCUGAAGAAGAUUGUA87.9202262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
713566CCACCTGAAGAAGATTGTATACAATCTTCTTCAGGTGG0.063100.002600.663801.000001.000001.00000


Target Position: 2578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2578CAAUUUGUAAAAACAGCAU81.7932624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7392596CAATTTGTAAAAACAGCATATGCTGTTTTTACAAATTG0.140600.016900.491400.750000.994601.00000


Target Position: 1279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1279CAUUCACCAUGAGCAUCAU89.1157206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8221297CATTCACCATGAGCATCATATGATGCTCATGGTGAATG0.019100.001000.500000.750001.000001.00000


Target Position: 36, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
36AGAUCCAUUGUGCUCUAAA89.7028188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
26254AGATCCATTGTGCTCTAAATTTAGAGCACAATGGATCT0.310800.175800.724100.750001.000001.00000


Target Position: 2373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2373ACCUGCAGAAUGUGGACAU73.52611296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4362391ACCTGCAGAATGTGGACATATGTCCACATTCTGCAGGT0.097500.017000.698300.750001.000001.00000


Target Position: 1359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1359AAGAAACAGCUACCCAGAA83.6684495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8241377AAGAAACAGCTACCCAGAATTCTGGGTAGCTGTTTCTT0.045400.021500.465500.500001.000001.00000


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590GCCUUUGAUGGACCAAUUA85.7786373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
692608GCCTTTGATGGACCAATTATAATTGGTCCATCAAAGGC0.366000.002900.965501.000001.000001.00000


Target Position: 424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
424AGAAGGGCAUGUGGUGAUU73.34471308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
815442AGAAGGGCATGTGGTGATTAATCACCACATGCCCTTCT0.013700.003600.715500.750001.000001.00000


Target Position: 1490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1490CAAGGAAGGACAACACCAA94.373972

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7161508CAAGGAAGGACAACACCAATTGGTGTTGTCCTTCCTTG0.588900.011200.500000.750000.962000.75000


Target Position: 2996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2996UUUGAUCAGUAUAAUUUUU71.81151449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6513014TTTGATCAGTATAATTTTTAAAAATTATACTGATCAAA0.278800.004000.500000.500001.000001.00000


Target Position: 1596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1596UGGACUCCAGUCAUAGUAC67.92491783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6661614TGGACTCCAGTCATAGTACGTACTATGACTGGAGTCCA0.082800.008600.663800.500000.956500.75000


Target Position: 2434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2434ACAACCGUUGGAAACAUAA80.3144728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2732452ACAACCGTTGGAAACATAATTATGTTTCCAACGGTTGT0.831000.030600.672400.750001.000001.00000


Target Position: 2589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2589AACAGCAUUGCUUUGUAAA81.2418663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8072607AACAGCATTGCTTTGTAAATTTACAAAGCAATGCTGTT0.022500.001900.646600.500000.962000.87500


Target Position: 1471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1471UCAUACCAGCCAUCCAAUG58.25982504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7091489TCATACCAGCCATCCAATGCATTGGATGGCTGGTATGA0.028300.009400.569000.500001.000001.00000


Target Position: 2119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2119UCCAGAAUGGCUGAUCAUC56.95552580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5742137TCCAGAATGGCTGATCATCGATGATCAGCCATTCTGGA0.052100.006600.689700.500000.956500.62500


Target Position: 1641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1641ACACAGGUUUGGUGGAAAA85.8421370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7711659ACACAGGTTTGGTGGAAAATTTTCCACCAAACCTGTGT0.036800.001600.706900.750000.994600.62500


Target Position: 1764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1764CUUCUACUCUGACAUCAAG78.5835857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7401782CTTCTACTCTGACATCAAGCTTGATGTCAGAGTAGAAG0.112800.009700.500000.500001.000001.00000


Target Position: 1528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1528GACUGAUUUCUUCAACCCA92.2223113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7881546GACTGATTTCTTCAACCCATGGGTTGAAGAAATCAGTC0.107300.013900.474100.500000.945700.75000


Target Position: 1315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1315ACAUUCUACAAGCACAAUC63.06672172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6841333ACATTCTACAAGCACAATCGATTGTGCTTGTAGAATGT0.324400.201300.525900.500001.000001.00000


Target Position: 1266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1266CACACCCUCCCCUCAUUCA81.2605661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7561284CACACCCTCCCCTCATTCATGAATGAGGGGAGGGTGTG0.030600.025000.569000.500001.000001.00000


Target Position: 1760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1760ACAACUUCUACUCUGACAU76.16721061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5291778ACAACTTCTACTCTGACATATGTCAGAGTAGAAGTTGT0.111900.016400.551700.750001.000001.00000


Target Position: 1610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1610AGUACAACGCUUCAGCCUA86.4017332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5651628AGTACAACGCTTCAGCCTATAGGCTGAAGCGTTGTACT0.099800.042400.534500.750000.978300.87500


Target Position: 512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512UCCCAGUAUGACACAUAUU74.66171186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
650530TCCCAGTATGACACATATTAATATGTGTCATACTGGGA0.083000.003800.862100.750001.000001.00000


Target Position: 31, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
31CCUCGAGAUCCAUUGUGCU81.2041668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
74149CCTCGAGATCCATTGTGCTAGCACAATGGATCTCGAGG0.270600.005500.491400.750001.000001.00000


Target Position: 2683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2683UGGAUGGCUUCUAACAAAA82.4556585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6802701TGGATGGCTTCTAACAAAATTTTGTTAGAAGCCATCCA0.292400.003200.844800.750001.000001.00000


Target Position: 1397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1397AGAUGGCAUGAGGGAUAUC68.32141743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7681415AGATGGCATGAGGGATATCGATATCCCTCATGCCATCT0.083100.021600.543100.500001.000001.00000


Target Position: 3004, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3004GUAUAAUUUUUUAAAGUUA96.22834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4373022GTATAATTTTTTAAAGTTATAACTTTAAAAAATTATAC0.097400.073100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3002-3024CAGTATAATTTTTTAAAGTTACTUAACUUUAAAAAAUUAUACUGGUAUAAUUUUUUAAAGUUACUU4.9-8.022


Target Position: 2610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2610AGGGCCCAAUUAAUAAUCA80.5706709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6152628AGGGCCCAATTAATAATCATGATTATTAATTGGGCCCT0.449400.049200.620700.500001.000001.00000


Target Position: 1859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1859ACCUCUCAUUACCCACACA84.7356433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7051877ACCTCTCATTACCCACACATGTGTGGGTAATGAGAGGT0.696700.155800.646600.500001.000001.00000


Target Position: 1061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1061UCAGGCAUUGAUGAUGAUG57.99732520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8121079TCAGGCATTGATGATGATGCATCATCATCAATGCCTGA0.015800.006900.569000.500001.000001.00000


Target Position: 1578, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1578CAGGAAGAAGGAUGGAUAU86.5446327

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3157819CAGGAAGAAGGATGGATAT1/1/0/097.75CD44NM_000610.3+NM_001001389.1+NM_001001392.1+NM_001001391.1+NM_001001390.11+1+0+0+0NANANA11:35227776,35229652..35227790,35229655(+)00CD44(0.002)


Target Position: 1694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1694CAGCAGAGUAAUUCUCAGA90.4893164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7971712CAGCAGAGTAATTCTCAGATCTGAGAATTACTCTGCTG0.016100.002500.560300.500000.940200.87500


Target Position: 2337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2337CUCCAGACCAGUUUAUGAC69.16581680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7462355CTCCAGACCAGTTTATGACGTCATAAACTGGTCTGGAG0.043800.002100.491400.500001.000001.00000


Target Position: 2591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2591CAGCAUUGCUUUGUAAAUU81.263660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242609CAGCATTGCTTTGTAAATTAATTTACAAAGCAATGCTG0.026600.003700.775900.750000.962000.62500


Target Position: 1828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1828UGAAGGCUCAACUACUUUA86.153350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3881846TGAAGGCTCAACTACTTTATAAAGTAGTTGAGCCTTCA0.249400.034700.689700.750001.000001.00000


Target Position: 1322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1322ACAAGCACAAUCCAGGCAA75.85631092

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5141340ACAAGCACAATCCAGGCAATTGCCTGGATTGTGCTTGT0.204300.122600.560300.750000.956500.75000


Target Position: 2120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2120CCAGAAUGGCUGAUCAUCU84.7164435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5992138CCAGAATGGCTGATCATCTAGATGATCAGCCATTCTGG0.067100.005400.620700.750000.956500.62500


Target Position: 3034, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3034GCACAAAAGGGUUUAAACU81.5645636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4823052GCACAAAAGGGTTTAAACTAGTTTAAACCCTTTTGTGC0.078000.062900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3032-3054AGGCACAAAAGGGTTTAAACTGAAGUUUAAACCCUUUUGUGCCUGCACAAAAGGGUUUAAACUGAU0.012.222


Target Position: 2684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2684GGAUGGCUUCUAACAAAAA97.576924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6582702GGATGGCTTCTAACAAAAATTTTTGTTAGAAGCCATCC0.341800.003700.870701.000001.000001.00000


Target Position: 1, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1GGGAGACCCAAGCUUCUAG76.13371065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
57819GGGAGACCCAAGCTTCTAGCTAGAAGCTTGGGTCTCCC0.051000.032700.819000.750000.934800.62500


Target Position: 1343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1343CCUAGUAGUACAACGGAAG71.96881428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3911361CCTAGTAGTACAACGGAAGCTTCCGTTGTACTACTAGG0.459700.016900.706900.750001.000001.00000


Target Position: 396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
396GAUUUGAGACCUGCAGGUA90.8599150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
682414GATTTGAGACCTGCAGGTATACCTGCAGGTCTCAAATC0.073700.003800.500000.750000.951100.62500


Target Position: 1961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1961AACUCUAAUGUCAAUCGUU82.7457564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6811979AACTCTAATGTCAATCGTTAACGATTGACATTAGAGTT0.080300.046700.500000.500001.000001.00000


Target Position: 1932, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1932GAGUUACUGCAGUUACUGU90.3995169

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1930-1952TGGAGTTACTGCAGTTACTGTTGACAGUAACUGCAGUAACUCCAGAGUUACUGCAGUUACUGUUGU19.017.622


Target Position: 499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
499CACAUACAACACCUCCCAG76.11781069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
745517CACATACAACACCTCCCAGCTGGGAGGTGTTGTATGTG0.023400.024700.508600.500001.000001.00000


Target Position: 1201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1201CACAAGGAUGACUGAUGUA94.967157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6431219CACAAGGATGACTGATGTATACATCAGTCATCCTTGTG0.038700.008600.612100.750001.000001.00000


Target Position: 1673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1673GGACCUCUUUCAAUGACAA99.694110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301691GGACCTCTTTCAATGACAATTGTCATTGAAAGAGGTCC0.247700.014700.724101.000001.000001.00000


Target Position: 2128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2128GCUGAUCAUCUUGGCAUCC61.12142316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7632146GCTGATCATCTTGGCATCCGGATGCCAAGATGATCAGC0.066500.008500.482800.500001.000001.00000


Target Position: 1752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1752ACCAUCCAACAACUUCUAC59.27912439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8101770ACCATCCAACAACTTCTACGTAGAAGTTGTTGGATGGT0.032400.026100.672400.500001.000001.00000


Target Position: 3071, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3071GUACUUCUUCGAUCUUCAA92.6555104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5513089GTACTTCTTCGATCTTCAATTGAAGATCGAAGAAGTAC0.713400.579100.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3069-3091CTGTACTTCTTCGATCTTCAAAAUUGAAGAUCGAAGAAGUACAGGUACUUCUUCGAUCUUCAAAAU20.418.9


Target Position: 1306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1306AGAGACCCCACAUUCUACA79.5087788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6211324AGAGACCCCACATTCTACATGTAGAATGTGGGGTCTCT0.526400.114600.517200.500001.000001.00000


Target Position: 1167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1167GCCAUUCAAAUCCGGAAGU63.14412162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5671185GCCATTCAAATCCGGAAGTACTTCCGGATTTGAATGGC0.054600.017800.793100.750000.962000.62500


Target Position: 2980, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2980AACCCUGGAUCAGUCCUUU72.86961350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7912998AACCCTGGATCAGTCCTTTAAAGGACTGATCCAGGGTT0.021700.001400.646600.500000.907600.87500


Target Position: 2802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2802UCCAUUUUGCCCUUCCAUA73.11751332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6272820TCCATTTTGCCCTTCCATATATGGAAGGGCAAAATGGA0.041200.008800.827600.750001.000001.00000


Target Position: 170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
170CCGGACACCAUGGACAAGU63.38362145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
608188CCGGACACCATGGACAAGTACTTGTCCATGGTGTCCGG0.389000.005100.706900.750001.000001.00000


Target Position: 1617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1617CGCUUCAGCCUACUGCAAA86.7164315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4001635CGCTTCAGCCTACTGCAAATTTGCAGTAGGCTGAAGCG0.226200.016200.922401.000000.945701.00000


Target Position: 2184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2184CAGUCAACAGUCGAAGAAG78.1384902

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6692202CAGTCAACAGTCGAAGAAGCTTCTTCGACTGTTGACTG0.048500.004400.646600.500001.000001.00000


Target Position: 807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
807CCUGGAUCACCGACAGCAC72.67631364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
609825CCTGGATCACCGACAGCACGTGCTGTCGGTGATCCAGG0.204400.005000.551700.750000.956500.87500


Target Position: 144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
144CCUUUCGCCCGCGCCCUCC40.84323022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
786162CCTTTCGCCCGCGCCCTCCGGAGGGCGCGGGCGAAAGG0.073900.042500.474100.500000.902201.00000


Target Position: 2629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2629GCAAGAAUUUGAUCGUUCA94.78759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6152647GCAAGAATTTGATCGTTCATGAACGATCAAATTCTTGC0.043200.006600.629300.750001.000001.00000


Target Position: 486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
486GGGUGUACAUCCUCACAUA106.5611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
494504GGGTGTACATCCTCACATATATGTGAGGATGTACACCC0.730000.010400.948301.000000.962000.62500


Target Position: 1840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1840UACUUUACUGGAAGGUUAU73.8951262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8141858TACTTTACTGGAAGGTTATATAACCTTCCAGTAAAGTA0.013900.003500.637900.500001.000001.00000


Target Position: 2461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2461GGGAGCUGGGACACUUAAC70.68381547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3142479GGGAGCTGGGACACTTAACGTTAAGTGTCCCAGCTCCC0.304700.025600.844800.750000.983700.87500


Target Position: 2298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2298AGGAAAUGGUGCAUUUGGU75.66071102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7322316AGGAAATGGTGCATTTGGTACCAAATGCACCATTTCCT0.029700.015900.491400.500001.000001.00000


Target Position: 454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
454CCCCAACUCCAUCUGUGCA81.5365641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
705472CCCCAACTCCATCTGTGCATGCACAGATGGAGTTGGGG0.097700.002700.637900.750001.000001.00000


Target Position: 2524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2524CAUAAAAUUUUCUACUCUU91.9259120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6122542CATAAAATTTTCTACTCTTAAGAGTAGAAAATTTTATG0.742800.110300.517200.750001.000001.00000


Target Position: 1672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1672AGGACCUCUUUCAAUGACA82.8153556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6431690AGGACCTCTTTCAATGACATGTCATTGAAAGAGGTCCT0.188700.017200.637900.500001.000001.00000


Target Position: 580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
580CCUGCCCAAUGCCUUUGAU75.09031152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433598CCTGCCCAATGCCTTTGATATCAAAGGCATTGGGCAGG0.098200.044800.663801.000000.972800.87500


Target Position: 2540, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2540CUUUUUGUUUUUUGUGUUU72.91961344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3702558CTTTTTGTTTTTTGTGTTTAAACACAAAAAACAAAAAG0.128000.093500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2538-2560CTCTTTTTGTTTTTTGTGTTTTGAAACACAAAAAACAAAAAGAGCUUUUUGUUUUUUGUGUUUUGU19.35.610


Target Position: 1688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1688ACAACGCAGCAGAGUAAUU77.2921969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6281706ACAACGCAGCAGAGTAATTAATTACTCTGCTGCGTTGT0.041000.029500.698300.750001.000001.00000


Target Position: 2511, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2511GAAUCUUUUUUAGCAUAAA94.663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4862529GAATCTTTTTTAGCATAAATTTATGCTAAAAAAGATTC0.076400.021300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2509-2531GCGAATCTTTTTTAGCATAAAATUUUAUGCUAAAAAAGAUUCGCGAAUCUUUUUUAGCAUAAAAUU19.75.321


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766CACCUUUUCUACUGUACAC77.3343965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
672784CACCTTTTCTACTGTACACGTGTACAGTAGAAAAGGTG0.270500.124800.500000.500001.000001.00000


