siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Sidirect 41   77   79   162   167   171   203   256   290   320   407   416   417   471   1372   1413   1452   1498   1526   1590  
1691   1727   1739   1798   1860  
Biltr, Rnaxs, Sidirect 84   87   113   116   117   234   235   242   243   255   323   329   396   405   410   444   771   879   1378   1380  
1389   1391   1403   1404   1424   1428   1454   1455   1476   1483   1493   1496   1507   1513   1515   1518   1528   1663   1688   1689  
1736   1747   1758   1855   1857   1867   1870   1880   1883   1886   1892  
Biltr, Ernai, Rnaxs, Sidirect 1383  
Biltr, Rnaxs 28   29   30   31   47   60   62   63   64   65   66   67   68   69   70   71   72   73   74   75  
81   82   83   88   89   90   94   95   109   110   111   112   114   115   131   132   133   135   136   143  
144   145   169   170   174   181   186   191   192   193   194   198   199   200   201   202   223   224   236   237  
240   241   248   249   250   251   252   253   254   264   266   275   276   277   279   300   301   306   307   308  
309   310   313   314   317   318   319   321   322   327   328   330   331   343   344   345   371   372   384   385  
397   398   401   402   404   411   412   413   414   415   432   435   436   438   439   440   441   442   443   445  
447   448   449   450   451   452   453   456   457   459   477   504   505   513   514   524   525   527   558   559  
560   561   562   566   567   568   570   571   572   576   577   578   607   608   609   610   611   613   614   615  
618   638   642   643   645   649   655   660   661   666   667   668   669   672   673   674   675   676   684   685  
686   687   688   689   693   698   702   703   716   725   726   727   731   732   733   734   745   762   763   768  
769   770   772   773   778   798   801   802   803   804   805   806   807   810   812   813   814   815   816   817  
818   819   820   864   873   874   875   876   877   878   880   902   903   904   909   910   912   913   916   942  
943   945   946   947   948   950   954   955   956   957   960   961   962   963   964   965   966   967   968   969  
975   981   988   1025   1026   1027   1032   1033   1035   1040   1041   1042   1044   1045   1070   1071   1080   1081   1090   1092  
1093   1095   1099   1110   1115   1137   1143   1155   1156   1157   1162   1168   1172   1173   1174   1175   1176   1177   1179   1180  
1181   1182   1183   1184   1186   1187   1202   1203   1204   1205   1208   1209   1210   1211   1212   1213   1222   1223   1224   1225  
1226   1227   1228   1254   1255   1257   1282   1285   1286   1289   1320   1322   1323   1324   1332   1337   1338   1339   1341   1342  
1343   1344   1346   1347   1349   1356   1367   1368   1369   1370   1371   1375   1376   1377   1379   1381   1382   1384   1388   1390  
1392   1394   1398   1399   1400   1401   1402   1405   1415   1416   1417   1418   1423   1425   1426   1427   1429   1430   1442   1443  
1447   1448   1453   1456   1457   1461   1462   1464   1465   1469   1470   1471   1472   1475   1477   1479   1482   1484   1487   1488  
1490   1491   1492   1494   1495   1501   1502   1503   1504   1505   1506   1512   1514   1516   1517   1520   1521   1522   1523   1524  
1527   1529   1530   1531   1535   1540   1541   1553   1554   1580   1581   1582   1584   1585   1586   1587   1588   1589   1592   1599  
1600   1607   1608   1609   1610   1611   1613   1614   1617   1618   1619   1621   1622   1623   1625   1626   1644   1645   1646   1664  
1665   1675   1676   1677   1678   1679   1682   1683   1686   1687   1690   1724   1725   1726   1732   1733   1734   1735   1743   1744  
1745   1746   1748   1749   1757   1759   1760   1771   1777   1778   1779   1783   1802   1803   1804   1806   1814   1818   1819   1831  
1839   1841   1842   1843   1845   1852   1853   1854   1856   1861   1866   1869   1871   1873   1877   1878   1879   1881   1882   1884  
1885   1887   1888   1889   1890   1891   1893   1894  
Biltr, Ernai, Rnaxs 233   278   403   1229   1345   1612   1784  
Biltr, Ernai 164   1104  


Target Position: 278, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
278GGUUAAUGCUUGCUGAAUU90.753392

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_827819GGTTAATGCTTGCTGAATT1/1/0/097.21CXCR4NM_001008540.1+NM_003467.21+0NANANA2:136873518..136873536(-)00CXCR4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
407296GGTTAATGCTTGCTGAATTAATTCAGCAAGCATTAACC0.060400.012300.844801.000001.000001.00000


Target Position: 1371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1371GCUAACACAGAUGUAAAAG69.52781004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4491389GCTAACACAGATGTAAAAGCTTTTACATCTGTGTTAGC0.047600.027900.715500.750001.000001.00000


Target Position: 445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
445CAUCUACUCCAUCAUCUUC78.3908501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
554463CATCTACTCCATCATCTTCGAAGATGATGGAGTAGATG0.724100.269300.482800.500001.000001.00000


Target Position: 772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
772UGAAAAGGUGGUCUAUGUU75.9715629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486790TGAAAAGGTGGTCTATGTTAACATAGACCACCTTTTCA0.035800.006200.577600.750001.000001.00000


Target Position: 1878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1878AAGUACAUGUUAAACUUAA90.2585101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4541896AAGTACATGTTAAACTTAATTAAGTTTAACATGTACTT0.402900.004800.603400.500001.000001.00000


Target Position: 1344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1344AGUCUGAGUCUUCAAGUUU81.3403371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2981362AGTCTGAGTCTTCAAGTTTAAACTTGAAGACTCAGACT0.389700.014700.706900.750000.972800.87500


Target Position: 1893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1893UUAAAAAAAAAAAAAAAAA75.4481655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4651911TTAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTAA0.995700.636300.534500.500001.000001.00000


Target Position: 471, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
471GCAUUGUGGGCAAUGGAUU78.0513525

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
469-491TGGCATTGTGGGCAATGGATTGGAAUCCAUUGCCCACAAUGCCAGCAUUGUGGGCAAUGGAUUGGU20.118.132


Target Position: 1388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1388AGACUUUUUUUUAUACGAU83.8895268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4131406AGACTTTTTTTTATACGATATCGTATAAAAAAAAGTCT0.136100.060700.543100.750001.000001.00000


Target Position: 1743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1743AGACGUGAUUUUGCUGUAG69.58441000

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241761AGACGTGATTTTGCTGTAGCTACAGCAAAATCACGTCT0.064700.002700.551700.500001.000001.00000


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773GAAAAGGUGGUCUAUGUUG75.3124659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
523791GAAAAGGTGGTCTATGTTGCAACATAGACCACCTTTTC0.023700.004300.525900.500001.000001.00000


Target Position: 1687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1687AGCUGUUUAUGCAUAGAUA97.704912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2671705AGCTGTTTATGCATAGATATATCTATGCATAAACAGCT0.190900.018400.810300.750000.994600.75000


Target Position: 1212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1212CCAUCCUCUAUGCUUUCCU71.4418895

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5141230CCATCCTCTATGCTTTCCTAGGAAAGCATAGAGGATGG0.408100.088300.500000.750001.000001.00000


Target Position: 321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
321CUCUUUUGCAGAUAUACAC70.8125930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
457339CTCTTTTGCAGATATACACGTGTATATCTGCAAAAGAG0.124000.019600.517200.500000.967400.62500


Target Position: 560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
560GUGGCCGACCUCCUCUUUG61.19421443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
569578GTGGCCGACCTCCTCTTTGCAAAGAGGAGGTCGGCCAC0.215700.021700.646600.500000.983700.75000


Target Position: 1735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1735UGUUCUUAAGACGUGAUUU73.7052751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4401753TGTTCTTAAGACGTGATTTAAATCACGTCTTAAGAACA0.049900.005600.706900.750001.000001.00000