Target Position: 1391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1391GGCAACAGAUGGCAUGAGG67.20891832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531409GGCAACAGATGGCATGAGGCCTCATGCCATCTGTTGCC0.165200.021700.655200.500001.000001.00000


Target Position: 2377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2377GCAGAAUGUGGACAUGAAG78.3562872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4102395GCAGAATGTGGACATGAAGCTTCATGTCCACATTCTGC0.206000.015800.715500.750001.000001.00000


Target Position: 1338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1338CAACUCCUAGUAGUACAAC69.20891676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8181356CAACTCCTAGTAGTACAACGTTGTACTACTAGGAGTTG0.141200.021600.500000.500001.000001.00000


Target Position: 1210, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210GACUGAUGUAGACAGAAAU92.977895

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8121019GACTGATGTAGACAGAAAT1/1/0/094.96CD44NM_000610.3+NM_001001389.1+NM_001001392.1+NM_001001391.1+NM_001001390.11+1+0+0+0NANANANA00CD44(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3521228GACTGATGTAGACAGAAATATTTCTGTCTACATCAGTC0.239300.035900.810300.750000.972800.75000


Target Position: 2941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2941AUCUGUAGUAAACUAUUUA88.2041247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7802959ATCTGTAGTAAACTATTTATAAATAGTTTACTACAGAT0.366100.028700.646600.500001.000001.00000


Target Position: 943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
943GAAUCAUCUUCACACAACA100.5215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
821961GAATCATCTTCACACAACATGTTGTGTGAAGATGATTC0.765500.197600.465500.500001.000001.00000


Target Position: 1572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1572AUCAAGCAGGAAGAAGGAU65.18231991

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7831590ATCAAGCAGGAAGAAGGATATCCTTCTTCCTGCTTGAT0.018200.015100.500000.500001.000001.00000


Target Position: 1002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1002GCUGGGAGCCAAAUGAAGA86.1303351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3891020GCTGGGAGCCAAATGAAGATCTTCATTTGGCTCCCAGC0.226500.017000.629300.750000.956500.62500


Target Position: 1642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1642CACAGGUUUGGUGGAAAAU74.82561174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7471660CACAGGTTTGGTGGAAAATATTTTCCACCAAACCTGTG0.249700.001900.784500.750001.000001.00000


Target Position: 1308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1308AGACCCCACAUUCUACAAG65.04622005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7011326AGACCCCACATTCTACAAGCTTGTAGAATGTGGGGTCT0.358600.291500.586200.500001.000001.00000


Target Position: 2500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2500UGUUUCAUUGCGAAUCUUU71.92461435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2742518TGTTTCATTGCGAATCTTTAAAGATTCGCAATGAAACA0.224500.030400.706900.750001.000001.00000


Target Position: 1129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1129CACAAAACAGAACCAGGAC70.27131580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771147CACAAAACAGAACCAGGACGTCCTGGTTCTGTTTTGTG0.093700.067000.474100.500001.000001.00000


Target Position: 2237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2237GGCAAUGGAGCUGUGGAGG56.64722600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8202255GGCAATGGAGCTGTGGAGGCCTCCACAGCTCCATTGCC0.013100.013700.655200.500000.940200.75000


Target Position: 809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
809UGGAUCACCGACAGCACAG61.35872300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
798827TGGATCACCGACAGCACAGCTGTGCTGTCGGTGATCCA0.141100.057600.560300.500000.956500.75000


Target Position: 2628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2628AGCAAGAAUUUGAUCGUUC68.88631702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6642646AGCAAGAATTTGATCGTTCGAACGATCAAATTCTTGCT0.035500.007400.681000.500001.000001.00000


Target Position: 1689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1689CAACGCAGCAGAGUAAUUC68.36361741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7841707CAACGCAGCAGAGTAATTCGAATTACTCTGCTGCGTTG0.039200.022800.474100.500001.000001.00000


Target Position: 1066, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1066CAUUGAUGAUGAUGAAGAU99.37711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7761084CATTGATGATGATGAAGATATCTTCATCATCATCAATG0.026900.005400.474100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1064-1086GGCATTGATGATGATGAAGATTTAUCUUCAUCAUCAUCAAUGCCCAUUGAUGAUGAUGAAGAUUUU20.413.612


Target Position: 2121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2121CAGAAUGGCUGAUCAUCUU88.3682243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6052139CAGAATGGCTGATCATCTTAAGATGATCAGCCATTCTG0.110400.005100.646600.750000.956500.62500


Target Position: 1232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1232ACCACUGCUUAUGAAGGAA80.4122719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6031250ACCACTGCTTATGAAGGAATTCCTTCATAAGCAGTGGT0.372000.005400.681000.750001.000001.00000


Target Position: 409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409CAGGUAUGGGUUCAUAGAA92.6845102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
550427CAGGTATGGGTTCATAGAATTCTATGAACCCATACCTG0.080300.007500.612100.750000.967400.87500


Target Position: 1235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1235ACUGCUUAUGAAGGAAACU67.83431791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8231253ACTGCTTATGAAGGAAACTAGTTTCCTTCATAAGCAGT0.060900.001000.500000.500001.000001.00000


Target Position: 606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
606UUACCAUAACUAUUGUUAA85.561386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
663624TTACCATAACTATTGTTAATTAACAATAGTTATGGTAA0.103500.009800.500000.500000.967400.62500


Target Position: 971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
971GCUGGUACGUCUUCAAAUA96.087636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
512989GCTGGTACGTCTTCAAATATATTTGAAGACGTACCAGC0.070500.012500.810301.000001.000001.00000


Target Position: 1300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1300GGAAGAAGAGACCCCACAU90.7138154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3151318GGAAGAAGAGACCCCACATATGTGGGGTCTCTTCTTCC0.655100.025400.715501.000000.940200.62500


Target Position: 363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
363CAAUGGCCCAGAUGGAGAA88.7123229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
798381CAATGGCCCAGATGGAGAATTCTCCATCTGGGCCATTG0.035200.002800.474100.750000.951100.87500


Target Position: 1054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1054UUCUGGAUCAGGCAUUGAU70.66581548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7721072TTCTGGATCAGGCATTGATATCAATGCCTGATCCAGAA0.057800.001600.491400.500000.983700.75000


Target Position: 589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
589UGCCUUUGAUGGACCAAUU73.63511288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
682607TGCCTTTGATGGACCAATTAATTGGTCCATCAAAGGCA0.043800.003200.844800.750000.978300.62500


Target Position: 84, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
84UCCGCCAUCCUCGUCCCGU48.12992913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483102TCCGCCATCCTCGTCCCGTACGGGACGAGGATGGCGGA0.265100.025000.594800.500001.000001.00000


Target Position: 2056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2056CUCACAUGGGAGUCAAGAA92.4068109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8062074CTCACATGGGAGTCAAGAATTCTTGACTCCCATGTGAG0.031500.001200.637900.750000.978300.62500


Target Position: 1930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1930UGGAGUUACUGCAGUUACU77.4303959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6631948TGGAGTTACTGCAGTTACTAGTAACTGCAGTAACTCCA0.051400.014300.637900.500001.000001.00000


Target Position: 1119, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1119CCUUUGACCACACAAAACA83.1088540

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1117-1139GGCCTTTGACCACACAAAACAGAUGUUUUGUGUGGUCAAAGGCCCCUUUGACCACACAAAACAGAU13.319.2


Target Position: 601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
601ACCAAUUACCAUAACUAUU76.9643999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
734619ACCAATTACCATAACTATTAATAGTTATGGTAATTGGT0.024900.009300.844800.750001.000001.00000


Target Position: 1711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1711GAGCUUCUCUACAUCACAU95.934340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4261729GAGCTTCTCTACATCACATATGTGATGTAGAGAAGCTC0.880400.014800.655200.750001.000001.00000


Target Position: 2164, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2164GAUUCUUGCAGUUUGCAUU85.8663368

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2162-2184TTGATTCTTGCAGTTTGCATTGCAAUGCAAACUGCAAGAAUCAAGAUUCUUGCAGUUUGCAUUGCU20.012.022


Target Position: 748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
748AGGAGGUUACAUCUUUUAC70.1891586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
694766AGGAGGTTACATCTTTTACGTAAAAGATGTAACCTCCT0.649100.002900.663800.500001.000001.00000


Target Position: 810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
810GGAUCACCGACAGCACAGA86.7141316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
356828GGATCACCGACAGCACAGATCTGTGCTGTCGGTGATCC0.139000.062700.646600.750000.978300.62500


Target Position: 647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
647CAGAAAGGAGAAUACAGAA98.68716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
594665CAGAAAGGAGAATACAGAATTCTGTATTCTCCTTTCTG0.657800.005600.612100.750001.000001.00000


Target Position: 946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
946UCAUCUUCACACAACAACA85.6109382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
595964TCATCTTCACACAACAACATGTTGTTGTGTGAAGATGA0.755000.210400.517200.500001.000001.00000


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975GUACGUCUUCAAAUACCAU88.8328224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
658993GTACGTCTTCAAATACCATATGGTATTTGAAGACGTAC0.035900.024200.525900.750001.000001.00000


Target Position: 1713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1713GCUUCUCUACAUCACAUGA92.0474116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5401731GCTTCTCTACATCACATGATCATGTGATGTAGAGAAGC0.063900.019800.629300.750001.000001.00000


Target Position: 1360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1360AGAAACAGCUACCCAGAAG70.57031561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6041378AGAAACAGCTACCCAGAAGCTTCTGGGTAGCTGTTTCT0.045100.022400.586200.500001.000001.00000


Target Position: 143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
143UCCUUUCGCCCGCGCCCUC41.13263018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506161TCCTTTCGCCCGCGCCCTCGAGGGCGCGGGCGAAAGGA0.071200.039800.560300.500000.902201.00000


Target Position: 147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
147UUCGCCCGCGCCCUCCGUU45.6742956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
573165TTCGCCCGCGCCCTCCGTTAACGGAGGGCGCGGGCGAA0.174000.028100.525900.500000.902200.87500


Target Position: 1193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1193CAGACAACCACAAGGAUGA86.0713352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6711211CAGACAACCACAAGGATGATCATCCTTGTGGTTGTCTG0.034400.005000.560300.500000.902200.75000


Target Position: 2948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2948GUAAACUAUUUAUCUGUGU75.95581083

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7802966GTAAACTATTTATCTGTGTACACAGATAAATAGTTTAC0.207000.159000.474100.500001.000001.00000


Target Position: 1085, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1085UUUAUCUCCAGCACCAUUU59.78262407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6781103TTTATCTCCAGCACCATTTAAATGGTGCTGGAGATAAA0.291300.027700.500000.500001.000001.00000


Target Position: 927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
927UACCAUCAGAGUCAAAGAA80.6039707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
625945TACCATCAGAGTCAAAGAATTCTTTGACTCTGATGGTA0.094600.009900.508600.500001.000001.00000


Target Position: 511, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
511CUCCCAGUAUGACACAUAU88.4359240

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_451119CTCCCAGTATGACACATAT1/1/0/097.21CD44NM_001001390.1+NM_001001391.1+NM_000610.3+NM_001001389.1+NM_001001392.11+1+1+1+0NANANA11:35201920..35201938(+)00CD44(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
652529CTCCCAGTATGACACATATATATGTGTCATACTGGGAG0.104200.003800.767200.750001.000001.00000


Target Position: 1965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1965CUAAUGUCAAUCGUUCCUU71.47811479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5631983CTAATGTCAATCGTTCCTTAAGGAACGATTGACATTAG0.062800.033100.534500.750001.000001.00000


Target Position: 3028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3028UCAGAGGCACAAAAGGGUU66.40051898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7433046TCAGAGGCACAAAAGGGTTAACCCTTTTGTGCCTCTGA0.161100.002000.577600.750001.000001.00000


Target Position: 1192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1192UCAGACAACCACAAGGAUG62.20642236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7541210TCAGACAACCACAAGGATGCATCCTTGTGGTTGTCTGA0.032100.004400.569000.500000.907600.62500


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949UCUUCACACAACAACACAA86.9723304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
453967TCTTCACACAACAACACAATTGTGTTGTTGTGTGAAGA0.776900.334900.577600.750001.000001.00000


Target Position: 236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
236GCGCAGAUCGAUUUGAAUA91.8887121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
351254GCGCAGATCGATTTGAATATATTCAAATCGATCTGCGC0.208700.021100.879301.000001.000001.00000


Target Position: 598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
598UGGACCAAUUACCAUAACU72.72291359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
707616TGGACCAATTACCATAACTAGTTATGGTAATTGGTCCA0.028800.008800.637900.500000.929300.62500


Target Position: 2696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2696ACAAAAACUACACAUAUGU72.99211340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6872714ACAAAAACTACACATATGTACATATGTGTAGTTTTTGT0.196400.163100.500000.500001.000001.00000


Target Position: 741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
741GCACUUCAGGAGGUUACAU81.506643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
787759GCACTTCAGGAGGTTACATATGTAACCTCCTGAAGTGC0.017600.002700.698301.000001.000001.00000


Target Position: 968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
968AUGGCUGGUACGUCUUCAA80.821693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
674986ATGGCTGGTACGTCTTCAATTGAAGACGTACCAGCCAT0.263400.005900.508600.500001.000001.00000


Target Position: 2583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2583UGUAAAAACAGCAUUGCUU74.26961233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7472601TGTAAAAACAGCATTGCTTAAGCAATGCTGTTTTTACA0.022900.003600.569000.750000.962000.62500


Target Position: 765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
765ACACCUUUUCUACUGUACA82.515576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
684783ACACCTTTTCTACTGTACATGTACAGTAGAAAAGGTGT0.270100.115700.500000.500001.000001.00000


Target Position: 1064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1064GGCAUUGAUGAUGAUGAAG72.13271412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771082GGCATTGATGATGATGAAGCTTCATCATCATCAATGCC0.019300.004000.862100.750001.000001.00000


Target Position: 1756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1756UCCAACAACUUCUACUCUG61.89372260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7721774TCCAACAACTTCTACTCTGCAGAGTAGAAGTTGTTGGA0.019700.017300.586200.500001.000001.00000


Target Position: 2620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2620UAAUAAUCAGCAAGAAUUU77.255973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5812638TAATAATCAGCAAGAATTTAAATTCTTGCTGATTATTA0.049700.046100.534500.500001.000001.00000


Target Position: 2533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2533UUCUACUCUUUUUGUUUUU61.72022274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5182551TTCTACTCTTTTTGTTTTTAAAAACAAAAAGAGTAGAA0.225800.155400.672400.500001.000001.00000


Target Position: 2145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2145CCCUCUUGGCCUUGGCUUU69.58931644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7692163CCCTCTTGGCCTTGGCTTTAAAGCCAAGGCCAAGAGGG0.022000.001600.991401.000000.940200.87500


Target Position: 1692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1692CGCAGCAGAGUAAUUCUCA88.2036248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7081710CGCAGCAGAGTAATTCTCATGAGAATTACTCTGCTGCG0.028400.006400.698300.750000.940200.62500


Target Position: 452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
452CACCCCAACUCCAUCUGUG72.98591341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
827470CACCCCAACTCCATCTGTGCACAGATGGAGTTGGGGTG0.022800.001000.500000.500001.000001.00000


Target Position: 2429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2429AAGAAACAACCGUUGGAAA84.9565407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5222447AAGAAACAACCGTTGGAAATTTCCAACGGTTGTTTCTT0.070800.050600.637900.500001.000001.00000


Target Position: 3002, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3002CAGUAUAAUUUUUUAAAGU85.512388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5433020CAGTATAATTTTTTAAAGTACTTTAAAAAATTATACTG0.227300.088900.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3000-3022ATCAGTATAATTTTTTAAAGTTAACUUUAAAAAAUUAUACUGAUCAGUAUAAUUUUUUAAAGUUAU-3.86.321


Target Position: 1126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1126CCACACAAAACAGAACCAG64.59382043

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5091144CCACACAAAACAGAACCAGCTGGTTCTGTTTTGTGTGG0.189200.106900.560300.750001.000001.00000


Target Position: 2202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2202GGUGUGGGCAGAAGAAAAA89.651189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
712220GGTGTGGGCAGAAGAAAAATTTTTCTTCTGCCCACACC0.818100.138300.853401.000001.000001.00000


Target Position: 757, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
757CAUCUUUUACACCUUUUCU81.1538674

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
755-777TACATCTTTTACACCTTTTCTACAGAAAAGGUGUAAAAGAUGUACAUCUUUUACACCUUUUCUACU18.75.322


Target Position: 1761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1761CAACUUCUACUCUGACAUC78.671848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251779CAACTTCTACTCTGACATCGATGTCAGAGTAGAAGTTG0.108900.015600.465500.500001.000001.00000