Target Position: 1584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1584GGCCAAGUUCUUAGUUGCU79.0786473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211602GGCCAAGTTCTTAGTTGCTAGCAACTAAGAACTTGGCC0.024000.004100.646600.750001.000001.00000


Target Position: 414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
414AUGCUAAUUUCAAUAAAAU81.8868348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
360432ATGCTAATTTCAATAAAATATTTTATTGAAATTAGCAT0.371000.177200.646600.500001.000001.00000


Target Position: 880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
880CUUCUACCCCAAUGACUUG70.3164958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
539898CTTCTACCCCAATGACTTGCAAGTCATTGGGGTAGAAG0.082000.017600.491400.500001.000001.00000


Target Position: 1884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1884AUGUUAAACUUAAAAAAAA87.627155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4201902ATGTTAAACTTAAAAAAAATTTTTTTTAAGTTTAACAT0.461400.216200.655200.500001.000001.00000


Target Position: 1343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1343GAGUCUGAGUCUUCAAGUU92.32566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4481361GAGTCTGAGTCTTCAAGTTAACTTGAAGACTCAGACTC0.476200.005100.663800.750000.972800.87500


Target Position: 191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
191GUGCCCUUAGCCCACUACU69.6036997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
443209GTGCCCTTAGCCCACTACTAGTAGTGGGCTAAGGGCAC0.113000.037200.586200.500000.945700.75000


Target Position: 1888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1888UAAACUUAAAAAAAAAAAA78.2786508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4661906TAAACTTAAAAAAAAAAAATTTTTTTTTTTTAAGTTTA0.985800.399400.534500.500001.000001.00000


Target Position: 716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
716CGCUACCUGGCCAUCGUCC57.75361576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
577734CGCTACCTGGCCATCGTCCGGACGATGGCCAGGTAGCG0.378500.001200.551700.500000.923900.62500


Target Position: 255, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
255GCUUUAAAAAUUUUUUUUA87.0059170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
155273GCTTTAAAAATTTTTTTTATAAAAAAAATTTTTAAAGC0.381300.044500.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
253-275TTGCTTTAAAAATTTTTTTTAACUAAAAAAAAUUUUUAAAGCAAGCUUUAAAAAUUUUUUUUAACU-11.3-3.810


Target Position: 879, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879GCUUCUACCCCAAUGACUU83.5744285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
303897GCTTCTACCCCAATGACTTAAGTCATTGGGGTAGAAGC0.100800.037900.715501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
877-899CCGCTTCTACCCCAATGACTTGTAAGUCAUUGGGGUAGAAGCGGGCUUCUACCCCAAUGACUUGUU19.218.923


Target Position: 451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
451CUCCAUCAUCUUCUUAACU75.2657662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
376469CTCCATCATCTTCTTAACTAGTTAAGAAGATGATGGAG0.421900.250000.603400.500001.000001.00000


Target Position: 1418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1418UUUUAAGUUACACAUUUUU65.95921202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931436TTTTAAGTTACACATTTTTAAAAATGTGTAACTTAAAA0.530600.119200.500000.500001.000001.00000


Target Position: 946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
946GCCUGGUAUUGUCAUCCUG75.2331664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463964GCCTGGTATTGTCATCCTGCAGGATGACAATACCAGGC0.086900.004300.715500.750000.978300.75000


Target Position: 450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
450ACUCCAUCAUCUUCUUAAC72.3985838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
503468ACTCCATCATCTTCTTAACGTTAAGAAGATGATGGAGT0.668800.500500.560300.500001.000001.00000


Target Position: 1885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1885UGUUAAACUUAAAAAAAAA89.4501118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1581903TGTTAAACTTAAAAAAAAATTTTTTTTTAAGTTTAACA0.653600.399300.706900.750001.000001.00000


Target Position: 1377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1377ACAGAUGUAAAAGACUUUU71.4807893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2991395ACAGATGTAAAAGACTTTTAAAAGTCTTTTACATCTGT0.101800.017000.706900.750001.000001.00000


Target Position: 84, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
84GUUCUAAACAAAGAAUUUU77.5208547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
515102GTTCTAAACAAAGAATTTTAAAATTCTTTGTTTAGAAC0.028000.004300.646600.750000.945700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
82-104TTGTTCTAAACAAAGAATTTTGTAAAAUUCUUUGUUUAGAACAAGUUCUAAACAAAGAAUUUUGUU5.37.112


Target Position: 401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
401UUCCGUGAAGAAAAUGCUA73.1264799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
516419TTCCGTGAAGAAAATGCTATAGCATTTTCTTCACGGAA0.463400.004000.500000.500001.000001.00000


Target Position: 1675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1675GAAAUGAUCCCCAGCUGUU84263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5511693GAAATGATCCCCAGCTGTTAACAGCTGGGGATCATTTC0.018700.007700.525900.750001.000001.00000


Target Position: 67, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
67CGUCUCAGUGCCCUUUUGU73.1724796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
36185CGTCTCAGTGCCCTTTTGTACAAAAGGGCACTGAGACG0.147900.051500.569000.750001.000001.00000


Target Position: 448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
448CUACUCCAUCAUCUUCUUA87.826148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
267466CTACTCCATCATCTTCTTATAAGAAGATGATGGAGTAG0.705800.502700.637900.750001.000001.00000


Target Position: 1663, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1663CACGUAAAGCUAGAAAUGA84.8111236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5501681CACGTAAAGCTAGAAATGATCATTTCTAGCTTTACGTG0.234800.001800.569000.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1661-1683ATCACGTAAAGCTAGAAATGATCUCAUUUCUAGCUUUACGUGAUCACGUAAAGCUAGAAAUGAUCU12.015.032


Target Position: 1512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1512UGUGAAGUUUAAUUGACUU80.0177430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451530TGTGAAGTTTAATTGACTTAAGTCAATTAAACTTCACA0.068200.002000.569000.750001.000001.00000


Target Position: 698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
698GCCUUCAUCAGUCUGGACC57.61621579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
577716GCCTTCATCAGTCTGGACCGGTCCAGACTGATGAAGGC0.013600.013200.646600.500001.000001.00000


Target Position: 310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
310CAUUCCUUUGCCUCUUUUG67.79161126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
520328CATTCCTTTGCCTCTTTTGCAAAAGAGGCAAAGGAATG0.045300.028100.508600.500001.000001.00000


Target Position: 73, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
73AGUGCCCUUUUGUUCUAAA86.1382190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
43491AGTGCCCTTTTGTTCTAAATTTAGAACAAAAGGGCACT0.050800.026400.706900.750001.000001.00000


Target Position: 1472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1472UAUUGCUUGUUGGAUUUUU67.34111148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4031490TATTGCTTGTTGGATTTTTAAAAATCCAACAAGCAATA0.159200.040400.543100.500001.000001.00000


Target Position: 527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
527AGCAUGACGGACAAGUACA84.1695259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
538545AGCATGACGGACAAGTACATGTACTTGTCCGTCATGCT0.138200.003400.646600.500001.000001.00000


Target Position: 279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
279GUUAAUGCUUGCUGAAUUG73.6071760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
519297GTTAATGCTTGCTGAATTGCAATTCAGCAAGCATTAAC0.024400.004200.500000.500001.000001.00000


Target Position: 253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
253UUGCUUUAAAAAUUUUUUU59.62141507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
582271TTGCTTTAAAAATTTTTTTAAAAAAATTTTTAAAGCAA0.354100.031400.646600.500001.000001.00000


Target Position: 1372, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1372CUAACACAGAUGUAAAAGA87.8779144

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1370-1392AGCTAACACAGATGTAAAAGACTUCUUUUACAUCUGUGUUAGCUCUAACACAGAUGUAAAAGACUU4.920.422


Target Position: 1588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1588AAGUUCUUAGUUGCUGUAU69.39671015

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5331606AAGTTCTTAGTTGCTGTATATACAGCAACTAAGAACTT0.021500.006700.594800.500001.000001.00000