Target Position: 2569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2569AGUCAGGUCCAAUUUGUAA90.4125167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5542587AGTCAGGTCCAATTTGTAATTACAAATTGGACCTGACT0.060800.020500.672400.750001.000001.00000


Target Position: 1841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1841ACUUUACUGGAAGGUUAUA80.2249736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8261859ACTTTACTGGAAGGTTATATATAACCTTCCAGTAAAGT0.012000.002800.663800.750001.000001.00000


Target Position: 2017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2017GGGGUCCCAUACCACUCAU81.1737672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6542035GGGGTCCCATACCACTCATATGAGTGGTATGGGACCCC0.072000.003800.836201.000000.940200.75000


Target Position: 2783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2783GGGAGGAAAUUUGAAUGGG64.14142086

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8202801GGGAGGAAATTTGAATGGGCCCATTCAAATTTCCTCCC0.073800.001100.500000.500001.000001.00000


Target Position: 1921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1921UGGGUCCUUUGGAGUUACU65.83891948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7861939TGGGTCCTTTGGAGTTACTAGTAACTCCAAAGGACCCA0.018000.002100.637900.500000.972801.00000


Target Position: 2575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2575GUCCAAUUUGUAAAAACAG71.3781494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5482593GTCCAATTTGTAAAAACAGCTGTTTTTACAAATTGGAC0.077000.013800.534500.500000.994600.62500


Target Position: 2532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2532UUUCUACUCUUUUUGUUUU68.98351690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7232550TTTCTACTCTTTTTGTTTTAAAACAAAAAGAGTAGAAA0.265500.167600.500000.500001.000001.00000


Target Position: 488, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
488GUGUACAUCCUCACAUACA91.2155140

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
486-508GGGTGTACATCCTCACATACAACUGUAUGUGAGGAUGUACACCCGUGUACAUCCUCACAUACAACU20.420.4


Target Position: 2504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2504UCAUUGCGAAUCUUUUUUA78.1156905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3402522TCATTGCGAATCTTTTTTATAAAAAAGATTCGCAATGA0.173700.032600.689700.750001.000001.00000


Target Position: 2785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2785GAGGAAAUUUGAAUGGGUC75.92381086

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7352803GAGGAAATTTGAATGGGTCGACCCATTCAAATTTCCTC0.122500.021800.491400.500001.000001.00000


Target Position: 1088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1088AUCUCCAGCACCAUUUCAA79.3078804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5501106ATCTCCAGCACCATTTCAATTGAAATGGTGCTGGAGAT0.373600.079500.534500.500001.000001.00000


Target Position: 2608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2608UUAGGGCCCAAUUAAUAAU67.69351798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7792626TTAGGGCCCAATTAATAATATTATTAATTGGGCCCTAA0.503100.035700.525900.500001.000001.00000


Target Position: 2214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2214AGAAAAAGCUAGUGAUCAA99.150613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8122232AGAAAAAGCTAGTGATCAATTGATCACTAGCTTTTTCT0.014100.001400.577600.750001.000001.00000


Target Position: 1807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1807AAGAAGAGACCCAAAUCAU83.6057499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7541825AAGAAGAGACCCAAATCATATGATTTGGGTCTCTTCTT0.133600.024200.482800.500001.000001.00000


Target Position: 1871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1871CCACACACGAAGGAAAGCA77.511953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7441889CCACACACGAAGGAAAGCATGCTTTCCTTCGTGTGTGG0.031600.026000.491400.750001.000001.00000


Target Position: 1166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1166AGCCAUUCAAAUCCGGAAG56.57112605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5991184AGCCATTCAAATCCGGAAGCTTCCGGATTTGAATGGCT0.120500.034700.715500.500000.962000.62500


Target Position: 909, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
909GGUUUUCAUGGUUGUUUCU79.9125761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
767927GGTTTTCATGGTTGTTTCTAGAAACAACCATGAAAACC0.020100.001800.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
907-929TTGGTTTTCATGGTTGTTTCTACAGAAACAACCAUGAAAACCAAGGUUUUCAUGGUUGUUUCUACU14.914.921


Target Position: 653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
653GGAGAAUACAGAACGAAUC77.1495982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
321671GGAGAATACAGAACGAATCGATTCGTTCTGTATTCTCC0.365600.024700.689700.750001.000001.00000


Target Position: 2336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2336ACUCCAGACCAGUUUAUGA87.2765290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7662354ACTCCAGACCAGTTTATGATCATAAACTGGTCTGGAGT0.036700.002100.482800.500001.000001.00000


Target Position: 3056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3056UCAUAAUAAAUAUCUGUAC67.76111795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5323074TCATAATAAATATCTGTACGTACAGATATTTATTATGA0.609800.575300.543100.500001.000001.00000


Target Position: 2962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2962UGUGUUUUUGAAAUAUUAA84.2954455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2272980TGTGTTTTTGAAATATTAATTAATATTTCAAAAACACA0.343700.169400.672400.750001.000001.00000


Target Position: 667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667GAAUCCUGAAGACAUCUAC76.88751008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
736685GAATCCTGAAGACATCTACGTAGATGTCTTCAGGATTC0.088200.014900.491400.500001.000001.00000


Target Position: 1168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1168CCAUUCAAAUCCGGAAGUG64.68092035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6361186CCATTCAAATCCGGAAGTGCACTTCCGGATTTGAATGG0.040000.014100.551700.750000.983700.62500


Target Position: 3008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3008AAUUUUUUAAAGUUACUUU77.9095923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6763026AATTTTTTAAAGTTACTTTAAAGTAACTTTAAAAAATT0.062600.054100.508600.500001.000001.00000


Target Position: 1016, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1016GAAGAAAAUGAAGAUGAAA95.42146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3411034GAAGAAAATGAAGATGAAATTTCATCTTCATTTTCTTC0.468200.134400.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1014-1036ATGAAGAAAATGAAGATGAAAGAUUUCAUCUUCAUUUUCUUCAUGAAGAAAAUGAAGAUGAAAGAU20.45.512


Target Position: 2779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2779CCCUGGGAGGAAAUUUGAA84.011477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7102797CCCTGGGAGGAAATTTGAATTCAAATTTCCTCCCAGGG0.190400.002700.819001.000000.945700.62500


Target Position: 2527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2527AAAAUUUUCUACUCUUUUU79.8233764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7002545AAAATTTTCTACTCTTTTTAAAAAGAGTAGAAAATTTT0.800700.190200.500000.500001.000001.00000


Target Position: 2105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2105AGGACACCCCAAAUUCCAG68.10311770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7572123AGGACACCCCAAATTCCAGCTGGAATTTGGGGTGTCCT0.155900.008900.560300.500000.945700.62500


Target Position: 2375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2375CUGCAGAAUGUGGACAUGA81.9477614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5502393CTGCAGAATGTGGACATGATCATGTCCACATTCTGCAG0.075300.016000.560300.500001.000001.00000


Target Position: 2210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2210CAGAAGAAAAAGCUAGUGA86.2943337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7712228CAGAAGAAAAAGCTAGTGATCACTAGCTTTTTCTTCTG0.019700.019100.560300.500001.000001.00000


Target Position: 2725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2725GCCAACCUUUCCCCCACCA69.66541637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3492743GCCAACCTTTCCCCCACCATGGTGGGGGAAAGGTTGGC0.592900.459900.655200.750001.000001.00000


Target Position: 2929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2929GUGAAGCUAUUUAUCUGUA93.351892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6392947GTGAAGCTATTTATCTGTATACAGATAAATAGCTTCAC0.039400.012400.612100.750001.000001.00000


Target Position: 652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
652AGGAGAAUACAGAACGAAU89.2704202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
408670AGGAGAATACAGAACGAATATTCGTTCTGTATTCTCCT0.107200.029200.836200.750001.000001.00000


Target Position: 1326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1326GCACAAUCCAGGCAACUCC67.92581782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7691344GCACAATCCAGGCAACTCCGGAGTTGCCTGGATTGTGC0.061300.045400.482800.500000.994600.75000


Target Position: 2338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2338UCCAGACCAGUUUAUGACA76.21031059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232356TCCAGACCAGTTTATGACATGTCATAAACTGGTCTGGA0.183200.006800.663800.500001.000001.00000


Target Position: 1604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1604AGUCAUAGUACAACGCUUC69.12041682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7291622AGTCATAGTACAACGCTTCGAAGCGTTGTACTATGACT0.112500.028900.534500.500000.994600.62500


Target Position: 2889, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2889CUCUAGAAAUUUUUCAGAU85.9457362

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2887-2909CCCTCTAGAAATTTTTCAGATGCAUCUGAAAAAUUUCUAGAGGGCUCUAGAAAUUUUUCAGAUGCU20.420.222


Target Position: 1311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1311CCCCACAUUCUACAAGCAC63.32082149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101329CCCCACATTCTACAAGCACGTGCTTGTAGAATGTGGGG0.492400.280100.698300.750001.000001.00000


Target Position: 2134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2134CAUCUUGGCAUCCCUCUUG67.95481780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7652152CATCTTGGCATCCCTCTTGCAAGAGGGATGCCAAGATG0.300000.001600.508600.500000.923901.00000


Target Position: 368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
368GCCCAGAUGGAGAAAGCUC68.42011737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
766386GCCCAGATGGAGAAAGCTCGAGCTTTCTCCATCTGGGC0.036100.001600.689700.750000.951100.62500


Target Position: 1870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1870CCCACACACGAAGGAAAGC54.21262714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5841888CCCACACACGAAGGAAAGCGCTTTCCTTCGTGTGTGGG0.049300.032800.637900.500000.951100.62500


Target Position: 1403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1403CAUGAGGGAUAUCGCCAAA90.9212147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7781421CATGAGGGATATCGCCAAATTTGGCGATATCCCTCATG0.138600.001500.655200.750001.000001.00000


Target Position: 517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
517GUAUGACACAUAUUGCUUC76.87891010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
632535GTATGACACATATTGCTTCGAAGCAATATGTGTCATAC0.067400.014900.508600.500000.951100.62500


Target Position: 239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
239CAGAUCGAUUUGAAUAUAA95.663245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
378257CAGATCGATTTGAATATAATTATATTCAAATCGATCTG0.136600.137700.750000.750001.000001.00000


Target Position: 485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
485GGGGUGUACAUCCUCACAU84.3796451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
786503GGGGTGTACATCCTCACATATGTGAGGATGTACACCCC0.730200.001400.836201.000000.962000.62500


Target Position: 407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
407UGCAGGUAUGGGUUCAUAG68.58231721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
751425TGCAGGTATGGGTTCATAGCTATGAACCCATACCTGCA0.022600.006600.681000.500000.967400.62500


Target Position: 2417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2417CAUUAUCUUGGAAAGAAAC74.4641210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6172435CATTATCTTGGAAAGAAACGTTTCTTTCCAAGATAATG0.602600.026400.508600.500001.000001.00000


Target Position: 1668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1668GGACAGGACCUCUUUCAAU91.5371131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4731686GGACAGGACCTCTTTCAATATTGAAAGAGGTCCTGTCC0.099800.012400.862101.000001.000001.00000


Target Position: 588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
588AUGCCUUUGAUGGACCAAU66.27531914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
819606ATGCCTTTGATGGACCAATATTGGTCCATCAAAGGCAT0.013100.003200.646600.500000.978300.75000


Target Position: 1345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1345UAGUAGUACAACGGAAGAA80.6166706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6971363TAGTAGTACAACGGAAGAATTCTTCCGTTGTACTACTA0.463800.021800.500000.500001.000001.00000


Target Position: 2147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2147CUCUUGGCCUUGGCUUUGA70.88881532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8092165CTCTTGGCCTTGGCTTTGATCAAAGCCAAGGCCAAGAG0.014300.001300.586200.500000.940201.00000


Target Position: 1288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1288UGAGCAUCAUGAGGAAGAA87.2394293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8031306TGAGCATCATGAGGAAGAATTCTTCCTCATGATGCTCA0.015300.002300.551700.750001.000001.00000


Target Position: 1750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1750AGACCAUCCAACAACUUCU80.7233699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6671768AGACCATCCAACAACTTCTAGAAGTTGTTGGATGGTCT0.036900.028700.500000.500001.000001.00000


Target Position: 758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
758AUCUUUUACACCUUUUCUA80.1035743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
633776ATCTTTTACACCTTTTCTATAGAAAAGGTGTAAAAGAT0.526100.438200.508600.500001.000001.00000


Target Position: 1757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1757CCAACAACUUCUACUCUGA91.7737124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4131775CCAACAACTTCTACTCTGATCAGAGTAGAAGTTGTTGG0.105500.018000.620700.750001.000001.00000


Target Position: 2998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2998UGAUCAGUAUAAUUUUUUA95.387647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5183016TGATCAGTATAATTTTTTATAAAAAATTATACTGATCA0.264500.009100.689700.750001.000001.00000


Target Position: 2751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2751ACAUUUCCCAGGGUUAAUA77.7825933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8122769ACATTTCCCAGGGTTAATATATTAACCCTGGGAAATGT0.014800.001200.663800.750001.000001.00000


Target Position: 2317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2317GAACAAGGAGUCGUCAGAA96.003439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7572335GAACAAGGAGTCGTCAGAATTCTGACGACTCCTTGTTC0.494300.001800.500000.750000.956500.62500


Target Position: 2942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2942UCUGUAGUAAACUAUUUAU80.1154741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4092960TCTGTAGTAAACTATTTATATAAATAGTTTACTACAGA0.341800.034000.681000.750001.000001.00000


Target Position: 1763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1763ACUUCUACUCUGACAUCAA93.739480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991781ACTTCTACTCTGACATCAATTGATGTCAGAGTAGAAGT0.103900.011500.560300.750001.000001.00000


Target Position: 1057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1057UGGAUCAGGCAUUGAUGAU73.72071281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7481075TGGATCAGGCATTGATGATATCATCAATGCCTGATCCA0.026100.001900.663800.750000.972800.75000


Target Position: 516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
516AGUAUGACACAUAUUGCUU82.5648573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
492534AGTATGACACATATTGCTTAAGCAATATGTGTCATACT0.074100.013100.569000.750001.000001.00000


Target Position: 2414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2414CACCAUUAUCUUGGAAAGA79.5088787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6852432CACCATTATCTTGGAAAGATCTTTCCAAGATAATGGTG0.092400.009700.569000.500000.945700.75000


Target Position: 2380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2380GAAUGUGGACAUGAAGAUU89.1194205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4972398GAATGTGGACATGAAGATTAATCTTCATGTCCACATTC0.150000.010200.663800.750001.000001.00000


Target Position: 755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
755UACAUCUUUUACACCUUUU70.14941591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
770773TACATCTTTTACACCTTTTAAAAGGTGTAAAAGATGTA0.474000.103900.681000.500001.000001.00000


Target Position: 1922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1922GGGUCCUUUGGAGUUACUG66.78641866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7371940GGGTCCTTTGGAGTTACTGCAGTAACTCCAAAGGACCC0.085900.002000.706900.750000.972800.87500


Target Position: 1565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1565CGAGGUCAUCAAGCAGGAA90.5453162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3781583CGAGGTCATCAAGCAGGAATTCCTGCTTGATGACCTCG0.506500.062100.620701.000001.000001.00000


Target Position: 1536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1536UCUUCAACCCAAUCUCACA82.7554561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5981554TCTTCAACCCAATCTCACATGTGAGATTGGGTTGAAGA0.497200.028200.517200.500001.000001.00000


Target Position: 1792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1792UGAUGUCACAGGUGGAAGA81.0892678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6861810TGATGTCACAGGTGGAAGATCTTCCACCTGTGACATCA0.048100.003300.500000.500001.000001.00000


Target Position: 1313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1313CCACAUUCUACAAGCACAA88.3853242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1841331CCACATTCTACAAGCACAATTGTGCTTGTAGAATGTGG0.525400.289900.698301.000001.000001.00000


Target Position: 1806, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1806GAAGAAGAGACCCAAAUCA91.7717125

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1804-1826TGGAAGAAGAGACCCAAATCATTUGAUUUGGGUCUCUUCUUCCAGAAGAAGAGACCCAAAUCAUUU20.119.121


Target Position: 2296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2296UCAGGAAAUGGUGCAUUUG59.7522410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8112314TCAGGAAATGGTGCATTTGCAAATGCACCATTTCCTGA0.027100.018200.577600.500001.000001.00000


Target Position: 1092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1092CCAGCACCAUUUCAACCAC71.92831434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201110CCAGCACCATTTCAACCACGTGGTTGAAATGGTGCTGG0.670100.169400.551700.750001.000001.00000


Target Position: 651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
651AAGGAGAAUACAGAACGAA83.6912494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
803669AAGGAGAATACAGAACGAATTCGTTCTGTATTCTCCTT0.653800.007000.465500.500001.000001.00000