Target Position: 1345, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1345GUCUGAGUCUUCAAGUUUU88.4215136

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9134519GTCTGAGTCTTCAAGTTTT1/1/0/097.21CXCR4NM_001008540.1+NM_003467.21+1NANANA2:136872451..136872469(-)00CXCR4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3071363GTCTGAGTCTTCAAGTTTTAAAACTTGAAGACTCAGAC0.375800.013900.819000.750000.972800.75000


Target Position: 1861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1861UAUUAAGUUGUUAAUAAAA86.8711173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4661879TATTAAGTTGTTAATAAAATTTTATTAACAACTTAATA0.044300.013000.543100.500001.000001.00000


Target Position: 969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
969GCUAUUGCAUUAUCAUCUC74.516702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
406987GCTATTGCATTATCATCTCGAGATGATAATGCAATAGC0.605600.074300.543100.750001.000001.00000


Target Position: 199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
199AGCCCACUACUUCAGAAUU77.7943535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
403217AGCCCACTACTTCAGAATTAATTCTGAAGTAGTGGGCT0.061500.042000.844800.750001.000001.00000


Target Position: 578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
578GUCAUCACGCUUCCCUUCU65.29331237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
492596GTCATCACGCTTCCCTTCTAGAAGGGAAGCGTGATGAC0.032800.012900.594800.500001.000001.00000


Target Position: 957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
957UCAUCCUGUCCUGCUAUUG56.74661614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
517975TCATCCTGTCCTGCTATTGCAATAGCAGGACAGGATGA0.025900.004000.577600.500001.000001.00000


Target Position: 1368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1368CCAGCUAACACAGAUGUAA89.4843117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4501386CCAGCTAACACAGATGTAATTACATCTGTGTTAGCTGG0.047500.013000.810301.000001.000001.00000


Target Position: 443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
443ACCAUCUACUCCAUCAUCU73.796747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
357461ACCATCTACTCCATCATCTAGATGATGGAGTAGATGGT0.579600.280300.629300.500001.000001.00000


Target Position: 1726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1726CGUUUUUCCUGUUCUUAAG75.9905627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281744CGTTTTTCCTGTTCTTAAGCTTAAGAACAGGAAAAACG0.022500.006600.637900.750001.000001.00000


Target Position: 241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
241UGGUUUUUUAAAUUGCUUU67.83131125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
519259TGGTTTTTTAAATTGCTTTAAAGCAATTTAAAAAACCA0.030800.002800.844800.750001.000001.00000


Target Position: 1736, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1736GUUCUUAAGACGUGAUUUU79.6465452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5361754GTTCTTAAGACGTGATTTTAAAATCACGTCTTAAGAAC0.060000.002400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1734-1756CTGTTCTTAAGACGTGATTTTGCAAAAUCACGUCUUAAGAACAGGUUCUUAAGACGUGAUUUUGCU14.87.123


Target Position: 1803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1803GCUGGUUUUUCAGUUUUCA83.997264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3001821GCTGGTTTTTCAGTTTTCATGAAAACTGAAAAACCAGC0.116400.014500.629300.750000.923900.62500


Target Position: 1229, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1229CUUGGAGCCAAAUUUAAAA85.8536201

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5122919CTTGGAGCCAAATTTAAAA1/1/0/097.75CXCR4NM_001008540.1+NM_003467.21+1NANANA2:136872567..136872585(-)00CXCR4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3401247CTTGGAGCCAAATTTAAAATTTTAAATTTGGCTCCAAG0.942300.011200.637900.750001.000001.00000


Target Position: 1892, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1892CUUAAAAAAAAAAAAAAAA82.6925320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2381910CTTAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTAAG0.995200.468700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1890-1912AACTTAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAAGUUCUUAAAAAAAAAAAAAAAAAAU-11.3-9.100


Target Position: 117, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
117CAAAGAAGGAUAUAAUGAA100.276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
567135CAAAGAAGGATATAATGAATTCATTATATCCTTCTTTG0.716100.136100.474100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
115-137ACCAAAGAAGGATATAATGAAGTUUCAUUAUAUCCUUCUUUGGUCAAAGAAGGAUAUAAUGAAGUU8.710.322


Target Position: 1090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1090GAUCAGCAUCGACUCCUUC75.7357639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4751108GATCAGCATCGACTCCTTCGAAGGAGTCGATGCTGATC0.092700.009300.508600.500000.983700.62500


Target Position: 1877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1877AAAGUACAUGUUAAACUUA90.933988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751895AAAGTACATGTTAAACTTATAAGTTTAACATGTACTTT0.404400.002900.465500.500001.000001.00000


Target Position: 266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
266UUUUUUUAACUGGGUUAAU61.29571436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
573284TTTTTTTAACTGGGTTAATATTAACCCAGTTAAAAAAA0.063400.038800.491400.500000.989100.62500


Target Position: 726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
726CCAUCGUCCACGCCACCAA84.2105257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125744CCATCGTCCACGCCACCAATTGGTGGCGTGGACGATGG0.333400.066500.698301.000001.000001.00000


Target Position: 514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
514GAAGAAACUGAGAAGCAUG83.3616296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
453532GAAGAAACTGAGAAGCATGCATGCTTCTCAGTTTCTTC0.105100.052200.517200.500001.000001.00000


Target Position: 1819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1819UCAGGAGUGGGUUGAUUUC60.35011481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5731837TCAGGAGTGGGTTGATTTCGAAATCAACCCACTCCTGA0.022200.001200.551700.500001.000001.00000


Target Position: 1186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1186AGCUUUCUUCCACUGUUGU69.41481013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171204AGCTTTCTTCCACTGTTGTACAACAGTGGAAGAAAGCT0.198800.037300.646600.500001.000001.00000


Target Position: 132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
132UGAAGUCACUAUGGGAAAA81.7719355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
220150TGAAGTCACTATGGGAAAATTTTCCCATAGTGACTTCA0.158600.036900.724100.750001.000001.00000


Target Position: 877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
877CCGCUUCUACCCCAAUGAC66.16351192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
371895CCGCTTCTACCCCAATGACGTCATTGGGGTAGAAGCGG0.072900.040100.594800.750001.000001.00000


Target Position: 1869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1869UGUUAAUAAAAGUACAUGU76.8662577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5391887TGTTAATAAAAGTACATGTACATGTACTTTTATTAACA0.020600.017300.500000.500001.000001.00000


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623GUAGAAAAGGGAACUGAAC71.6676882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4201641GTAGAAAAGGGAACTGAACGTTCAGTTCCCTTTTCTAC0.065900.006500.534500.500001.000001.00000


Target Position: 1356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1356CAAGUUUUCACUCCAGCUA85.2325224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5691374CAAGTTTTCACTCCAGCTATAGCTGGAGTGAAAACTTG0.183200.050500.474100.750000.902200.62500


Target Position: 874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
874UGACCGCUUCUACCCCAAU70.0672969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
279892TGACCGCTTCTACCCCAATATTGGGGTAGAAGCGGTCA0.113600.040400.715500.750001.000001.00000


Target Position: 264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
264AUUUUUUUUAACUGGGUUA74.3519711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
566282ATTTTTTTTAACTGGGTTATAACCCAGTTAAAAAAAAT0.079400.049900.474100.500001.000001.00000


Target Position: 1210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210CCCCAUCCUCUAUGCUUUC63.16671347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2141228CCCCATCCTCTATGCTTTCGAAAGCATAGAGGATGGGG0.161100.096200.819000.750001.000001.00000


Target Position: 689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
689CUCAUCCUGGCCUUCAUCA75.8906633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
340707CTCATCCTGGCCTTCATCATGATGAAGGCCAGGATGAG0.209800.013700.586200.500001.000001.00000


Target Position: 1223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1223GCUUUCCUUGGAGCCAAAU68.42161082

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4681241GCTTTCCTTGGAGCCAAATATTTGGCTCCAAGGAAAGC0.055200.004200.844801.000000.989100.62500


Target Position: 202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
202CCACUACUUCAGAAUUUCC72.6793819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
570220CCACTACTTCAGAATTTCCGGAAATTCTGAAGTAGTGG0.053600.020300.474100.500001.000001.00000


Target Position: 64, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
64CAGCGUCUCAGUGCCCUUU73.8562743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
28882CAGCGTCTCAGTGCCCTTTAAAGGGCACTGAGACGCTG0.158300.015900.784500.750000.902200.62500


Target Position: 1228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1228CCUUGGAGCCAAAUUUAAA92.011770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4231246CCTTGGAGCCAAATTTAAATTTAAATTTGGCTCCAAGG0.923200.006200.844801.000001.000001.00000


Target Position: 876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
876ACCGCUUCUACCCCAAUGA68.70991060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
456894ACCGCTTCTACCCCAATGATCATTGGGGTAGAAGCGGT0.085400.040500.629300.500001.000001.00000


Target Position: 577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
577UGUCAUCACGCUUCCCUUC59.99631492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473595TGTCATCACGCTTCCCTTCGAAGGGAAGCGTGATGACA0.040600.014600.534500.500001.000001.00000


Target Position: 1724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1724AACGUUUUUCCUGUUCUUA76.7802584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761742AACGTTTTTCCTGTTCTTATAAGAACAGGAAAAACGTT0.062300.008100.612100.500001.000001.00000


Target Position: 254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
254UGCUUUAAAAAUUUUUUUU66.7271171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
193272TGCTTTAAAAATTTTTTTTAAAAAAAATTTTTAAAGCA0.385700.035500.853400.750001.000001.00000


Target Position: 725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
725GCCAUCGUCCACGCCACCA70.9352919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
201743GCCATCGTCCACGCCACCATGGTGGCGTGGACGATGGC0.236800.054700.655200.750000.951100.62500


Target Position: 1285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1285GUCCAGCCUCAAGAUCCUC62.29051386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5791303GTCCAGCCTCAAGATCCTCGAGGATCTTGAGGCTGGAC0.029100.003800.508600.500001.000001.00000


Target Position: 1255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1255CCAGCACGCACUCACCUCU77.1807558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2911273CCAGCACGCACTCACCTCTAGAGGTGAGTGCGTGCTGG0.106700.026100.620700.750001.000001.00000


Target Position: 965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
965UCCUGCUAUUGCAUUAUCA80.3268416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
551983TCCTGCTATTGCATTATCATGATAATGCAATAGCAGGA0.123200.009700.646600.500000.907600.87500


Target Position: 1745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1745ACGUGAUUUUGCUGUAGAA93.933942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4191763ACGTGATTTTGCTGTAGAATTCTACAGCAAAATCACGT0.055500.007200.603400.750001.000001.00000


Target Position: 524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
524AGAAGCAUGACGGACAAGU66.81771168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
562542AGAAGCATGACGGACAAGTACTTGTCCGTCATGCTTCT0.077900.003900.517200.500001.000001.00000


Target Position: 1582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1582GUGGCCAAGUUCUUAGUUG70.7227936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5461600GTGGCCAAGTTCTTAGTTGCAACTAAGAACTTGGCCAC0.032800.001900.646600.500001.000001.00000


Target Position: 1398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1398UUAUACGAUAAAUAACUUU69.6645993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5601416TTATACGATAAATAACTTTAAAGTTATTTATCGTATAA0.103400.007600.534500.500001.000001.00000


Target Position: 90, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
90AACAAAGAAUUUUGUAAUU76.8786576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
547108AACAAAGAATTTTGTAATTAATTACAAAATTCTTTGTT0.228100.002300.637900.500000.945700.62500


Target Position: 903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
903UGGUUGUGUUCCAGUUUCA82.3962333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
552921TGGTTGTGTTCCAGTTTCATGAAACTGGAACACAACCA0.249100.001700.620700.500000.994600.62500


Target Position: 963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
963UGUCCUGCUAUUGCAUUAU69.656995

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
353981TGTCCTGCTATTGCATTATATAATGCAATAGCAGGACA0.090800.010000.663800.750000.907601.00000


Target Position: 1688, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1688GCUGUUUAUGCAUAGAUAA95.207231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1171706GCTGTTTATGCATAGATAATTATCTATGCATAAACAGC0.285600.090700.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1686-1708CAGCTGTTTATGCATAGATAATCUUAUCUAUGCAUAAACAGCUGGCUGUUUAUGCAUAGAUAAUCU8.211.822


Target Position: 1173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1173UCACCGAGGCCCUAGCUUU69.9069977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611191TCACCGAGGCCCTAGCTTTAAAGCTAGGGCCTCGGTGA0.045500.009300.724100.750000.983700.75000


Target Position: 203, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
203CACUACUUCAGAAUUUCCU75.6002647

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
201-223CCCACTACTTCAGAATTTCCTGAAGGAAAUUCUGAAGUAGUGGGCACUACUUCAGAAUUUCCUGAU14.217.621


Target Position: 1732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1732UCCUGUUCUUAAGACGUGA72.5144831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5421750TCCTGTTCTTAAGACGTGATCACGTCTTAAGAACAGGA0.024900.002100.646600.500001.000001.00000


Target Position: 31, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
31GAGGAGUUAGCCAAGAUGU80.8354394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
53649GAGGAGTTAGCCAAGATGTACATCTTGGCTAACTCCTC0.030000.006900.603400.500001.000001.00000


Target Position: 277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
277GGGUUAAUGCUUGCUGAAU81.7961353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
440295GGGTTAATGCTTGCTGAATATTCAGCAAGCATTAACCC0.049700.010100.982801.000001.000001.00000


Target Position: 1476, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1476GCUUGUUGGAUUUUUGUCU76.8279580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2751494GCTTGTTGGATTTTTGTCTAGACAAAAATCCAACAAGC0.114800.057400.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1474-1496TTGCTTGTTGGATTTTTGTCTTGAGACAAAAAUCCAACAAGCAAGCUUGUUGGAUUUUUGUCUUGU14.916.722


Target Position: 1488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1488UUUGUCUUGUGUUUCUUUA73.6093759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5861506TTTGTCTTGTGTTTCTTTATAAAGAAACACAAGACAAA0.327600.052500.465500.500001.000001.00000


Target Position: 1040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1040GUCAUCCUCAUCCUGGCUU66.08571196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5581058GTCATCCTCATCCTGGCTTAAGCCAGGATGAGGATGAC0.017400.015800.681000.750000.994600.87500


Target Position: 1855, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1855GUCUUGUAUUAAGUUGUUA88.8301130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001873GTCTTGTATTAAGTTGTTATAACAACTTAATACAAGAC0.047500.003300.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1853-1875CAGTCTTGTATTAAGTTGTTAATUAACAACUUAAUACAAGACUGGUCUUGUAUUAAGUUGUUAAUU17.820.322


Target Position: 164, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
164GUUGUAGGAUUCUACAUUA99.95867

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_116419GTTGTAGGATTCTACATTA1/1/0/0100.00CXCR4NM_001008540.1+NM_003467.21+0NANANANA00CXCR4(0.002)


Target Position: 233, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
233GCCUGAAUUGGUUUUUUAA93.265650

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_323319GCCTGAATTGGTTTTTTAA1/1/0/097.75CXCR4NM_001008540.1+NM_003467.21+0NANANA2:136873563..136873581(-)00CXCR4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
571251GCCTGAATTGGTTTTTTAATTAAAAAACCAATTCAGGC0.015300.004300.965501.000000.972800.75000


Target Position: 250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
250AAAUUGCUUUAAAAAUUUU77.8763531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
586268AAATTGCTTTAAAAATTTTAAAATTTTTAAAGCAATTT0.429600.025900.500000.500001.000001.00000