Target Position: 756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756ACAUCUUUUACACCUUUUC61.20072306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
569774ACATCTTTTACACCTTTTCGAAAAGGTGTAAAAGATGT0.521600.435300.534500.500001.000001.00000


Target Position: 1314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1314CACAUUCUACAAGCACAAU81.348653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1421332CACATTCTACAAGCACAATATTGTGCTTGTAGAATGTG0.363800.225900.784500.750001.000001.00000


Target Position: 1737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1737UGGAAGAAGAUAAAGACCA75.89721087

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6731755TGGAAGAAGATAAAGACCATGGTCTTTATCTTCTTCCA0.518800.038100.500000.500001.000001.00000


Target Position: 6, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6ACCCAAGCUUCUAGAGAUC64.59922041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
76924ACCCAAGCTTCTAGAGATCGATCTCTAGAAGCTTGGGT0.019800.014100.672400.500000.978300.62500


Target Position: 730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730UGAAAGGAGCAGCACUUCA79.8404763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
763748TGAAAGGAGCAGCACTTCATGAAGTGCTGCTCCTTTCA0.063800.001700.500000.500001.000001.00000


Target Position: 2592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2592AGCAUUGCUUUGUAAAUUA88.8995220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6992610AGCATTGCTTTGTAAATTATAATTTACAAAGCAATGCT0.030500.003000.819000.750001.000001.00000


Target Position: 361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
361CACAAUGGCCCAGAUGGAG65.22871986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
760379CACAATGGCCCAGATGGAGCTCCATCTGGGCCATTGTG0.024600.003800.482800.500000.951100.62500


Target Position: 2860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2860GUACUAGUUACACAUCUUC73.78241276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6242878GTACTAGTTACACATCTTCGAAGATGTGTAACTAGTAC0.336000.039100.508600.500001.000001.00000


Target Position: 2018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2018GGGUCCCAUACCACUCAUG71.49481478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6442036GGGTCCCATACCACTCATGCATGAGTGGTATGGGACCC0.038200.007500.836200.750000.940200.62500


Target Position: 2552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2552UGUGUUUUGUUCUUUAAAG67.68661799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6402570TGTGTTTTGTTCTTTAAAGCTTTAAAGAACAAAACACA0.353100.078500.569000.500001.000001.00000


Target Position: 1650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1650UGGUGGAAAAUUUGGACAG61.16792310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6061668TGGTGGAAAATTTGGACAGCTGTCCAAATTTTCCACCA0.046200.013000.560300.500001.000001.00000


Target Position: 1055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055UCUGGAUCAGGCAUUGAUG65.73371958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8021073TCTGGATCAGGCATTGATGCATCAATGCCTGATCCAGA0.036000.002200.569000.500000.972800.62500


Target Position: 2352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2352UGACAGCUGAUGAGACAAG68.67631719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6482370TGACAGCTGATGAGACAAGCTTGTCTCATCAGCTGTCA0.553000.036500.586200.500001.000001.00000


Target Position: 910, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
910GUUUUCAUGGUUGUUUCUA78.0549910

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
908-930TGGTTTTCATGGTTGTTTCTACCUAGAAACAACCAUGAAAACCAGUUUUCAUGGUUGUUUCUACCU19.27.422


Target Position: 1024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1024UGAAGAUGAAAGAGACAGA85.1893398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6641042TGAAGATGAAAGAGACAGATCTGTCTCTTTCATCTTCA0.140000.096600.500000.500001.000001.00000


Target Position: 1611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1611GUACAACGCUUCAGCCUAC76.89151006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7851629GTACAACGCTTCAGCCTACGTAGGCTGAAGCGTTGTAC0.070200.022300.500000.500000.978301.00000


Target Position: 2833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2833GGCAUUGCUUUCCACUGAG73.97321253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4402851GGCATTGCTTTCCACTGAGCTCAGTGGAAAGCAATGCC0.097100.037800.689700.750001.000001.00000


Target Position: 1653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1653UGGAAAAUUUGGACAGGAC67.24411827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7411671TGGAAAATTTGGACAGGACGTCCTGTCCAAATTTTCCA0.040800.014000.525900.500001.000001.00000


Target Position: 1958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1958UCCAACUCUAAUGUCAAUC48.41062910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7011976TCCAACTCTAATGTCAATCGATTGACATTAGAGTTGGA0.080500.002800.689700.500001.000001.00000


Target Position: 2541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2541UUUUUGUUUUUUGUGUUUU57.87092532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8152559TTTTTGTTTTTTGTGTTTTAAAACACAAAAAACAAAAA0.125300.089500.500000.500001.000001.00000


Target Position: 2357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2357GCUGAUGAGACAAGGAACC62.44862217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6902375GCTGATGAGACAAGGAACCGGTTCCTTGTCTCATCAGC0.144000.036100.500000.500001.000001.00000


Target Position: 1352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1352ACAACGGAAGAAACAGCUA81.4629648

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5591370ACAACGGAAGAAACAGCTATAGCTGTTTCTTCCGTTGT0.123400.033000.534500.750001.000001.00000


Target Position: 1396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1396CAGAUGGCAUGAGGGAUAU80.0564748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341414CAGATGGCATGAGGGATATATATCCCTCATGCCATCTG0.098200.021700.741400.750001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051UUUUUCUGGAUCAGGCAUU57.78152537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8071069TTTTTCTGGATCAGGCATTAATGCCTGATCCAGAAAAA0.039900.001200.491400.500000.983701.00000


Target Position: 2593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2593GCAUUGCUUUGUAAAUUAG79.5833780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7612611GCATTGCTTTGTAAATTAGCTAATTTACAAAGCAATGC0.022900.001700.681000.750001.000001.00000


Target Position: 1263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1263AAGCACACCCUCCCCUCAU68.5481726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7591281AAGCACACCCTCCCCTCATATGAGGGGAGGGTGTGCTT0.040800.016500.482800.500000.994600.62500


Target Position: 2195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2195CGAAGAAGGUGUGGGCAGA84.7105436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4642213CGAAGAAGGTGTGGGCAGATCTGCCCACACCTTCTTCG0.198400.105400.569000.750001.000001.00000


Target Position: 3031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3031GAGGCACAAAAGGGUUUAA86.8989309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4633049GAGGCACAAAAGGGTTTAATTAAACCCTTTTGTGCCTC0.117800.012900.775900.750001.000001.00000


Target Position: 2694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2694UAACAAAAACUACACAUAU82.3264592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7312712TAACAAAAACTACACATATATATGTGTAGTTTTTGTTA0.241300.193400.491400.500001.000001.00000


Target Position: 1310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1310ACCCCACAUUCUACAAGCA82.3743589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7271328ACCCCACATTCTACAAGCATGCTTGTAGAATGTGGGGT0.358400.283600.500000.500001.000001.00000


Target Position: 1838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1838ACUACUUUACUGGAAGGUU72.511376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7961856ACTACTTTACTGGAAGGTTAACCTTCCAGTAAAGTAGT0.016300.004500.560300.750001.000001.00000


Target Position: 1417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1417CCAAACACCCAGAGAAGAC68.92511699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5721435CCAAACACCCAGAGAAGACGTCTTCTCTGGGTGTTTGG0.412000.187700.525900.750001.000001.00000


Target Position: 1018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1018AGAAAAUGAAGAUGAAAGA84.6855439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7191036AGAAAATGAAGATGAAAGATCTTTCATCTTCATTTTCT0.187400.193300.500000.500001.000001.00000


Target Position: 2963, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2963GUGUUUUUGAAAUAUUAAA88.2927245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3702981GTGTTTTTGAAATATTAAATTTAATATTTCAAAAACAC0.345700.176900.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2961-2983CTGTGTTTTTGAAATATTAAACCUUUAAUAUUUCAAAAACACAGGUGUUUUUGAAAUAUUAAACCU-8.05.621


Target Position: 2346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2346AGUUUAUGACAGCUGAUGA89.9993181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7612364AGTTTATGACAGCTGATGATCATCAGCTGTCATAAACT0.074000.011600.482800.500001.000001.00000


Target Position: 3049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3049AACUGAUUCAUAAUAAAUA92.7027101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4753067AACTGATTCATAATAAATATATTTATTATGAATCAGTT0.720900.127700.603400.500001.000001.00000


Target Position: 1402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1402GCAUGAGGGAUAUCGCCAA91.0909143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7411420GCATGAGGGATATCGCCAATTGGCGATATCCCTCATGC0.130700.002000.706901.000001.000001.00000


Target Position: 1773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1773UGACAUCAAGCAAUAGGAA86.0382356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301791TGACATCAAGCAATAGGAATTCCTATTGCTTGATGTCA0.112200.014400.551700.750001.000001.00000


Target Position: 952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
952UCACACAACAACACAAAUG62.34862225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
465970TCACACAACAACACAAATGCATTTGTGTTGTTGTGTGA0.312600.227300.569000.500001.000001.00000


Target Position: 2931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2931GAAGCUAUUUAUCUGUAGU88.1426251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8102949GAAGCTATTTATCTGTAGTACTACAGATAAATAGCTTC0.035700.003400.465500.500001.000001.00000


Target Position: 924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
924UUCUACCAUCAGAGUCAAA77.832930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
726942TTCTACCATCAGAGTCAAATTTGACTCTGATGGTAGAA0.066600.010200.672400.500000.962000.62500


Target Position: 2151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2151UGGCCUUGGCUUUGAUUCU65.87821943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6572169TGGCCTTGGCTTTGATTCTAGAATCAAAGCCAAGGCCA0.067900.007100.620700.500000.940200.75000


Target Position: 695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
695CCUACUGAUGAUGACGUGA81.6525629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
667713CCTACTGATGATGACGTGATCACGTCATCATCAGTAGG0.035300.004900.620700.750001.000001.00000


Target Position: 2223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2223UAGUGAUCAACAGUGGCAA79.6779775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7722241TAGTGATCAACAGTGGCAATTGCCACTGTTGATCACTA0.035900.007900.525900.500001.000001.00000


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050GUUUUUCUGGAUCAGGCAU74.78321176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8031068GTTTTTCTGGATCAGGCATATGCCTGATCCAGAAAAAC0.045900.001300.491400.750000.983701.00000


Target Position: 1788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1788GGAAUGAUGUCACAGGUGG71.08011518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201806GGAATGATGTCACAGGTGGCCACCTGTGACATCATTCC0.040900.001400.525900.500001.000001.00000


Target Position: 2577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2577CCAAUUUGUAAAAACAGCA82.6544568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7382595CCAATTTGTAAAAACAGCATGCTGTTTTTACAAATTGG0.115000.020700.491400.750000.994600.87500


Target Position: 2224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2224AGUGAUCAACAGUGGCAAU83.6511496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6792242AGTGATCAACAGTGGCAATATTGCCACTGTTGATCACT0.033400.011100.698300.750001.000001.00000


Target Position: 1009, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1009GCCAAAUGAAGAAAAUGAA90.3527172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1291027GCCAAATGAAGAAAATGAATTCATTTTCTTCATTTGGC0.387400.159600.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1007-1029GAGCCAAATGAAGAAAATGAAGAUUCAUUUUCUUCAUUUGGCUCGCCAAAUGAAGAAAAUGAAGAU7.417.722


Target Position: 1599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1599ACUCCAGUCAUAGUACAAC66.46161894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911617ACTCCAGTCATAGTACAACGTTGTACTATGACTGGAGT0.178300.021300.560300.500001.000001.00000


Target Position: 662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
662AGAACGAAUCCUGAAGACA83.1245539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
766680AGAACGAATCCTGAAGACATGTCTTCAGGATTCGTTCT0.020700.012900.517200.500001.000001.00000


Target Position: 2574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2574GGUCCAAUUUGUAAAAACA98.349218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4782592GGTCCAATTTGTAAAAACATGTTTTTACAAATTGGACC0.079300.016800.646600.750001.000001.00000


Target Position: 1687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1687GACAACGCAGCAGAGUAAU75.12461147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5271705GACAACGCAGCAGAGTAATATTACTCTGCTGCGTTGTC0.066500.052300.810300.750001.000001.00000


Target Position: 1415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1415CGCCAAACACCCAGAGAAG74.04211249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1571433CGCCAAACACCCAGAGAAGCTTCTCTGGGTGTTTGGCG0.372100.068900.784500.750001.000001.00000


Target Position: 1530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1530CUGAUUUCUUCAACCCAAU78.4666863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2821548CTGATTTCTTCAACCCAATATTGGGTTGAAGAAATCAG0.190500.034700.775900.750000.945700.75000


Target Position: 3035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3035CACAAAAGGGUUUAAACUG71.82741446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7813053CACAAAAGGGTTTAAACTGCAGTTTAAACCCTTTTGTG0.087700.054000.508600.500001.000001.00000


Target Position: 2410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2410CCUACACCAUUAUCUUGGA87.1423296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7902428CCTACACCATTATCTTGGATCCAAGATAATGGTGTAGG0.034200.002600.474100.750000.945700.62500


Target Position: 1430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1430GAAGACUCCCAUUCGACAA90.1957176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5741448GAAGACTCCCATTCGACAATTGTCGAATGGGAGTCTTC0.789600.029100.525900.750001.000001.00000


Target Position: 2571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2571UCAGGUCCAAUUUGUAAAA76.15031064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5052589TCAGGTCCAATTTGTAAAATTTTACAAATTGGACCTGA0.071300.014800.724100.750001.000001.00000


Target Position: 1985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1985UCAGGAGACCAAGACACAU75.54471116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6632003TCAGGAGACCAAGACACATATGTGTCTTGGTCTCCTGA0.183300.003500.569000.750001.000001.00000


Target Position: 2339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2339CCAGACCAGUUUAUGACAG70.84371535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6202357CCAGACCAGTTTATGACAGCTGTCATAAACTGGTCTGG0.042500.005700.560300.750001.000001.00000


Target Position: 1597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1597GGACUCCAGUCAUAGUACA94.145275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4651615GGACTCCAGTCATAGTACATGTACTATGACTGGAGTCC0.189700.012900.663800.750000.956500.62500


Target Position: 2952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2952ACUAUUUAUCUGUGUUUUU76.57951032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3262970ACTATTTATCTGTGTTTTTAAAAACACAGATAAATAGT0.210700.126400.706900.750001.000001.00000


Target Position: 1353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1353CAACGGAAGAAACAGCUAC72.64521367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8131371CAACGGAAGAAACAGCTACGTAGCTGTTTCTTCCGTTG0.105300.030700.465500.500001.000001.00000


Target Position: 1770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1770CUCUGACAUCAAGCAAUAG74.4291216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6641788CTCTGACATCAAGCAATAGCTATTGCTTGATGTCAGAG0.152200.029600.637900.500001.000001.00000


Target Position: 3037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3037CAAAAGGGUUUAAACUGAU85.6671377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8183055CAAAAGGGTTTAAACTGATATCAGTTTAAACCCTTTTG0.065600.038900.465500.750001.000001.00000


Target Position: 80, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
80UCGGUCCGCCAUCCUCGUC45.66612957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
78998TCGGTCCGCCATCCTCGTCGACGAGGATGGCGGACCGA0.364000.001500.474100.500000.983700.75000


Target Position: 1058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1058GGAUCAGGCAUUGAUGAUG75.95741082

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8131076GGATCAGGCATTGATGATGCATCATCAATGCCTGATCC0.030800.001200.715500.750000.972800.75000


Target Position: 750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
750GAGGUUACAUCUUUUACAC80.3373725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
689768GAGGTTACATCTTTTACACGTGTAAAAGATGTAACCTC0.477100.017100.517200.500001.000001.00000


Target Position: 1104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1104CAACCACACCACGGGCCUU74.97061161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7811122CAACCACACCACGGGCCTTAAGGCCCGTGGTGTGGTTG0.018800.017800.508600.750000.907600.75000


Target Position: 1529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1529ACUGAUUUCUUCAACCCAA86.9827303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071547ACTGATTTCTTCAACCCAATTGGGTTGAAGAAATCAGT0.071200.025900.560300.750000.945700.75000


Target Position: 1006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1006GGAGCCAAAUGAAGAAAAU87.3192287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2061024GGAGCCAAATGAAGAAAATATTTTCTTCATTTGGCTCC0.262000.072100.862101.000001.000001.00000


Target Position: 515, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
515CAGUAUGACACAUAUUGCU85.1915397

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
513-535CCCAGTATGACACATATTGCTTCAGCAAUAUGUGUCAUACUGGGCAGUAUGACACAUAUUGCUUCU15.220.333


Target Position: 1474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1474UACCAGCCAUCCAAUGCAA80.8515691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7431492TACCAGCCATCCAATGCAATTGCATTGGATGGCTGGTA0.038100.005200.534500.500000.972800.75000


Target Position: 746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
746UCAGGAGGUUACAUCUUUU81.5346642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
721764TCAGGAGGTTACATCTTTTAAAAGATGTAACCTCCTGA0.292900.002400.724100.750001.000001.00000


Target Position: 1796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1796GUCACAGGUGGAAGAAGAG73.71191282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7381814GTCACAGGTGGAAGAAGAGCTCTTCTTCCACCTGTGAC0.370500.003500.508600.500001.000001.00000


Target Position: 1097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1097ACCAUUUCAACCACACCAC58.85462468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7741115ACCATTTCAACCACACCACGTGGTGTGGTTGAAATGGT0.549100.522000.560300.500001.000001.00000


Target Position: 596, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
596GAUGGACCAAUUACCAUAA94.970556

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_659619GATGGACCAATTACCATAA1/1/0/094.96CD44NM_001001390.1+NM_001001391.1+NM_000610.3+NM_001001389.1+NM_001001392.11+1+1+1+0NANANA11:35208429..35208447(+)00CD44(0.002)


Target Position: 2862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2862ACUAGUUACACAUCUUCAA86.6207324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5132880ACTAGTTACACATCTTCAATTGAAGATGTGTAACTAGT0.138100.056300.560300.750001.000001.00000


Target Position: 287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
287GAGAAAAAUGGUCGCUACA88.4861236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
700305GAGAAAAATGGTCGCTACATGTAGCGACCATTTTTCTC0.058300.002800.603400.500001.000001.00000


Target Position: 2877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2877UCAACAGACCCCCUCUAGA75.31661135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7082895TCAACAGACCCCCTCTAGATCTAGAGGGGGTCTGTTGA0.244100.097300.500000.500000.934800.75000


Target Position: 521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
521GACACAUAUUGCUUCAAUG85.674376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
560539GACACATATTGCTTCAATGCATTGAAGCAATATGTGTC0.552500.041700.663800.500001.000001.00000


Target Position: 796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
796CGAAGACAGUCCCUGGAUC75.41311126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
746814CGAAGACAGTCCCTGGATCGATCCAGGGACTGTCTTCG0.028000.002000.612100.750001.000001.00000


Target Position: 2534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2534UCUACUCUUUUUGUUUUUU65.36781980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2702552TCTACTCTTTTTGTTTTTTAAAAAACAAAAAGAGTAGA0.199000.135300.724100.750001.000001.00000


Target Position: 1923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1923GGUCCUUUGGAGUUACUGC71.05281521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8101941GGTCCTTTGGAGTTACTGCGCAGTAACTCCAAAGGACC0.112600.001200.500000.500000.972800.75000


Target Position: 2107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2107GACACCCCAAAUUCCAGAA82.5085577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3662125GACACCCCAAATTCCAGAATTCTGGAATTTGGGGTGTC0.131100.062300.646600.750001.000001.00000


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742CACUUCAGGAGGUUACAUC72.27271397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
731760CACTTCAGGAGGTTACATCGATGTAACCTCCTGAAGTG0.034100.002100.612100.500001.000001.00000


Target Position: 2379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2379AGAAUGUGGACAUGAAGAU80.8011694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5372397AGAATGTGGACATGAAGATATCTTCATGTCCACATTCT0.176700.014400.543100.750001.000001.00000


Target Position: 173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
173GACACCAUGGACAAGUUUU81.469647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
476191GACACCATGGACAAGTTTTAAAACTTGTCCATGGTGTC0.105700.012000.819000.750001.000001.00000


Target Position: 1414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1414UCGCCAAACACCCAGAGAA77.6088947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3801432TCGCCAAACACCCAGAGAATTCTCTGGGTGTTTGGCGA0.443700.129200.620700.750001.000001.00000


Target Position: 2633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2633GAAUUUGAUCGUUCAGUUC76.34611046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6992651GAATTTGATCGTTCAGTTCGAACTGAACGATCAAATTC0.081400.007400.500000.500001.000001.00000


Target Position: 230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
230AGCCUGGCGCAGAUCGAUU72.37671385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
308248AGCCTGGCGCAGATCGATTAATCGATCTGCGCCAGGCT0.418500.029800.844800.750000.929300.75000


Target Position: 1093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1093CAGCACCAUUUCAACCACA88.0742253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7761111CAGCACCATTTCAACCACATGTGGTTGAAATGGTGCTG0.670400.244900.577600.500001.000001.00000


Target Position: 1056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1056CUGGAUCAGGCAUUGAUGA80.5818708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7361074CTGGATCAGGCATTGATGATCATCAATGCCTGATCCAG0.034200.002100.560300.500000.972800.75000


Target Position: 745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
745UUCAGGAGGUUACAUCUUU69.87791617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
775763TTCAGGAGGTTACATCTTTAAAGATGTAACCTCCTGAA0.293600.001500.672400.500001.000001.00000


Target Position: 2207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2207GGGCAGAAGAAAAAGCUAG74.66061187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7052225GGGCAGAAGAAAAAGCTAGCTAGCTTTTTCTTCTGCCC0.029300.007900.819000.750001.000001.00000


Target Position: 1106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1106ACCACACCACGGGCCUUUG54.39752706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7921124ACCACACCACGGGCCTTTGCAAAGGCCCGTGGTGTGGT0.016500.012600.706900.500000.907600.75000


Target Position: 1094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1094AGCACCAUUUCAACCACAC64.89032024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6711112AGCACCATTTCAACCACACGTGTGGTTGAAATGGTGCT0.595900.256400.560300.500001.000001.00000


Target Position: 3052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3052UGAUUCAUAAUAAAUAUCU74.25091235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7603070TGATTCATAATAAATATCTAGATATTTATTATGAATCA0.664300.190800.500000.500001.000001.00000


Target Position: 2286, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2286CCAGCAAGUCUCAGGAAAU87.4506281

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10228619CCAGCAAGTCTCAGGAAAT1/1/0/094.96CD44NM_001001390.1+NM_001001392.1+NM_001001391.1+NM_000610.3+NM_001001389.11+1+1+1+1NANANA11:35250759..35250777(+)00CD44(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6162304CCAGCAAGTCTCAGGAAATATTTCCTGAGACTTGCTGG0.046800.004800.836201.000001.000001.00000


Target Position: 2680, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2680CUAUGGAUGGCUUCUAACA87.9008264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232698CTATGGATGGCTTCTAACATGTTAGAAGCCATCCATAG0.166800.001200.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2678-2700TGCTATGGATGGCTTCTAACAAAUGUUAGAAGCCAUCCAUAGCACUAUGGAUGGCUUCUAACAAAU14.621.222


Target Position: 2523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2523GCAUAAAAUUUUCUACUCU88.6733230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3562541GCATAAAATTTTCTACTCTAGAGTAGAAAATTTTATGC0.770400.088000.629300.750001.000001.00000


Target Position: 680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
680AUCUACCCCAGCAACCCUA71.7841454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
649698ATCTACCCCAGCAACCCTATAGGGTTGCTGGGGTAGAT0.753200.157200.508600.500001.000001.00000


Target Position: 1394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1394AACAGAUGGCAUGAGGGAU74.27641231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8061412AACAGATGGCATGAGGGATATCCCTCATGCCATCTGTT0.094300.022300.465500.500001.000001.00000


Target Position: 2355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2355CAGCUGAUGAGACAAGGAA91.4623133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4062373CAGCTGATGAGACAAGGAATTCCTTGTCTCATCAGCTG0.683000.068600.612100.750001.000001.00000


Target Position: 496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
496CCUCACAUACAACACCUCC65.09112002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
797514CCTCACATACAACACCTCCGGAGGTGTTGTATGTGAGG0.434400.164100.474100.500001.000001.00000


Target Position: 1187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1187CUACUUCAGACAACCACAA86.2187342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5891205CTACTTCAGACAACCACAATTGTGGTTGTCTGAAGTAG0.061200.007000.525900.750001.000001.00000


Target Position: 1165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1165AAGCCAUUCAAAUCCGGAA80.9799685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8191183AAGCCATTCAAATCCGGAATTCCGGATTTGAATGGCTT0.220700.060200.465500.500000.962000.62500


Target Position: 1738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1738GGAAGAAGAUAAAGACCAU98.124620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1961756GGAAGAAGATAAAGACCATATGGTCTTTATCTTCTTCC0.337800.049100.715501.000001.000001.00000


Target Position: 1793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1793GAUGUCACAGGUGGAAGAA86.5478326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6221811GATGTCACAGGTGGAAGAATTCTTCCACCTGTGACATC0.054300.006700.508600.750001.000001.00000


Target Position: 2071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2071AGAAGGUGGAGCAAACACA86.4622330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242089AGAAGGTGGAGCAAACACATGTGTTTGCTCCACCTTCT0.307300.002300.517200.500000.994600.62500


Target Position: 1130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1130ACAAAACAGAACCAGGACU69.32281664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6591148ACAAAACAGAACCAGGACTAGTCCTGGTTCTGTTTTGT0.058600.042600.500000.500001.000001.00000


Target Position: 1037, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1037GACAGACACCUCAGUUUUU87.9915257

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7103719GACAGACACCTCAGTTTTT1/1/0/094.96CD44NM_000610.3+NM_001001389.1+NM_001001392.1+NM_001001391.1+NM_001001390.11+1+0+0+0NANANA11:35219730..35219748(+)00CD44(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6841055GACAGACACCTCAGTTTTTAAAAACTGAGGTGTCTGTC0.032800.003900.819000.750001.000001.00000


Target Position: 1065, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1065GCAUUGAUGAUGAUGAAGA90.2309174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7521083GCATTGATGATGATGAAGATCTTCATCATCATCAATGC0.022600.003600.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1063-1085AGGCATTGATGATGATGAAGATTUCUUCAUCAUCAUCAAUGCCUGCAUUGAUGAUGAUGAAGAUUU20.413.621


Target Position: 969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
969UGGCUGGUACGUCUUCAAA81.0305681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
585987TGGCTGGTACGTCTTCAAATTTGAAGACGTACCAGCCA0.263800.005900.844800.750001.000001.00000


Target Position: 2535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2535CUACUCUUUUUGUUUUUUG67.73331796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5752553CTACTCTTTTTGTTTTTTGCAAAAAACAAAAAGAGTAG0.179100.133100.525900.500001.000001.00000


Target Position: 1072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1072UGAUGAUGAAGAUUUUAUC72.98311342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8021090TGATGATGAAGATTTTATCGATAAAATCTTCATCATCA0.048600.001300.543100.500001.000001.00000


Target Position: 2995, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2995CUUUGAUCAGUAUAAUUUU86.2742339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7173013CTTTGATCAGTATAATTTTAAAATTATACTGATCAAAG0.194200.002500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2993-3015TCCTTTGATCAGTATAATTTTTTAAAAUUAUACUGAUCAAAGGACUUUGAUCAGUAUAAUUUUUUU-10.316.322


Target Position: 928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
928ACCAUCAGAGUCAAAGAAU74.931167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
474946ACCATCAGAGTCAAAGAATATTCTTTGACTCTGATGGT0.088700.012200.844800.750001.000001.00000


Target Position: 1901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1901CCAGUGACCUCAGCUAAGA82.5691572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6851919CCAGTGACCTCAGCTAAGATCTTAGCTGAGGTCACTGG0.032700.003400.620700.750001.000001.00000


Target Position: 296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
296GGUCGCUACAGCAUCUCUC73.82771270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
742314GGTCGCTACAGCATCTCTCGAGAGATGCTGTAGCGACC0.026600.002000.543100.750000.983701.00000


Target Position: 2934, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2934GCUAUUUAUCUGUAGUAAA97.87922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5972952GCTATTTATCTGTAGTAAATTTACTACAGATAAATAGC0.046500.010800.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2932-2954AAGCTATTTATCTGTAGTAAACTUUUACUACAGAUAAAUAGCUUGCUAUUUAUCUGUAGUAAACUU14.3-2.322


Target Position: 1795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1795UGUCACAGGUGGAAGAAGA80.3606722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7731813TGTCACAGGTGGAAGAAGATCTTCTTCCACCTGTGACA0.230100.003500.482800.500001.000001.00000


Target Position: 3069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3069CUGUACUUCUUCGAUCUUC66.17311920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4493087CTGTACTTCTTCGATCTTCGAAGATCGAAGAAGTACAG0.647800.475900.612100.500001.000001.00000


Target Position: 2435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2435CAACCGUUGGAAACAUAAC72.12371413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7972453CAACCGTTGGAAACATAACGTTATGTTTCCAACGGTTG0.096000.019800.500000.500001.000001.00000


Target Position: 2859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2859UGUACUAGUUACACAUCUU86.2942338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4752877TGTACTAGTTACACATCTTAAGATGTGTAACTAGTACA0.333700.038300.569000.750001.000001.00000


Target Position: 1622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1622CAGCCUACUGCAAAUCCAA92.950696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3291640CAGCCTACTGCAAATCCAATTGGATTTGCAGTAGGCTG0.174500.043200.637900.750000.983700.75000


Target Position: 646, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
646CCAGAAAGGAGAAUACAGA89.5281197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
711664CCAGAAAGGAGAATACAGATCTGTATTCTCCTTTCTGG0.615300.002700.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
644-666GTCCAGAAAGGAGAATACAGAACUCUGUAUUCUCCUUUCUGGACCCAGAAAGGAGAAUACAGAACU11.616.621


Target Position: 1429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1429AGAAGACUCCCAUUCGACA87.99258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6821447AGAAGACTCCCATTCGACATGTCGAATGGGAGTCTTCT0.786000.029300.517200.500001.000001.00000


Target Position: 1186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1186GCUACUUCAGACAACCACA92.105115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5481204GCTACTTCAGACAACCACATGTGGTTGTCTGAAGTAGC0.062200.010900.646600.750001.000001.00000


Target Position: 2961, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2961CUGUGUUUUUGAAAUAUUA94.529667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2022979CTGTGTTTTTGAAATATTATAATATTTCAAAAACACAG0.332500.154000.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2959-2981ATCTGTGTTTTTGAAATATTAAAUAAUAUUUCAAAAACACAGAUCUGUGUUUUUGAAAUAUUAAAU-10.319.322


Target Position: 1337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1337GCAACUCCUAGUAGUACAA92.345111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3651355GCAACTCCTAGTAGTACAATTGTACTACTAGGAGTTGC0.131200.026200.706901.000001.000001.00000


Target Position: 3032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3032AGGCACAAAAGGGUUUAAA76.12171068

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3403050AGGCACAAAAGGGTTTAAATTTAAACCCTTTTGTGCCT0.145900.089700.844800.750001.000001.00000


Target Position: 1159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159GAACCCAAGCCAUUCAAAU83.4437515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3251177GAACCCAAGCCATTCAAATATTTGAATGGCTTGGGTTC0.158700.040200.663800.750001.000001.00000


Target Position: 740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
740AGCACUUCAGGAGGUUACA75.59561111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
723758AGCACTTCAGGAGGTTACATGTAACCTCCTGAAGTGCT0.026900.003200.646600.500001.000001.00000


Target Position: 1592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1592GAUAUGGACUCCAGUCAUA99.91548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6651610GATATGGACTCCAGTCATATATGACTGGAGTCCATATC0.035500.004100.637900.750000.956500.87500


Target Position: 3044, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3044GUUUAAACUGAUUCAUAAU88.908219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3313062GTTTAAACTGATTCATAATATTATGAATCAGTTTAAAC0.202500.041200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3042-3064GGGTTTAAACTGATTCATAATAAAUUAUGAAUCAGUUUAAACCCGUUUAAACUGAUUCAUAAUAAU8.90.032


Target Position: 2426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2426GGAAAGAAACAACCGUUGG65.07212003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5802444GGAAAGAAACAACCGTTGGCCAACGGTTGTTTCTTTCC0.070900.066900.525900.500001.000001.00000


Target Position: 2590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2590ACAGCAUUGCUUUGUAAAU78.3208877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7382608ACAGCATTGCTTTGTAAATATTTACAAAGCAATGCTGT0.024200.003200.698300.750000.962000.75000


Target Position: 2068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2068UCAAGAAGGUGGAGCAAAC67.50791811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6332086TCAAGAAGGTGGAGCAAACGTTTGCTCCACCTTCTTGA0.482100.015500.577600.500001.000001.00000


Target Position: 295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
295UGGUCGCUACAGCAUCUCU76.12321067

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
788313TGGTCGCTACAGCATCTCTAGAGATGCTGTAGCGACCA0.023900.001400.620700.500000.983701.00000


Target Position: 1303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1303AGAAGAGACCCCACAUUCU81.4013650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6931321AGAAGAGACCCCACATTCTAGAATGTGGGGTCTCTTCT0.497700.047600.500000.500001.000001.00000