Target Position: 672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
672ACCUCUACAGCAGUGUCCU68.03331111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
566690ACCTCTACAGCAGTGTCCTAGGACACTGCTGTAGAGGT0.016500.013700.508600.500001.000001.00000


Target Position: 686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
686GUCCUCAUCCUGGCCUUCA73.3508779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483704GTCCTCATCCTGGCCTTCATGAAGGCCAGGATGAGGAC0.036900.011300.594800.500000.994600.75000


Target Position: 77, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
77CCCUUUUGUUCUAAACAAA90.734293

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
75-97TGCCCTTTTGTTCTAAACAAAGAUUUGUUUAGAACAAAAGGGCACCCUUUUGUUCUAAACAAAGAU7.216.122


Target Position: 570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
570UCCUCUUUGUCAUCACGCU69.8227981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
523588TCCTCTTTGTCATCACGCTAGCGTGATGACAAAGAGGA0.078000.057400.517200.500001.000001.00000


Target Position: 1428, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1428CACAUUUUUCAGAUAUAAA97.038917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2581446CACATTTTTCAGATATAAATTTATATCTGAAAAATGTG0.139700.073900.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1426-1448TACACATTTTTCAGATATAAAAGUUUAUAUCUGAAAAAUGUGUACACAUUUUUCAGAUAUAAAAGU3.55.322


Target Position: 1405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1405AUAAAUAACUUUUUUUUAA85.4904214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4801423ATAAATAACTTTTTTTTAATTAAAAAAAAGTTATTTAT0.071900.023600.508600.500001.000001.00000


Target Position: 1224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1224CUUUCCUUGGAGCCAAAUU69.40021014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4601242CTTTCCTTGGAGCCAAATTAATTTGGCTCCAAGGAAAG0.098500.004500.629300.750001.000001.00000


Target Position: 1505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1505UAGUUUUUGUGAAGUUUAA83.5859284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5811523TAGTTTTTGTGAAGTTTAATTAAACTTCACAAAAACTA0.012900.008300.637900.500001.000001.00000


Target Position: 815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
815CUGACUAUUCCCGACUUCA83.0366310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
368833CTGACTATTCCCGACTTCATGAAGTCGGGAATAGTCAG0.210900.045800.560300.500001.000001.00000


Target Position: 668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
668GUCAACCUCUACAGCAGUG69.7195990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
546686GTCAACCTCTACAGCAGTGCACTGCTGTAGAGGTTGAC0.019600.017400.525900.500001.000001.00000


Target Position: 144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
144GGGAAAAGAUGGGGAGGAG72.137855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
559162GGGAAAAGATGGGGAGGAGCTCCTCCCCATCTTTTCCC0.017300.016400.681000.750001.000001.00000


Target Position: 1176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1176CCGAGGCCCUAGCUUUCUU75.2999661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411194CCGAGGCCCTAGCTTTCTTAAGAAAGCTAGGGCCTCGG0.045200.002100.775901.000001.000001.00000


Target Position: 1490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1490UGUCUUGUGUUUCUUUAGU68.27181093

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5101508TGTCTTGTGTTTCTTTAGTACTAAAGAAACACAAGACA0.215200.038800.500000.500001.000001.00000


Target Position: 1042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1042CAUCCUCAUCCUGGCUUUC64.40631278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5721060CATCCTCATCCTGGCTTTCGAAAGCCAGGATGAGGATG0.015300.014200.482800.500000.994600.87500


Target Position: 417, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
417CUAAUUUCAAUAAAAUCUU76.3404609

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
415-437TGCTAATTTCAATAAAATCTTCCAAGAUUUUAUUGAAAUUAGCACUAAUUUCAAUAAAAUCUUCCU5.32.122


Target Position: 371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
371GGGGACUAUGACUCCAUGA87.0241169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
379389GGGGACTATGACTCCATGATCATGGAGTCATAGTCCCC0.090700.008500.767200.750000.913000.75000


Target Position: 1504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1504UUAGUUUUUGUGAAGUUUA75.8546636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5731522TTAGTTTTTGTGAAGTTTATAAACTTCACAAAAACTAA0.014800.009200.500000.500001.000001.00000


Target Position: 1503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1503UUUAGUUUUUGUGAAGUUU64.54481271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5611521TTTAGTTTTTGTGAAGTTTAAACTTCACAAAAACTAAA0.016900.010500.500000.500001.000001.00000


Target Position: 416, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
416GCUAAUUUCAAUAAAAUCU79.3371459

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
414-436ATGCTAATTTCAATAAAATCTTCAGAUUUUAUUGAAAUUAGCAUGCUAAUUUCAAUAAAAUCUUCU2.1-4.322


Target Position: 1514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514UGAAGUUUAAUUGACUUAU72.111858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4471532TGAAGTTTAATTGACTTATATAAGTCAATTAAACTTCA0.054200.005100.681000.750001.000001.00000


Target Position: 234, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
234CCUGAAUUGGUUUUUUAAA86.4486182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
456252CCTGAATTGGTTTTTTAAATTTAAAAAACCAATTCAGG0.317200.004700.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
232-254AGCCTGAATTGGTTTTTTAAATTUUUAAAAAACCAAUUCAGGCUCCUGAAUUGGUUUUUUAAAUUU-9.112.022


Target Position: 1416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1416UUUUUUAAGUUACACAUUU68.67881064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201434TTTTTTAAGTTACACATTTAAATGTGTAACTTAAAAAA0.292400.095600.500000.500001.000001.00000


Target Position: 1482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1482UGGAUUUUUGUCUUGUGUU71.3462898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2471500TGGATTTTTGTCTTGTGTTAACACAAGACAAAAATCCA0.137900.072900.698300.750001.000001.00000


Target Position: 87, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
87CUAAACAAAGAAUUUUGUA85.3529219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
537105CTAAACAAAGAATTTTGTATACAAAATTCTTTGTTTAG0.202400.006200.491400.750000.945700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
85-107TTCTAAACAAAGAATTTTGTAATUACAAAAUUCUUUGUUUAGAACUAAACAAAGAAUUUUGUAAUU5.37.222


Target Position: 1383, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1383GUAAAAGACUUUUUUUUAU85.6278206

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10138319GTAAAAGACTTTTTTTTAT1/1/0/096.22CXCR4NM_001008540.1+NM_003467.21+1NANANA2:136872413..136872431(-)00CXCR4(0.002)&SLC4A8(0.029)&MEST(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2541401GTAAAAGACTTTTTTTTATATAAAAAAAAGTCTTTTAC0.145500.027500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1381-1403ATGTAAAAGACTTTTTTTTATACAUAAAAAAAAGUCUUUUACAUGUAAAAGACUUUUUUUUAUACU-9.17.112


Target Position: 1425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1425UUACACAUUUUUCAGAUAU70.8836926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5401443TTACACATTTTTCAGATATATATCTGAAAAATGTGTAA0.199900.161400.491400.500001.000001.00000


Target Position: 1442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1442AUAAAAGACUGACCAAUAU81.5266364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941460ATAAAAGACTGACCAATATATATTGGTCAGTCTTTTAT0.051200.006200.500000.500001.000001.00000


Target Position: 1033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1033GACCACAGUCAUCCUCAUC72.9267808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4261051GACCACAGTCATCCTCATCGATGAGGATGACTGTGGTC0.685400.043600.637900.500001.000001.00000


Target Position: 1222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1222UGCUUUCCUUGGAGCCAAA79.2173465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261240TGCTTTCCTTGGAGCCAAATTTGGCTCCAAGGAAAGCA0.023200.003600.853400.750000.913000.62500


Target Position: 910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
910GUUCCAGUUUCAGCACAUC70.3466955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
581928GTTCCAGTTTCAGCACATCGATGTGCTGAAACTGGAAC0.112400.035300.465500.500001.000001.00000


Target Position: 1691, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1691GUUUAUGCAUAGAUAAUCU89.5443115

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1689-1711CTGTTTATGCATAGATAATCTCTAGAUUAUCUAUGCAUAAACAGGUUUAUGCAUAGAUAAUCUCUU11.615.332