Target Position: 88, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
88CCAUCCUCGUCCCGUCCUC60.51222360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
553106CCATCCTCGTCCCGTCCTCGAGGACGGGACGAGGATGG0.214000.184400.534500.750001.000001.00000


Target Position: 1864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1864UCAUUACCCACACACGAAG60.63382348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811882TCATTACCCACACACGAAGCTTCGTGTGTGGGTAATGA0.078100.067600.586200.500001.000001.00000


Target Position: 2416, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2416CCAUUAUCUUGGAAAGAAA98.233719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3012434CCATTATCTTGGAAAGAAATTTCTTTCCAAGATAATGG0.466900.027900.844801.000000.978300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2414-2436CACCATTATCTTGGAAAGAAACAUUUCUUUCCAAGAUAAUGGUGCCAUUAUCUUGGAAAGAAACAU14.88.732


Target Position: 676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676AGACAUCUACCCCAGCAAC69.72371635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
469694AGACATCTACCCCAGCAACGTTGCTGGGGTAGATGTCT0.276800.039000.577600.500001.000001.00000


Target Position: 2679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2679GCUAUGGAUGGCUUCUAAC73.77471277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8242697GCTATGGATGGCTTCTAACGTTAGAAGCCATCCATAGC0.118500.001000.706900.750001.000001.00000


Target Position: 2437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2437ACCGUUGGAAACAUAACCA76.13181066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6132455ACCGTTGGAAACATAACCATGGTTATGTTTCCAACGGT0.100900.021900.508600.500000.902200.62500


Target Position: 2539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2539UCUUUUUGUUUUUUGUGUU68.87671703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4572557TCTTTTTGTTTTTTGTGTTAACACAAAAAACAAAAAGA0.135200.100200.577600.750001.000001.00000


Target Position: 2573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2573AGGUCCAAUUUGUAAAAAC71.81881447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7502591AGGTCCAATTTGTAAAAACGTTTTTACAAATTGGACCT0.070500.014500.698300.500001.000001.00000


Target Position: 2351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2351AUGACAGCUGAUGAGACAA82.2359597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6302369ATGACAGCTGATGAGACAATTGTCTCATCAGCTGTCAT0.551000.030400.508600.500001.000001.00000


Target Position: 1036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1036AGACAGACACCUCAGUUUU81.0403680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6771054AGACAGACACCTCAGTTTTAAAACTGAGGTGTCTGTCT0.127000.003300.724100.750001.000001.00000


Target Position: 1774, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1774GACAUCAAGCAAUAGGAAU83.3842517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7191792GACATCAAGCAATAGGAATATTCCTATTGCTTGATGTC0.027300.011200.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1772-1794CTGACATCAAGCAATAGGAATGAAUUCCUAUUGCUUGAUGUCAGGACAUCAAGCAAUAGGAAUGAU19.920.532


Target Position: 2791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2791AUUUGAAUGGGUCCAUUUU71.76431456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6182809ATTTGAATGGGTCCATTTTAAAATGGACCCATTCAAAT0.044400.005400.508600.500000.989100.75000


Target Position: 2443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2443GGAAACAUAACCAUUACAG76.46381041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6982461GGAAACATAACCATTACAGCTGTAATGGTTATGTTTCC0.030500.008300.586200.750001.000001.00000


Target Position: 2564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2564UUUAAAGUCAGGUCCAAUU67.09781841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7432582TTTAAAGTCAGGTCCAATTAATTGGACCTGACTTTAAA0.065100.044000.491400.500001.000001.00000


Target Position: 2737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2737CCCACCAGCUAAGGACAUU72.3581386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4612755CCCACCAGCTAAGGACATTAATGTCCTTAGCTGGTGGG0.086200.020100.982801.000000.951100.62500


Target Position: 1202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1202ACAAGGAUGACUGAUGUAG65.54121968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7861220ACAAGGATGACTGATGTAGCTACATCAGTCATCCTTGT0.046400.010300.534500.500001.000001.00000


Target Position: 37, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
37GAUCCAUUGUGCUCUAAAG85.885365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
66555GATCCATTGTGCTCTAAAGCTTTAGAGCACAATGGATC0.142600.081400.543100.500001.000001.00000


Target Position: 2316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2316UGAACAAGGAGUCGUCAGA77.9306920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8062334TGAACAAGGAGTCGTCAGATCTGACGACTCCTTGTTCA0.015100.002300.500000.500000.956500.62500


Target Position: 1171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1171UUCAAAUCCGGAAGUGCUA69.0921685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7841189TTCAAATCCGGAAGTGCTATAGCACTTCCGGATTTGAA0.106900.001500.500000.500001.000001.00000


Target Position: 1406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1406GAGGGAUAUCGCCAAACAC78.6827846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7131424GAGGGATATCGCCAAACACGTGTTTGGCGATATCCCTC0.220400.004100.517200.500001.000001.00000


Target Position: 2933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2933AGCUAUUUAUCUGUAGUAA91.4326134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6522951AGCTATTTATCTGTAGTAATTACTACAGATAAATAGCT0.036700.007700.819000.750001.000001.00000


Target Position: 2503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2503UUCAUUGCGAAUCUUUUUU55.5782656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5462521TTCATTGCGAATCTTTTTTAAAAAAGATTCGCAATGAA0.339900.065300.672400.500001.000001.00000


Target Position: 229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
229GAGCCUGGCGCAGAUCGAU79.5353782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
354247GAGCCTGGCGCAGATCGATATCGATCTGCGCCAGGCTC0.407300.028100.629300.750000.929300.75000


Target Position: 423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
423UAGAAGGGCAUGUGGUGAU70.3741573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
773441TAGAAGGGCATGTGGTGATATCACCACATGCCCTTCTA0.019600.004400.491400.500001.000001.00000


Target Position: 2289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2289GCAAGUCUCAGGAAAUGGU78.7703842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6712307GCAAGTCTCAGGAAATGGTACCATTTCCTGAGACTTGC0.149900.006800.500000.750001.000001.00000


Target Position: 3041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3041AGGGUUUAAACUGAUUCAU71.43021487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3523059AGGGTTTAAACTGATTCATATGAATCAGTTTAAACCCT0.140700.031400.689700.750001.000001.00000


Target Position: 2502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2502UUUCAUUGCGAAUCUUUUU64.50642052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7392520TTTCATTGCGAATCTTTTTAAAAAGATTCGCAATGAAA0.320900.052500.500000.500001.000001.00000


Target Position: 2148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2148UCUUGGCCUUGGCUUUGAU71.13531513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8112166TCTTGGCCTTGGCTTTGATATCAAAGCCAAGGCCAAGA0.017100.001200.543100.750000.940201.00000


Target Position: 2579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2579AAUUUGUAAAAACAGCAUU72.70221361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6702597AATTTGTAAAAACAGCATTAATGCTGTTTTTACAAATT0.134800.015800.500000.500000.994601.00000


Target Position: 281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
281CACGUGGAGAAAAAUGGUC64.24732078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
792299CACGTGGAGAAAAATGGTCGACCATTTTTCTCCACGTG0.061700.014300.474100.500001.000001.00000


Target Position: 2133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2133UCAUCUUGGCAUCCCUCUU68.91841700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5232151TCATCTTGGCATCCCTCTTAAGAGGGATGCCAAGATGA0.320100.008800.586200.750000.923901.00000


Target Position: 2305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2305GGUGCAUUUGGUGAACAAG75.79561096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6342323GGTGCATTTGGTGAACAAGCTTGTTCACCAAATGCACC0.040400.007800.715500.750001.000001.00000


Target Position: 950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
950CUUCACACAACAACACAAA84.6239442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
322968CTTCACACAACAACACAAATTTGTGTTGTTGTGTGAAG0.763000.598000.637900.750001.000001.00000


Target Position: 1098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1098CCAUUUCAACCACACCACG65.95211935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5101116CCATTTCAACCACACCACGCGTGGTGTGGTTGAAATGG0.188800.057200.569000.500001.000001.00000


Target Position: 929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
929CCAUCAGAGUCAAAGAAUC78.7574844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
430947CCATCAGAGTCAAAGAATCGATTCTTTGACTCTGATGG0.099000.016300.663800.750001.000001.00000


Target Position: 2345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2345CAGUUUAUGACAGCUGAUG69.1051683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7162363CAGTTTATGACAGCTGATGCATCAGCTGTCATAAACTG0.069100.009100.629300.500001.000001.00000


Target Position: 2464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2464AGCUGGGACACUUAACAGA82.3765588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7622482AGCTGGGACACTTAACAGATCTGTTAAGTGTCCCAGCT0.155500.021000.629300.500001.000001.00000


Target Position: 2496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2496UGAUUGUUUCAUUGCGAAU75.12371149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6062514TGATTGTTTCATTGCGAATATTCGCAATGAAACAATCA0.075400.005100.715500.750001.000001.00000


Target Position: 2801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2801GUCCAUUUUGCCCUUCCAU73.74061279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6782819GTCCATTTTGCCCTTCCATATGGAAGGGCAAAATGGAC0.033900.007200.663800.750001.000001.00000


Target Position: 2412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2412UACACCAUUAUCUUGGAAA77.2587972

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6682430TACACCATTATCTTGGAAATTTCCAAGATAATGGTGTA0.041600.003400.681000.500000.945700.87500


Target Position: 1265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1265GCACACCCUCCCCUCAUUC63.52012135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6771283GCACACCCTCCCCTCATTCGAATGAGGGGAGGGTGTGC0.034100.026800.681000.750001.000001.00000


Target Position: 2964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2964UGUUUUUGAAAUAUUAAAC63.13242164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5752982TGTTTTTGAAATATTAAACGTTTAATATTTCAAAAACA0.352700.185700.560300.500001.000001.00000


Target Position: 509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
509ACCUCCCAGUAUGACACAU72.11261415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
754527ACCTCCCAGTATGACACATATGTGTCATACTGGGAGGT0.035400.001800.698300.750001.000001.00000


Target Position: 2562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2562UCUUUAAAGUCAGGUCCAA78.3408875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4982580TCTTTAAAGTCAGGTCCAATTGGACCTGACTTTAAAGA0.073400.053100.577600.750001.000001.00000


Target Position: 2531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2531UUUUCUACUCUUUUUGUUU68.77031711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7892549TTTTCTACTCTTTTTGTTTAAACAAAAAGAGTAGAAAA0.297500.202600.500000.500001.000001.00000


Target Position: 2689, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2689GCUUCUAACAAAAACUACA91.2762139

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2687-2709TGGCTTCTAACAAAAACTACACAUGUAGUUUUUGUUAGAAGCCAGCUUCUAACAAAAACUACACAU12.911.722


Target Position: 1008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1008AGCCAAAUGAAGAAAAUGA83.2508529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6381026AGCCAAATGAAGAAAATGATCATTTTCTTCATTTGGCT0.326400.096800.629300.500001.000001.00000


Target Position: 2788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2788GAAAUUUGAAUGGGUCCAU76.63191027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8172806GAAATTTGAATGGGTCCATATGGACCCATTCAAATTTC0.013300.013100.517200.750001.000001.00000


Target Position: 760, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
760CUUUUACACCUUUUCUACU78.6681849

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
758-780ATCTTTTACACCTTTTCTACTGTAGUAGAAAAGGUGUAAAAGAUCUUUUACACCUUUUCUACUGUU14.67.222


Target Position: 690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
690GCAACCCUACUGAUGAUGA85.5615385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497708GCAACCCTACTGATGATGATCATCATCAGTAGGGTTGC0.073600.031500.629300.750001.000001.00000


Target Position: 1269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1269ACCCUCCCCUCAUUCACCA69.73221633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8221287ACCCTCCCCTCATTCACCATGGTGAATGAGGGGAGGGT0.017300.010000.508600.500001.000001.00000


Target Position: 403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
403GACCUGCAGGUAUGGGUUC64.13042088

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
827421GACCTGCAGGTATGGGTTCGAACCCATACCTGCAGGTC0.012000.001700.646600.500000.951100.62500


Target Position: 1566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1566GAGGUCAUCAAGCAGGAAG70.341575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6001584GAGGTCATCAAGCAGGAAGCTTCCTGCTTGATGACCTC0.191300.007600.672400.500001.000001.00000


Target Position: 2716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2716UUCCUGAUCGCCAACCUUU63.42842142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7612734TTCCTGATCGCCAACCTTTAAAGGTTGGCGATCAGGAA0.562600.213500.672400.500001.000001.00000


Target Position: 1525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1525CUGGACUGAUUUCUUCAAC66.37381903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7811543CTGGACTGATTTCTTCAACGTTGAAGAAATCAGTCCAG0.071000.001500.637900.500001.000001.00000


Target Position: 3070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3070UGUACUUCUUCGAUCUUCA86.0206358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7723088TGTACTTCTTCGATCTTCATGAAGATCGAAGAAGTACA0.663900.578600.482800.500001.000001.00000


Target Position: 2565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2565UUAAAGUCAGGUCCAAUUU63.76222116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5552583TTAAAGTCAGGTCCAATTTAAATTGGACCTGACTTTAA0.065500.039800.534500.500001.000001.00000


Target Position: 2803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2803CCAUUUUGCCCUUCCAUAG70.19361585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6892821CCATTTTGCCCTTCCATAGCTATGGAAGGGCAAAATGG0.158700.003000.672400.750001.000001.00000


Target Position: 645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
645UCCAGAAAGGAGAAUACAG67.54611805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
708663TCCAGAAAGGAGAATACAGCTGTATTCTCCTTTCTGGA0.613600.002700.586200.500000.907600.62500


Target Position: 754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
754UUACAUCUUUUACACCUUU70.28691579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
710772TTACATCTTTTACACCTTTAAAGGTGTAAAAGATGTAA0.465400.035500.534500.500001.000001.00000


Target Position: 1469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1469GCUCAUACCAGCCAUCCAA90.6747156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7741487GCTCATACCAGCCATCCAATTGGATGGCTGGTATGAGC0.019600.014300.706901.000000.913000.62500


Target Position: 1826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1826UCUGAAGGCUCAACUACUU75.43011125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211844TCTGAAGGCTCAACTACTTAAGTAGTTGAGCCTTCAGA0.276100.028400.586200.750000.983700.62500


Target Position: 843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
843CCACUUUGAUGAGCACUAG75.00151159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
721861CCACTTTGATGAGCACTAGCTAGTGCTCATCAAAGTGG0.027000.008100.672400.750001.000001.00000


Target Position: 2413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2413ACACCAUUAUCUUGGAAAG71.87331440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6512431ACACCATTATCTTGGAAAGCTTTCCAAGATAATGGTGT0.053600.003900.569000.500000.945700.87500


Target Position: 603, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
603CAAUUACCAUAACUAUUGU86.9297306

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
601-623ACCAATTACCATAACTATTGTTAACAAUAGUUAUGGUAAUUGGUCAAUUACCAUAACUAUUGUUAU11.613.922


Target Position: 2878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2878CAACAGACCCCCUCUAGAA95.322748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952896CAACAGACCCCCTCTAGAATTCTAGAGGGGGTCTGTTG0.324000.105600.474100.750000.934800.75000


Target Position: 1924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1924GUCCUUUGGAGUUACUGCA81.3926651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8141942GTCCTTTGGAGTTACTGCATGCAGTAACTCCAAAGGAC0.125500.001800.465500.500000.972800.62500


Target Position: 1970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1970GUCAAUCGUUCCUUAUCAG76.85091011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8171988GTCAATCGTTCCTTATCAGCTGATAAGGAACGATTGAC0.016400.008100.534500.500001.000001.00000


Target Position: 1691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1691ACGCAGCAGAGUAAUUCUC61.5872282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8011709ACGCAGCAGAGTAATTCTCGAGAATTACTCTGCTGCGT0.028200.008600.465500.500000.940200.62500


Target Position: 1011, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1011CAAAUGAAGAAAAUGAAGA84.7909428

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1009-1031GCCAAATGAAGAAAATGAAGATGUCUUCAUUUUCUUCAUUUGGCCAAAUGAAGAAAAUGAAGAUGU12.07.412


Target Position: 2935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2935CUAUUUAUCUGUAGUAAAC78.5841856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5782953CTATTTATCTGTAGTAAACGTTTACTACAGATAAATAG0.051000.013400.525900.500001.000001.00000


Target Position: 2157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2157UGGCUUUGAUUCUUGCAGU70.90871530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7752175TGGCTTTGATTCTTGCAGTACTGCAAGAATCAAAGCCA0.021400.003400.637900.500001.000001.00000


Target Position: 2152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2152GGCCUUGGCUUUGAUUCUU75.50861118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6902170GGCCTTGGCTTTGATTCTTAAGAATCAAAGCCAAGGCC0.031600.003900.862101.000000.940200.75000


Target Position: 1206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1206GGAUGACUGAUGUAGACAG87.2459292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4351224GGATGACTGATGTAGACAGCTGTCTACATCAGTCATCC0.102700.020900.586200.750000.978300.62500


Target Position: 2440, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2440GUUGGAAACAUAACCAUUA90.6068160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4232458GTTGGAAACATAACCATTATAATGGTTATGTTTCCAAC0.102400.026400.612100.750000.902200.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2438-2460CCGTTGGAAACATAACCATTACAUAAUGGUUAUGUUUCCAACGGGUUGGAAACAUAACCAUUACAU18.820.133


Target Position: 2940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2940UAUCUGUAGUAAACUAUUU80.2681730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7822958TATCTGTAGTAAACTATTTAAATAGTTTACTACAGATA0.401000.024800.543100.500001.000001.00000


Target Position: 2601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2601UUGUAAAUUAGGGCCCAAU63.76252115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8242619TTGTAAATTAGGGCCCAATATTGGGCCCTAATTTACAA0.113600.013200.637900.500001.000001.00000


Target Position: 3050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3050ACUGAUUCAUAAUAAAUAU87.9372260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3733068ACTGATTCATAATAAATATATATTTATTATGAATCAGT0.701900.153400.663800.750001.000001.00000


Target Position: 1667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1667AGGACAGGACCUCUUUCAA87.9286261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6181685AGGACAGGACCTCTTTCAATTGAAAGAGGTCCTGTCCT0.042600.011700.698300.750000.918500.62500


Target Position: 578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
578GACCUGCCCAAUGCCUUUG58.28362501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
425596GACCTGCCCAATGCCTTTGCAAAGGCATTGGGCAGGTC0.161800.079300.672400.500000.972801.00000


Target Position: 749, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
749GGAGGUUACAUCUUUUACA95.082952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
676767GGAGGTTACATCTTTTACATGTAAAAGATGTAACCTCC0.486300.003300.663800.750001.000001.00000


Target Position: 1208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1208AUGACUGAUGUAGACAGAA82.4518586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7561226ATGACTGATGTAGACAGAATTCTGTCTACATCAGTCAT0.167800.031500.482800.500000.972800.75000


Target Position: 2433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2433AACAACCGUUGGAAACAUA84.4575447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6472451AACAACCGTTGGAAACATATATGTTTCCAACGGTTGTT0.114300.033000.603400.500001.000001.00000


Target Position: 4, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4AGACCCAAGCUUCUAGAGA78.5157859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
77922AGACCCAAGCTTCTAGAGATCTCTAGAAGCTTGGGTCT0.019000.019900.500000.500000.978300.62500


Target Position: 2958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2958UAUCUGUGUUUUUGAAAUA84.8873417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6532976TATCTGTGTTTTTGAAATATATTTCAAAAACACAGATA0.469100.123700.500000.500001.000001.00000


Target Position: 1405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1405UGAGGGAUAUCGCCAAACA82.904553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7821423TGAGGGATATCGCCAAACATGTTTGGCGATATCCCTCA0.269800.001500.517200.500001.000001.00000


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682UCAAUGACAACGCAGCAGA71.75171457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6651700TCAATGACAACGCAGCAGATCTGCTGCGTTGTCATTGA0.189000.081400.500000.500001.000001.00000


Target Position: 2650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2650UCCACUUGGAGGCCUUCAU62.50962212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8082668TCCACTTGGAGGCCTTCATATGAAGGCCTCCAAGTGGA0.015800.001200.715500.750000.934800.62500


Target Position: 2950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2950AAACUAUUUAUCUGUGUUU79.1417817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8052968AAACTATTTATCTGTGTTTAAACACAGATAAATAGTTT0.193700.132000.500000.500001.000001.00000


Target Position: 1095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1095GCACCAUUUCAACCACACC69.7421632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6611113GCACCATTTCAACCACACCGGTGTGGTTGAAATGGTGC0.581000.271700.500000.500001.000001.00000


Target Position: 2549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2549UUUUGUGUUUUGUUCUUUA80.7457698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8172567TTTTGTGTTTTGTTCTTTATAAAGAACAAAACACAAAA0.348200.079400.465500.500001.000001.00000


Target Position: 602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
602CCAAUUACCAUAACUAUUG70.59221559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
534620CCAATTACCATAACTATTGCAATAGTTATGGTAATTGG0.070200.008100.698300.750001.000001.00000


Target Position: 2066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2066AGUCAAGAAGGUGGAGCAA81.922616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6552084AGTCAAGAAGGTGGAGCAATTGCTCCACCTTCTTGACT0.036400.011600.560300.750001.000001.00000


Target Position: 2411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2411CUACACCAUUAUCUUGGAA87.3046288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6932429CTACACCATTATCTTGGAATTCCAAGATAATGGTGTAG0.038000.002900.500000.750000.945700.75000


Target Position: 3051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3051CUGAUUCAUAAUAAAUAUC70.5991554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7693069CTGATTCATAATAAATATCGATATTTATTATGAATCAG0.693000.160000.603400.500001.000001.00000


Target Position: 2442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2442UGGAAACAUAACCAUUACA80.1012744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7402460TGGAAACATAACCATTACATGTAATGGTTATGTTTCCA0.024100.010000.637900.500000.929300.62500


Target Position: 2513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2513AUCUUUUUUAGCAUAAAAU74.05751246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7832531ATCTTTTTTAGCATAAAATATTTTATGCTAAAAAAGAT0.069300.025700.672400.500001.000001.00000


Target Position: 610, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
610CAUAACUAUUGUUAACCGU76.07421074

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
608-630ACCATAACTATTGTTAACCGTGAACGGUUAACAAUAGUUAUGGUCAUAACUAUUGUUAACCGUGAU20.66.323


Target Position: 500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
500ACAUACAACACCUCCCAGU69.16271681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
804518ACATACAACACCTCCCAGTACTGGGAGGTGTTGTATGT0.015200.016100.500000.500001.000001.00000


Target Position: 1211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1211ACUGAUGUAGACAGAAAUG71.0481522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7361229ACTGATGTAGACAGAAATGCATTTCTGTCTACATCAGT0.097400.013600.551700.500000.972800.62500


Target Position: 1693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1693GCAGCAGAGUAAUUCUCAG84.0087478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7751711GCAGCAGAGTAATTCTCAGCTGAGAATTACTCTGCTGC0.019500.003900.569000.750000.940200.75000


Target Position: 1640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1640AACACAGGUUUGGUGGAAA82.5976570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7791658AACACAGGTTTGGTGGAAATTTCCACCAAACCTGTGTT0.021500.001500.646600.500000.994600.75000


Target Position: 648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
648AGAAAGGAGAAUACAGAAC67.28891824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
593666AGAAAGGAGAATACAGAACGTTCTGTATTCTCCTTTCT0.646600.005600.577600.500001.000001.00000


Target Position: 1191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1191UUCAGACAACCACAAGGAU69.74261631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7901209TTCAGACAACCACAAGGATATCCTTGTGGTTGTCTGAA0.027400.005600.491400.500000.972800.75000


Target Position: 1432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1432AGACUCCCAUUCGACAACA79.0476826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5961450AGACTCCCATTCGACAACATGTTGTCGAATGGGAGTCT0.765700.023700.517200.500001.000001.00000


Target Position: 2459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2459CAGGGAGCUGGGACACUUA93.722281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5672477CAGGGAGCTGGGACACTTATAAGTGTCCCAGCTCCCTG0.519300.006800.750000.750000.983700.75000


Target Position: 2099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2099CCUAUAAGGACACCCCAAA84.2467458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4172117CCTATAAGGACACCCCAAATTTGGGGTGTCCTTATAGG0.578800.015500.844801.000000.902200.75000


Target Position: 1010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1010CCAAAUGAAGAAAAUGAAG71.33181500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3961028CCAAATGAAGAAAATGAAGCTTCATTTTCTTCATTTGG0.695100.164400.706900.750001.000001.00000


Target Position: 1779, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1779CAAGCAAUAGGAAUGAUGU84.8146424

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1777-1799ATCAAGCAATAGGAATGATGTCAACAUCAUUCCUAUUGCUUGAUCAAGCAAUAGGAAUGAUGUCAU13.618.533


Target Position: 2201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2201AGGUGUGGGCAGAAGAAAA90.6158159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
872219AGGTGTGGGCAGAAGAAAATTTTCTTCTGCCCACACCT0.776400.130900.844800.750001.000001.00000


Target Position: 1185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1185UGCUACUUCAGACAACCAC59.11582449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5921203TGCTACTTCAGACAACCACGTGGTTGTCTGAAGTAGCA0.061700.005600.560300.500001.000001.00000


Target Position: 1616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1616ACGCUUCAGCCUACUGCAA78.6363854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241634ACGCTTCAGCCTACTGCAATTGCAGTAGGCTGAAGCGT0.202300.014900.629300.750000.945700.87500


Target Position: 3001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3001UCAGUAUAAUUUUUUAAAG68.96951693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7883019TCAGTATAATTTTTTAAAGCTTTAAAAAATTATACTGA0.236000.041800.586200.500001.000001.00000


Target Position: 2308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2308GCAUUUGGUGAACAAGGAG73.20971320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6862326GCATTTGGTGAACAAGGAGCTCCTTGTTCACCAAATGC0.100000.003100.543100.750001.000001.00000


Target Position: 1335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1335AGGCAACUCCUAGUAGUAC69.08261687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6171353AGGCAACTCCTAGTAGTACGTACTACTAGGAGTTGCCT0.118600.013300.663800.500000.962000.62500


Target Position: 2515, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2515CUUUUUUAGCAUAAAAUUU78.1906895

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3732533CTTTTTTAGCATAAAATTTAAATTTTATGCTAAAAAAG0.125500.060800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2513-2535ATCTTTTTTAGCATAAAATTTTCAAAUUUUAUGCUAAAAAAGAUCUUUUUUAGCAUAAAAUUUUCU-9.7-9.122


Target Position: 1357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1357GGAAGAAACAGCUACCCAG82.5989569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6621375GGAAGAAACAGCTACCCAGCTGGGTAGCTGTTTCTTCC0.035700.019300.586200.750001.000001.00000


Target Position: 1832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1832GGCUCAACUACUUUACUGG74.51141203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7371850GGCTCAACTACTTTACTGGCCAGTAAAGTAGTTGAGCC0.056800.008900.655200.500001.000001.00000


Target Position: 1220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1220GACAGAAAUGGCACCACUG78.9274834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7441238GACAGAAATGGCACCACTGCAGTGGTGCCATTTCTGTC0.023600.014600.534500.500000.994600.62500


Target Position: 3047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3047UAAACUGAUUCAUAAUAAA91.6389127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7713065TAAACTGATTCATAATAAATTTATTATGAATCAGTTTA0.850200.071600.534500.500001.000001.00000


Target Position: 835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
835CCCUGCUACCACUUUGAUG69.78111625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
670853CCCTGCTACCACTTTGATGCATCAAAGTGGTAGCAGGG0.108600.003400.836200.750001.000001.00000


Target Position: 1839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1839CUACUUUACUGGAAGGUUA92.591106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8111857CTACTTTACTGGAAGGTTATAACCTTCCAGTAAAGTAG0.014200.003800.637900.750001.000001.00000


Target Position: 2789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2789AAAUUUGAAUGGGUCCAUU76.15411063

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8072807AAATTTGAATGGGTCCATTAATGGACCCATTCAAATTT0.015000.010200.491400.500001.000001.00000


Target Position: 1671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1671CAGGACCUCUUUCAAUGAC69.75361630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8261689CAGGACCTCTTTCAATGACGTCATTGAAAGAGGTCCTG0.168700.015700.465500.500001.000001.00000


Target Position: 2832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2832GGGCAUUGCUUUCCACUGA85.9705361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5712850GGGCATTGCTTTCCACTGATCAGTGGAAAGCAATGCCC0.113600.006700.767200.750001.000001.00000


Target Position: 1122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1122UUGACCACACAAAACAGAA76.68611023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7871140TTGACCACACAAAACAGAATTCTGTTTTGTGTGGTCAA0.335600.114500.474100.500001.000001.00000


Target Position: 2113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2113CCAAAUUCCAGAAUGGCUG63.03332177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7502131CCAAATTCCAGAATGGCTGCAGCCATTCTGGAATTTGG0.022600.014500.560300.750000.956500.87500


Target Position: 2717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2717UCCUGAUCGCCAACCUUUC56.11652628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6542735TCCTGATCGCCAACCTTTCGAAAGGTTGGCGATCAGGA0.633000.196100.698300.500001.000001.00000


Target Position: 405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
405CCUGCAGGUAUGGGUUCAU75.04511156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
813423CCTGCAGGTATGGGTTCATATGAACCCATACCTGCAGG0.014100.004900.689701.000001.000001.00000


Target Position: 550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
550ACCUGAAGAAGAUUGUACA87.0483300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
797568ACCTGAAGAAGATTGTACATGTACAATCTTCTTCAGGT0.032600.001300.646600.500001.000001.00000


Target Position: 3003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3003AGUAUAAUUUUUUAAAGUU85.1564401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5103021AGTATAATTTTTTAAAGTTAACTTTAAAAAATTATACT0.110000.083100.560300.750001.000001.00000


Target Position: 85, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
85CCGCCAUCCUCGUCCCGUC66.16491922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
419103CCGCCATCCTCGTCCCGTCGACGGGACGAGGATGGCGG0.242700.024900.594800.750001.000001.00000


Target Position: 1902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1902CAGUGACCUCAGCUAAGAC82.7518562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8051920CAGTGACCTCAGCTAAGACGTCTTAGCTGAGGTCACTG0.044400.002500.465500.500001.000001.00000


Target Position: 2956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2956UUUAUCUGUGUUUUUGAAA69.88981616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6572974TTTATCTGTGTTTTTGAAATTTCAAAAACACAGATAAA0.224400.125400.500000.500001.000001.00000


Target Position: 1312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1312CCCACAUUCUACAAGCACA92.1225114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1341330CCCACATTCTACAAGCACATGTGCTTGTAGAATGTGGG0.482400.292300.784500.750001.000001.00000


Target Position: 681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
681UCUACCCCAGCAACCCUAC49.94142868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
693699TCTACCCCAGCAACCCTACGTAGGGTTGCTGGGGTAGA0.117500.101900.543100.500001.000001.00000


Target Position: 393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
393UCGGAUUUGAGACCUGCAG52.86312768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
810411TCGGATTTGAGACCTGCAGCTGCAGGTCTCAAATCCGA0.014200.002400.508600.500000.956500.75000


Target Position: 549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
549CACCUGAAGAAGAUUGUAC74.42851217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
826567CACCTGAAGAAGATTGTACGTACAATCTTCTTCAGGTG0.029700.001000.612100.500001.000001.00000


Target Position: 2075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2075GGUGGAGCAAACACAACCU83.084543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6562093GGTGGAGCAAACACAACCTAGGTTGTGTTTGCTCCACC0.051700.003700.508600.750000.967400.62500


Target Position: 1823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1823CAUUCUGAAGGCUCAACUA96.603832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7751841CATTCTGAAGGCTCAACTATAGTTGAGCCTTCAGAATG0.393700.007800.482800.750000.983700.87500


Target Position: 2997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2997UUGAUCAGUAUAAUUUUUU63.69962119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5793015TTGATCAGTATAATTTTTTAAAAAATTATACTGATCAA0.271100.006400.646600.500001.000001.00000


Target Position: 2538, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2538CUCUUUUUGUUUUUUGUGU69.17491679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4902556CTCTTTTTGTTTTTTGTGTACACAAAAAACAAAAAGAG0.138200.101700.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2536-2558TACTCTTTTTGTTTTTTGTGTTTACACAAAAAACAAAAAGAGUACUCUUUUUGUUUUUUGUGUUUU12.25.511


Target Position: 2886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2886CCCCUCUAGAAAUUUUUCA75.63211105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6602904CCCCTCTAGAAATTTTTCATGAAAAATTTCTAGAGGGG0.035700.007600.767200.750001.000001.00000


Target Position: 965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
965CAAAUGGCUGGUACGUCUU77.0359993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
621983CAAATGGCTGGTACGTCTTAAGACGTACCAGCCATTTG0.048800.007500.508600.750001.000001.00000


Target Position: 2499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2499UUGUUUCAUUGCGAAUCUU66.44321896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6342517TTGTTTCATTGCGAATCTTAAGATTCGCAATGAAACAA0.112600.022100.508600.500001.000001.00000


Target Position: 1063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1063AGGCAUUGAUGAUGAUGAA95.029253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8001081AGGCATTGATGATGATGAATTCATCATCATCAATGCCT0.015600.004700.672400.750001.000001.00000


Target Position: 3068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3068UCUGUACUUCUUCGAUCUU70.16381589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4383086TCTGTACTTCTTCGATCTTAAGATCGAAGAAGTACAGA0.643000.467400.586200.750001.000001.00000