Target Position: 397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
397CUGUUUCCGUGAAGAAAAU79.1957468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
499415CTGTTTCCGTGAAGAAAATATTTTCTTCACGGAAACAG0.144700.003300.775900.750000.945700.62500


Target Position: 412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
412AAAUGCUAAUUUCAAUAAA87.6129157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513430AAATGCTAATTTCAATAAATTTATTGAAATTAGCATTT0.514600.415600.500000.500001.000001.00000


Target Position: 112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
112UCUACCAAAGAAGGAUAUA73.9256736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364130TCTACCAAAGAAGGATATATATATCCTTCTTTGGTAGA0.175800.009500.681000.750000.962001.00000


Target Position: 1882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1882ACAUGUUAAACUUAAAAAA87.3216162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1251900ACATGTTAAACTTAAAAAATTTTTTAAGTTTAACATGT0.446400.056200.706900.750001.000001.00000


Target Position: 439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
439GCCCACCAUCUACUCCAUC63.49641328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86457GCCCACCATCTACTCCATCGATGGAGTAGATGGTGGGC0.383000.309500.819000.750001.000001.00000


Target Position: 1092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1092UCAGCAUCGACUCCUUCAU69.46921009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281110TCAGCATCGACTCCTTCATATGAAGGAGTCGATGCTGA0.095700.002600.569000.750001.000001.00000


Target Position: 1523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1523AUUGACUUAUUUAUAUAAA85.5287211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4681541ATTGACTTATTTATATAAATTTATATAAATAAGTCAAT0.203900.033300.508600.500001.000001.00000


Target Position: 169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
169AGGAUUCUACAUUAAUUCU80.4971409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
339187AGGATTCTACATTAATTCTAGAATTAATGTAGAATCCT0.204500.023600.620700.500001.000001.00000


Target Position: 1177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1177CGAGGCCCUAGCUUUCUUC66.40351180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261195CGAGGCCCTAGCTTTCTTCGAAGAAAGCTAGGGCCTCG0.084000.002700.620700.750001.000001.00000


Target Position: 1783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1783GCCCAAAGUGGUAUAGAAA93.816743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5321801GCCCAAAGTGGTATAGAAATTTCTATACCACTTTGGGC0.021700.003201.000001.000000.940200.75000


Target Position: 145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
145GGAAAAGAUGGGGAGGAGA81.5663362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
460163GGAAAAGATGGGGAGGAGATCTCCTCCCCATCTTTTCC0.045500.014400.646600.750001.000001.00000


Target Position: 1282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1282AGGGUCCAGCCUCAAGAUC56.39931630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551300AGGGTCCAGCCTCAAGATCGATCTTGAGGCTGGACCCT0.046900.037300.663800.500000.967400.62500


Target Position: 235, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
235CUGAAUUGGUUUUUUAAAU79.0645475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
544253CTGAATTGGTTTTTTAAATATTTAAAAAACCAATTCAG0.219200.002000.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
233-255GCCTGAATTGGTTTTTTAAATTGAUUUAAAAAACCAAUUCAGGCCUGAAUUGGUUUUUUAAAUUGU-9.113.822


Target Position: 1621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1621CUGUAGAAAAGGGAACUGA80.6557402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531639CTGTAGAAAAGGGAACTGATCAGTTCCCTTTTCTACAG0.093500.012100.560300.500001.000001.00000


Target Position: 405, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
405GUGAAGAAAAUGCUAAUUU79.0835471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
223423GTGAAGAAAATGCTAATTTAAATTAGCATTTTCTTCAC0.454800.057200.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
403-425CCGTGAAGAAAATGCTAATTTCAAAAUUAGCAUUUUCUUCACGGGUGAAGAAAAUGCUAAUUUCAU13.620.422


Target Position: 1041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1041UCAUCCUCAUCCUGGCUUU69.53531003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5681059TCATCCTCATCCTGGCTTTAAAGCCAGGATGAGGATGA0.016300.015200.724100.750000.994601.00000


Target Position: 762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
762AGCUGUUGGCUGAAAAGGU73.8406744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
572780AGCTGTTGGCTGAAAAGGTACCTTTTCAGCCAACAGCT0.099300.001200.500000.500000.967400.62500


Target Position: 1856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1856UCUUGUAUUAAGUUGUUAA87.088166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5101874TCTTGTATTAAGTTGTTAATTAACAACTTAATACAAGA0.037000.003100.689700.750001.000001.00000


Target Position: 1205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1205CUGAACCCCAUCCUCUAUG58.85561539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751223CTGAACCCCATCCTCTATGCATAGAGGATGGGGTTCAG0.179700.096800.629300.500001.000001.00000


Target Position: 666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666CAGUCAACCUCUACAGCAG83.2063303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
504684CAGTCAACCTCTACAGCAGCTGCTGTAGAGGTTGACTG0.056900.050900.500000.500001.000001.00000


Target Position: 1475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1475UGCUUGUUGGAUUUUUGUC58.43951554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4151493TGCTTGTTGGATTTTTGTCGACAAAAATCCAACAAGCA0.116100.032900.534500.500001.000001.00000


Target Position: 457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
457CAUCUUCUUAACUGGCAUU81.5625363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
282475CATCTTCTTAACTGGCATTAATGCCAGTTAAGAAGATG0.112100.033700.646600.750001.000001.00000


Target Position: 960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
960UCCUGUCCUGCUAUUGCAU69.7729987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
490978TCCTGTCCTGCTATTGCATATGCAATAGCAGGACAGGA0.032900.007700.715500.750000.907600.62500


Target Position: 745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
745CAGUCAGAGGCCAAGGAAG75.2585663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
579763CAGTCAGAGGCCAAGGAAGCTTCCTTGGCCTCTGACTG0.013300.008800.646600.500001.000001.00000


Target Position: 1226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1226UUCCUUGGAGCCAAAUUUA72.1175856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4461244TTCCTTGGAGCCAAATTTATAAATTTGGCTCCAAGGAA0.886400.005200.637900.500001.000001.00000


Target Position: 116, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
116CCAAAGAAGGAUAUAAUGA87.7718152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
286134CCAAAGAAGGATATAATGATCATTATATCCTTCTTTGG0.265800.056300.620700.750000.994600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
114-136TACCAAAGAAGGATATAATGAAGUCAUUAUAUCCUUCUUUGGUACCAAAGAAGGAUAUAAUGAAGU0.012.222


Target Position: 1733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1733CCUGUUCUUAAGACGUGAU80.2601422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301751CCTGTTCTTAAGACGTGATATCACGTCTTAAGAACAGG0.028900.002600.663801.000001.000001.00000


Target Position: 875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
875GACCGCUUCUACCCCAAUG68.95471043

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
495893GACCGCTTCTACCCCAATGCATTGGGGTAGAAGCGGTC0.084400.040400.663800.500001.000001.00000


Target Position: 1590, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1590GUUCUUAGUUGCUGUAUGU83.7323278

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1588-1610AAGTTCTTAGTTGCTGTATGTCTACAUACAGCAACUAAGAACUUGUUCUUAGUUGCUGUAUGUCUU17.911.732


Target Position: 769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769GGCUGAAAAGGUGGUCUAU85.0316229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433787GGCTGAAAAGGTGGTCTATATAGACCACCTTTTCAGCC0.069200.005900.956901.000001.000001.00000


Target Position: 947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
947CCUGGUAUUGUCAUCCUGU80.056429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
442965CCTGGTATTGTCATCCTGTACAGGATGACAATACCAGG0.114800.005400.637900.750000.978300.75000


Target Position: 1883, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1883CAUGUUAAACUUAAAAAAA93.493148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1971901CATGTTAAACTTAAAAAAATTTTTTTAAGTTTAACATG0.445500.175400.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1881-1903TACATGTTAAACTTAAAAAAAAAUUUUUUUAAGUUUAACAUGUACAUGUUAAACUUAAAAAAAAAU-9.16.922


Target Position: 171, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
171GAUUCUACAUUAAUUCUCU93.116553

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
169-191AGGATTCTACATTAATTCTCTTGAGAGAAUUAAUGUAGAAUCCUGAUUCUACAUUAAUUCUCUUGU14.814.523


Target Position: 1110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1110UCCUCCUGGAAAUCAUCAA73.8163746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2971128TCCTCCTGGAAATCATCAATTGATGATTTCCAGGAGGA0.479700.014800.724100.750000.929300.62500


Target Position: 1530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1530UAUUUAUAUAAAUUUUUUU79.9989431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341548TATTTATATAAATTTTTTTAAAAAAATTTATATAAATA0.226400.150200.543100.500001.000001.00000


Target Position: 816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
816UGACUAUUCCCGACUUCAU79.8211443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
343834TGACTATTCCCGACTTCATATGAAGTCGGGAATAGTCA0.211100.047800.569000.750001.000001.00000


Target Position: 1535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1535AUAUAAAUUUUUUUUGUUU77.5346546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4071553ATATAAATTTTTTTTGTTTAAACAAAAAAAATTTATAT0.302800.102500.543100.500001.000001.00000


Target Position: 673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
673CCUCUACAGCAGUGUCCUC73.4508769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
570691CCTCTACAGCAGTGTCCTCGAGGACACTGCTGTAGAGG0.015800.013200.534500.750001.000001.00000


Target Position: 1746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1746CGUGAUUUUGCUGUAGAAG70.504944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3911764CGTGATTTTGCTGTAGAAGCTTCTACAGCAAAATCACG0.066000.030800.637900.750001.000001.00000


Target Position: 513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
513AGAAGAAACUGAGAAGCAU85.8592200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
360531AGAAGAAACTGAGAAGCATATGCTTCTCAGTTTCTTCT0.144000.070200.569000.750001.000001.00000


Target Position: 111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
111UUCUACCAAAGAAGGAUAU62.77181364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
576129TTCTACCAAAGAAGGATATATATCCTTCTTTGGTAGAA0.168500.005800.629300.500000.962001.00000


Target Position: 109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
109GGUUCUACCAAAGAAGGAU83.7363277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487127GGTTCTACCAAAGAAGGATATCCTTCTTTGGTAGAACC0.206900.003600.672401.000000.956500.75000


Target Position: 1520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1520UUAAUUGACUUAUUUAUAU77.0477565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451538TTAATTGACTTATTTATATATATAAATAAGTCAATTAA0.204800.025500.491400.500001.000001.00000


Target Position: 1517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1517AGUUUAAUUGACUUAUUUA97.176815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3891535AGTTTAATTGACTTATTTATAAATAAGTCAATTAAACT0.066300.020700.672400.750001.000001.00000


Target Position: 1400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1400AUACGAUAAAUAACUUUUU75.0928673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4051418ATACGATAAATAACTTTTTAAAAAGTTATTTATCGTAT0.080700.061300.543100.500001.000001.00000


Target Position: 609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
609CCGUGGCAAACUGGUACUU69.50121005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
375627CCGTGGCAAACTGGTACTTAAGTACCAGTTTGCCACGG0.071700.009600.775901.000001.000001.00000


Target Position: 306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
306UGUCCAUUCCUUUGCCUCU70.0501970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
556324TGTCCATTCCTTTGCCTCTAGAGGCAAAGGAATGGACA0.088700.002700.482800.500001.000001.00000


Target Position: 813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
813UGCUGACUAUUCCCGACUU75.4773654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
201831TGCTGACTATTCCCGACTTAAGTCGGGAATAGTCAGCA0.341800.074300.715500.750001.000001.00000


Target Position: 313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
313UCCUUUGCCUCUUUUGCAG56.6371619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
510331TCCTTTGCCTCTTTTGCAGCTGCAAAAGAGGCAAAGGA0.028900.006600.586200.500000.923900.62500


Target Position: 223, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
223AAGAAAGCAAGCCUGAAUU72.6519822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
525241AAGAAAGCAAGCCTGAATTAATTCAGGCTTGCTTTCTT0.023200.011100.629300.500001.000001.00000


Target Position: 309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
309CCAUUCCUUUGCCUCUUUU75.4984651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
439327CCATTCCTTTGCCTCTTTTAAAAGAGGCAAAGGAATGG0.049700.036700.844801.000001.000001.00000


Target Position: 1870, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1870GUUAAUAAAAGUACAUGUU81.2491376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241888GTTAATAAAAGTACATGTTAACATGTACTTTTATTAAC0.023400.017800.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1868-1890TTGTTAATAAAAGTACATGTTAAAACAUGUACUUUUAUUAACAAGUUAAUAAAAGUACAUGUUAAU20.4-7.522


Target Position: 1332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1332CUGUUUCCACUGAGUCUGA83.6989280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5581350CTGTTTCCACTGAGTCTGATCAGACTCAGTGGAAACAG0.028700.001700.560300.500001.000001.00000


Target Position: 1402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1402ACGAUAAAUAACUUUUUUU76.516599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3931420ACGATAAATAACTTTTTTTAAAAAAAGTTATTTATCGT0.065200.056800.775900.750001.000001.00000


Target Position: 1211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1211CCCAUCCUCUAUGCUUUCC52.41981738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5771229CCCATCCTCTATGCTTTCCGGAAAGCATAGAGGATGGG0.437200.085700.620700.500001.000001.00000


Target Position: 618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
618ACUGGUACUUUGGGAACUU73.0196804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
563636ACTGGTACTTTGGGAACTTAAGTTCCCAAAGTACCAGT0.017900.001500.569000.750001.000001.00000


Target Position: 442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
442CACCAUCUACUCCAUCAUC75.0533678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
532460CACCATCTACTCCATCATCGATGATGGAGTAGATGGTG0.583800.293300.612100.500001.000001.00000


Target Position: 432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
432UCUUCCUGCCCACCAUCUA72.538830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
390450TCTTCCTGCCCACCATCTATAGATGGTGGGCAGGAAGA0.411200.062800.551700.750001.000001.00000


Target Position: 820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820UAUUCCCGACUUCAUCUUU69.16131030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
442838TATTCCCGACTTCATCTTTAAAGATGAAGTCGGGAATA0.217200.157800.543100.500001.000001.00000


Target Position: 452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
452UCCAUCAUCUUCUUAACUG62.6061372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
531470TCCATCATCTTCTTAACTGCAGTTAAGAAGATGATGGA0.128200.067200.586200.500001.000001.00000


Target Position: 135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
135AGUCACUAUGGGAAAAGAU81.3126374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
446153AGTCACTATGGGAAAAGATATCTTTTCCCATAGTGACT0.299200.042500.525900.750001.000001.00000


Target Position: 1889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1889AAACUUAAAAAAAAAAAAA82.3503334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211907AAACTTAAAAAAAAAAAAATTTTTTTTTTTTTAAGTTT0.990700.403300.500000.500001.000001.00000


Target Position: 1384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1384UAAAAGACUUUUUUUUAUA84.2355256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5471402TAAAAGACTTTTTTTTATATATAAAAAAAAGTCTTTTA0.156100.037100.491400.500001.000001.00000


Target Position: 676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676CUACAGCAGUGUCCUCAUC71.1469910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
536694CTACAGCAGTGTCCTCATCGATGAGGACACTGCTGTAG0.051200.009500.491400.500001.000001.00000


Target Position: 1390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1390ACUUUUUUUUAUACGAUAA86.3087185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2171408ACTTTTTTTTATACGATAATTATCGTATAAAAAAAAGT0.160000.081600.672400.750001.000001.00000


Target Position: 1461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1461UGUACAGUUUUUAUUGCUU76.515600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3481479TGTACAGTTTTTATTGCTTAAGCAATAAAAACTGTACA0.105400.012600.569000.750000.994600.62500