Target Position: 448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
448GAUCCACCCCAACUCCAUC73.29781312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
776466GATCCACCCCAACTCCATCGATGGAGTTGGGGTGGATC0.202200.001500.500000.500001.000001.00000


Target Position: 1962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1962ACUCUAAUGUCAAUCGUUC70.43371570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7871980ACTCTAATGTCAATCGTTCGAACGATTGACATTAGAGT0.071600.042300.534500.500001.000001.00000


Target Position: 1089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1089UCUCCAGCACCAUUUCAAC64.00442104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421107TCTCCAGCACCATTTCAACGTTGAAATGGTGCTGGAGA0.611000.079500.577600.500001.000001.00000


Target Position: 1239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1239CUUAUGAAGGAAACUGGAA84.5625443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201257CTTATGAAGGAAACTGGAATTCCAGTTTCCTTCATAAG0.091900.013100.465500.750001.000001.00000


Target Position: 743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
743ACUUCAGGAGGUUACAUCU79.6676777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
768761ACTTCAGGAGGTTACATCTAGATGTAACCTCCTGAAGT0.095000.001600.482800.500001.000001.00000


Target Position: 2225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2225GUGAUCAACAGUGGCAAUG60.08262392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7552243GTGATCAACAGTGGCAATGCATTGCCACTGTTGATCAC0.035200.014100.637900.500001.000001.00000


Target Position: 1461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1461CAGCCUCAGCUCAUACCAG78.3348876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6761479CAGCCTCAGCTCATACCAGCTGGTATGAGCTGAGGCTG0.311000.013300.500000.500000.913000.62500


Target Position: 2208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2208GGCAGAAGAAAAAGCUAGU79.928758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7332226GGCAGAAGAAAAAGCTAGTACTAGCTTTTTCTTCTGCC0.025000.021700.793100.750001.000001.00000


Target Position: 1416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1416GCCAAACACCCAGAGAAGA77.9855916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1201434GCCAAACACCCAGAGAAGATCTTCTCTGGGTGTTTGGC0.407600.108900.775900.750001.000001.00000


Target Position: 2508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2508UGCGAAUCUUUUUUAGCAU74.43641214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4312526TGCGAATCTTTTTTAGCATATGCTAAAAAAGATTCGCA0.099000.016100.698300.750001.000001.00000


Target Position: 1714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1714CUUCUCUACAUCACAUGAA87.0402301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8081732CTTCTCTACATCACATGAATTCATGTGATGTAGAGAAG0.040200.016200.465500.750001.000001.00000


Target Position: 570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
570CAGUCACAGACCUGCCCAA92.928597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
336588CAGTCACAGACCTGCCCAATTGGGCAGGTCTGTGACTG0.398600.037300.637900.750000.923900.62500


Target Position: 169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
169UCCGGACACCAUGGACAAG56.79292588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
688187TCCGGACACCATGGACAAGCTTGTCCATGGTGTCCGGA0.380500.003000.732800.500000.972800.62500


Target Position: 1817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1817CCAAAUCAUUCUGAAGGCU73.13221330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7881835CCAAATCATTCTGAAGGCTAGCCTTCAGAATGATTTGG0.017300.003900.491400.750000.989100.62500


Target Position: 2299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2299GGAAAUGGUGCAUUUGGUG73.07951333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6112317GGAAATGGTGCATTTGGTGCACCAAATGCACCATTTCC0.043600.015300.577600.750001.000001.00000


Target Position: 1989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1989GAGACCAAGACACAUUCCA84.1746464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8022007GAGACCAAGACACATTCCATGGAATGTGTCTTGGTCTC0.216300.052600.465500.500001.000001.00000


Target Position: 390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
390GCAUCGGAUUUGAGACCUG77.3093967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
726408GCATCGGATTTGAGACCTGCAGGTCTCAAATCCGATGC0.026600.003100.569000.750000.956500.75000


Target Position: 2959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2959AUCUGUGUUUUUGAAAUAU75.07511155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6242977ATCTGTGTTTTTGAAATATATATTTCAAAAACACAGAT0.482800.127900.637900.500001.000001.00000


Target Position: 455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
455CCCAACUCCAUCUGUGCAG60.07792394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
493473CCCAACTCCATCTGTGCAGCTGCACAGATGGAGTTGGG0.086200.010400.706900.750000.962000.62500


Target Position: 231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
231GCCUGGCGCAGAUCGAUUU76.11411070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
240249GCCTGGCGCAGATCGATTTAAATCGATCTGCGCCAGGC0.613400.036301.000001.000000.978300.62500


Target Position: 2127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2127GGCUGAUCAUCUUGGCAUC78.4631864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7382145GGCTGATCATCTTGGCATCGATGCCAAGATGATCAGCC0.068400.002000.819000.750000.983700.62500


Target Position: 2250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2250UGGAGGACAGAAAGCCAAG63.19492159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7332268TGGAGGACAGAAAGCCAAGCTTGGCTTTCTGTCCTCCA0.522700.002100.706900.500000.934800.87500


Target Position: 1071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1071AUGAUGAUGAAGAUUUUAU78.213892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7501089ATGATGATGAAGATTTTATATAAAATCTTCATCATCAT0.040600.001900.612100.500001.000001.00000


Target Position: 970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
970GGCUGGUACGUCUUCAAAU89.4116199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
590988GGCTGGTACGTCTTCAAATATTTGAAGACGTACCAGCC0.109100.005800.991401.000001.000001.00000


Target Position: 600, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
600GACCAAUUACCAUAACUAU94.36873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
764618GACCAATTACCATAACTATATAGTTATGGTAATTGGTC0.021000.010500.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
598-620TGGACCAATTACCATAACTATTGAUAGUUAUGGUAAUUGGUCCAGACCAAUUACCAUAACUAUUGU6.318.833


Target Position: 233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
233CUGGCGCAGAUCGAUUUGA72.20981404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
490251CTGGCGCAGATCGATTTGATCAAATCGATCTGCGCCAG0.250600.010600.560300.500001.000001.00000


Target Position: 386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
386CUGAGCAUCGGAUUUGAGA79.0679824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
773404CTGAGCATCGGATTTGAGATCTCAAATCCGATGCTCAG0.122300.001500.560300.500001.000001.00000


Target Position: 2497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2497GAUUGUUUCAUUGCGAAUC65.75131956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6582515GATTGTTTCATTGCGAATCGATTCGCAATGAAACAATC0.085200.008900.500000.500001.000001.00000


Target Position: 364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
364AAUGGCCCAGAUGGAGAAA71.95261429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
742382AATGGCCCAGATGGAGAAATTTCTCCATCTGGGCCATT0.087500.002300.508600.500000.951101.00000


Target Position: 1568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1568GGUCAUCAAGCAGGAAGAA89.4006200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2961586GGTCATCAAGCAGGAAGAATTCTTCCTGCTTGATGACC0.180900.073400.681001.000001.000001.00000


Target Position: 2200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2200AAGGUGUGGGCAGAAGAAA77.1186984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7442218AAGGTGTGGGCAGAAGAAATTTCTTCTGCCCACACCTT0.754400.126000.637900.500001.000001.00000


Target Position: 1162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1162CCCAAGCCAUUCAAAUCCG61.08362318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4561180CCCAAGCCATTCAAATCCGCGGATTTGAATGGCTTGGG0.222600.049100.577600.500001.000001.00000


Target Position: 1669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1669GACAGGACCUCUUUCAAUG79.522784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5761687GACAGGACCTCTTTCAATGCATTGAAAGAGGTCCTGTC0.107900.013200.663800.500001.000001.00000


Target Position: 2100, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2100CUAUAAGGACACCCCAAAU84.3218454

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9210019CTATAAGGACACCCCAAAT1/1/0/094.96CD44NM_001001391.1+NM_001001390.1+NM_000610.3+NM_001001389.1+NM_001001392.11+1+1+1+0NANANA11:35240911..35240929(+)00CD44(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3022118CTATAAGGACACCCCAAATATTTGGGGTGTCCTTATAG0.572900.027800.663800.750000.902200.75000


Target Position: 808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
808CUGGAUCACCGACAGCACA83.1679537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501826CTGGATCACCGACAGCACATGTGCTGTCGGTGATCCAG0.164600.010000.577600.500000.956500.75000


Target Position: 2458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2458ACAGGGAGCUGGGACACUU76.35561045

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5842476ACAGGGAGCTGGGACACTTAAGTGTCCCAGCTCCCTGT0.498300.005900.569000.750000.983700.62500


Target Position: 300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
300GCUACAGCAUCUCUCGGAC74.73531182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
796318GCTACAGCATCTCTCGGACGTCCGAGAGATGCTGTAGC0.029900.001300.534500.750001.000001.00000


Target Position: 2572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2572CAGGUCCAAUUUGUAAAAA83.5907501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5332590CAGGTCCAATTTGTAAAAATTTTTACAAATTGGACCTG0.065300.014000.784500.750001.000001.00000


Target Position: 1230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1230GCACCACUGCUUAUGAAGG68.95681694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6261248GCACCACTGCTTATGAAGGCCTTCATAAGCAGTGGTGC0.206700.004700.508600.500000.934800.62500


Target Position: 2548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2548UUUUUGUGUUUUGUUCUUU62.58062205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8002566TTTTTGTGTTTTGTTCTTTAAAGAACAAAACACAAAAA0.383600.093600.500000.500001.000001.00000


Target Position: 2505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2505CAUUGCGAAUCUUUUUUAG74.43541215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7682523CATTGCGAATCTTTTTTAGCTAAAAAAGATTCGCAATG0.063800.004800.482800.500001.000001.00000


Target Position: 3033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3033GGCACAAAAGGGUUUAAAC76.19441060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4523051GGCACAAAAGGGTTTAAACGTTTAAACCCTTTTGTGCC0.088900.074400.853400.750001.000001.00000


Target Position: 2295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2295CUCAGGAAAUGGUGCAUUU81.5662634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6802313CTCAGGAAATGGTGCATTTAAATGCACCATTTCCTGAG0.033100.022400.810300.750001.000001.00000


Target Position: 2370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2370GGAACCUGCAGAAUGUGGA82.8912554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6882388GGAACCTGCAGAATGTGGATCCACATTCTGCAGGTTCC0.097100.014800.500000.750001.000001.00000


Target Position: 2199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2199GAAGGUGUGGGCAGAAGAA94.529168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6982217GAAGGTGTGGGCAGAAGAATTCTTCTGCCCACACCTTC0.247000.124500.500000.750001.000001.00000


Target Position: 866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
866ACAGCAACUGAGACAGCAA91.9295119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
503884ACAGCAACTGAGACAGCAATTGCTGTCTCAGTTGCTGT0.186700.021100.560300.750000.929300.75000


Target Position: 729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
729GUGAAAGGAGCAGCACUUC64.8892025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
814747GTGAAAGGAGCAGCACTTCGAAGTGCTGCTCCTTTCAC0.063600.001200.620700.500001.000001.00000


Target Position: 2546, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2546GUUUUUUGUGUUUUGUUCU73.8321269

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2544-2566TTGTTTTTTGTGTTTTGTTCTTTAGAACAAAACACAAAAAACAAGUUUUUUGUGUUUUGUUCUUUU14.9-2.910


Target Position: 2438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2438CCGUUGGAAACAUAACCAU78.988830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4322456CCGTTGGAAACATAACCATATGGTTATGTTTCCAACGG0.098300.021000.758601.000000.902200.62500


Target Position: 131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
131GGAUCCUCCAGCUCCUUUC69.17561678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
180149GGATCCTCCAGCTCCTTTCGAAAGGAGCTGGAGGATCC0.300700.117600.698300.750000.951100.62500


Target Position: 2971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2971GAAAUAUUAAACCCUGGAU83.8323487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7302989GAAATATTAAACCCTGGATATCCAGGGTTTAATATTTC0.145700.074900.491400.750001.000001.00000


Target Position: 1005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1005GGGAGCCAAAUGAAGAAAA86.4489331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2091023GGGAGCCAAATGAAGAAAATTTTCTTCATTTGGCTCCC0.257700.053400.991401.000001.000001.00000


Target Position: 417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
417GGUUCAUAGAAGGGCAUGU77.3958961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
804435GGTTCATAGAAGGGCATGTACATGCCCTTCTATGAACC0.041800.001300.646600.750000.994600.62500


Target Position: 2408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2408CACCUACACCAUUAUCUUG79.1916812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8042426CACCTACACCATTATCTTGCAAGATAATGGTGTAGGTG0.027700.001800.646600.500001.000001.00000


Target Position: 1809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1809GAAGAGACCCAAAUCAUUC78.2854882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6921827GAAGAGACCCAAATCATTCGAATGATTTGGGTCTCTTC0.255900.007700.500000.500001.000001.00000


Target Position: 2159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2159GCUUUGAUUCUUGCAGUUU76.50251040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8222177GCTTTGATTCTTGCAGTTTAAACTGCAAGAATCAAAGC0.013000.002600.853401.000001.000001.00000


Target Position: 1996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1996AGACACAUUCCACCCCAGU68.15661761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8022014AGACACATTCCACCCCAGTACTGGGGTGGAATGTGTCT0.015300.001500.517200.500001.000001.00000


Target Position: 579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
579ACCUGCCCAAUGCCUUUGA63.13082165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
613597ACCTGCCCAATGCCTTTGATCAAAGGCATTGGGCAGGT0.130800.050900.629300.500000.972801.00000


Target Position: 2304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2304UGGUGCAUUUGGUGAACAA86.5747325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4222322TGGTGCATTTGGTGAACAATTGTTCACCAAATGCACCA0.102500.017400.698300.750001.000001.00000


Target Position: 2726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2726CCAACCUUUCCCCCACCAG58.34192498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4932744CCAACCTTTCCCCCACCAGCTGGTGGGGGAAAGGTTGG0.382500.209200.560300.750001.000001.00000


Target Position: 2887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2887CCCUCUAGAAAUUUUUCAG72.65221366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152905CCCTCTAGAAATTTTTCAGCTGAAAAATTTCTAGAGGG0.027900.010600.706900.750001.000001.00000


Target Position: 2356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2356AGCUGAUGAGACAAGGAAC75.21821143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6722374AGCTGATGAGACAAGGAACGTTCCTTGTCTCATCAGCT0.585500.079300.706900.500001.000001.00000


Target Position: 1966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1966UAAUGUCAAUCGUUCCUUA91.5528129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8091984TAATGTCAATCGTTCCTTATAAGGAACGATTGACATTA0.054500.029200.500000.500001.000001.00000


Target Position: 842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
842ACCACUUUGAUGAGCACUA79.6811774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
688860ACCACTTTGATGAGCACTATAGTGCTCATCAAAGTGGT0.032200.011800.681000.750001.000001.00000


Target Position: 1233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1233CCACUGCUUAUGAAGGAAA87.0647299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5721251CCACTGCTTATGAAGGAAATTTCCTTCATAAGCAGTGG0.416900.006700.844801.000001.000001.00000


Target Position: 1198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1198AACCACAAGGAUGACUGAU71.02721523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8161216AACCACAAGGATGACTGATATCAGTCATCCTTGTGGTT0.028300.004200.465500.500000.972800.75000


Target Position: 873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
873CUGAGACAGCAACCAAGAG72.75841356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
778891CTGAGACAGCAACCAAGAGCTCTTGGTTGCTGTCTCAG0.054200.019600.474100.500001.000001.00000


Target Position: 1869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1869ACCCACACACGAAGGAAAG58.60942481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6191887ACCCACACACGAAGGAAAGCTTTCCTTCGTGTGTGGGT0.042500.034700.715500.500000.918500.62500


Target Position: 2800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2800GGUCCAUUUUGCCCUUCCA88.0694254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7272818GGTCCATTTTGCCCTTCCATGGAAGGGCAAAATGGACC0.026200.006200.508600.750001.000001.00000


Target Position: 2463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2463GAGCUGGGACACUUAACAG82.0457608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5872481GAGCTGGGACACTTAACAGCTGTTAAGTGTCCCAGCTC0.139900.015800.525900.500000.983700.62500


Target Position: 1808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1808AGAAGAGACCCAAAUCAUU84.726434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4141826AGAAGAGACCCAAATCATTAATGATTTGGGTCTCTTCT0.146000.015500.715500.750001.000001.00000


Target Position: 286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
286GGAGAAAAAUGGUCGCUAC83.2338531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
790304GGAGAAAAATGGTCGCTACGTAGCGACCATTTTTCTCC0.057600.001400.689700.750001.000001.00000


Target Position: 1483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1483UCCAAUGCAAGGAAGGACA68.18731753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7481501TCCAATGCAAGGAAGGACATGTCCTTCCTTGCATTGGA0.022800.004500.663800.500000.918500.62500