Target Position: 447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
447UCUACUCCAUCAUCUUCUU74.7712691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
323465TCTACTCCATCATCTTCTTAAGAAGATGATGGAGTAGA0.703400.293600.586200.750001.000001.00000


Target Position: 1581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1581UGUGGCCAAGUUCUUAGUU66.40041181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5401599TGTGGCCAAGTTCTTAGTTAACTAAGAACTTGGCCACA0.192600.002100.560300.750001.000001.00000


Target Position: 1492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1492UCUUGUGUUUCUUUAGUUU75.6476642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1761510TCTTGTGTTTCTTTAGTTTAAACTAAAGAAACACAAGA0.197700.152700.724100.750001.000001.00000


Target Position: 1739, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1739CUUAAGACGUGAUUUUGCU74.9838682

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1737-1759TTCTTAAGACGTGATTTTGCTGTAGCAAAAUCACGUCUUAAGAACUUAAGACGUGAUUUUGCUGUU14.014.633


Target Position: 610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
610CGUGGCAAACUGGUACUUU79.2251464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
491628CGTGGCAAACTGGTACTTTAAAGTACCAGTTTGCCACG0.032800.006600.775901.000001.000001.00000


Target Position: 70, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
70CUCAGUGCCCUUUUGUUCU71.0334916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
41788CTCAGTGCCCTTTTGTTCTAGAACAAAAGGGCACTGAG0.101200.040900.586200.500001.000001.00000


Target Position: 167, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
167GUAGGAUUCUACAUUAAUU94.933935

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
165-187TTGTAGGATTCTACATTAATTCTAAUUAAUGUAGAAUCCUACAAGUAGGAUUCUACAUUAAUUCUU-1.819.922


Target Position: 1404, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1404GAUAAAUAACUUUUUUUUA95.513927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2651422GATAAATAACTTTTTTTTATAAAAAAAAGTTATTTATC0.122000.033300.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1402-1424ACGATAAATAACTTTTTTTTAAGUAAAAAAAAGUUAUUUAUCGUGAUAAAUAACUUUUUUUUAAGU-11.3-8.022


Target Position: 66, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
66GCGUCUCAGUGCCCUUUUG72.0089865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
27884GCGTCTCAGTGCCCTTTTGCAAAAGGGCACTGAGACGC0.113800.054600.775900.750001.000001.00000


Target Position: 1403, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1403CGAUAAAUAACUUUUUUUU85.9663197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3851421CGATAAATAACTTTTTTTTAAAAAAAAGTTATTTATCG0.067900.044700.793101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1401-1423TACGATAAATAACTTTTTTTTAAAAAAAAAAGUUAUUUAUCGUACGAUAAAUAACUUUUUUUUAAU-11.31.822


Target Position: 131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
131AUGAAGUCACUAUGGGAAA79.3149460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
431149ATGAAGTCACTATGGGAAATTTCCCATAGTGACTTCAT0.155400.035400.655200.500001.000001.00000


Target Position: 1172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1172AUCACCGAGGCCCUAGCUU58.06281570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721190ATCACCGAGGCCCTAGCTTAAGCTAGGGCCTCGGTGAT0.041000.009600.543100.500000.983700.87500


Target Position: 1203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1203GUCUGAACCCCAUCCUCUA91.627677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2151221GTCTGAACCCCATCCTCTATAGAGGATGGGGTTCAGAC0.454100.244100.646600.750001.000001.00000


Target Position: 248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
248UUAAAUUGCUUUAAAAAUU68.11841103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
442266TTAAATTGCTTTAAAAATTAATTTTTAAAGCAATTTAA0.113900.019500.525900.500001.000001.00000


Target Position: 1592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1592UCUUAGUUGCUGUAUGUCU73.3513778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5341610TCTTAGTTGCTGTATGTCTAGACATACAGCAACTAAGA0.052200.005100.500000.500001.000001.00000


Target Position: 1526, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1526GACUUAUUUAUAUAAAUUU90.280199

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1524-1546TTGACTTATTTATATAAATTTTTAAAUUUAUAUAAAUAAGUCAAGACUUAUUUAUAUAAAUUUUUU-10.34.621


Target Position: 1174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1174CACCGAGGCCCUAGCUUUC66.53661175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4371192CACCGAGGCCCTAGCTTTCGAAAGCTAGGGCCTCGGTG0.050000.009600.620700.500000.983700.75000


Target Position: 1626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1626GAAAAGGGAACUGAACAUU78.369503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301644GAAAAGGGAACTGAACATTAATGTTCAGTTCCCTTTTC0.052100.019400.663800.750001.000001.00000


Target Position: 814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
814GCUGACUAUUCCCGACUUC68.16741100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
270832GCTGACTATTCCCGACTTCGAAGTCGGGAATAGTCAGC0.214000.043500.681000.750001.000001.00000


Target Position: 1375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1375ACACAGAUGUAAAAGACUU82.6442323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3621393ACACAGATGTAAAAGACTTAAGTCTTTTACATCTGTGT0.077000.018300.569000.750001.000001.00000


Target Position: 201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
201CCCACUACUUCAGAAUUUC68.19121096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
445219CCCACTACTTCAGAATTTCGAAATTCTGAAGTAGTGGG0.048700.028600.819000.750001.000001.00000


Target Position: 322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
322UCUUUUGCAGAUAUACACU71.7437877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
451340TCTTTTGCAGATATACACTAGTGTATATCTGCAAAAGA0.364500.020600.517200.500000.967400.75000


Target Position: 1426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1426UACACAUUUUUCAGAUAUA89.3252120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5401444TACACATTTTTCAGATATATATATCTGAAAAATGTGTA0.191900.156300.637900.500001.000001.00000


Target Position: 162, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
162GAGUUGUAGGAUUCUACAU90.0078108

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
160-182GAGAGTTGTAGGATTCTACATTAAUGUAGAAUCCUACAACUCUCGAGUUGUAGGAUUCUACAUUAU20.319.033


Target Position: 1607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1607GUCUCGUGGUAGGACUGUA91.880671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221625GTCTCGTGGTAGGACTGTATACAGTCCTACCACGAGAC0.023900.002700.637900.750000.983700.62500


Target Position: 1115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1115CUGGAAAUCAUCAAGCAAG72.354842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5631133CTGGAAATCATCAAGCAAGCTTGCTTGATGATTTCCAG0.029200.003200.646600.500001.000001.00000


Target Position: 1852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1852ACAGUCUUGUAUUAAGUUG67.84621121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5581870ACAGTCTTGTATTAAGTTGCAACTTAATACAAGACTGT0.020500.004200.560300.500001.000001.00000


Target Position: 1370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1370AGCUAACACAGAUGUAAAA90.85989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361388AGCTAACACAGATGTAAAATTTTACATCTGTGTTAGCT0.050100.019700.853400.750001.000001.00000


Target Position: 655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
655UGUCAUCUACACAGUCAAC71.3404899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
561673TGTCATCTACACAGTCAACGTTGACTGTGTAGATGACA0.477300.222900.560300.500001.000001.00000


Target Position: 308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
308UCCAUUCCUUUGCCUCUUU62.91861352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
395326TCCATTCCTTTGCCTCTTTAAAGAGGCAAAGGAATGGA0.064800.021000.870700.750001.000001.00000


Target Position: 562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
562GGCCGACCUCCUCUUUGUC69.34461018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
289580GGCCGACCTCCTCTTTGTCGACAAAGAGGAGGTCGGCC0.177300.015900.681000.750000.929300.62500


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682UCCCCAGCUGUUUAUGCAU67.77431127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3331700TCCCCAGCTGTTTATGCATATGCATAAACAGCTGGGGA0.168200.012000.715500.750000.994600.75000


Target Position: 1493, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1493CUUGUGUUUCUUUAGUUUU76.2833611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2471511CTTGTGTTTCTTTAGTTTTAAAACTAAAGAAACACAAG0.184400.139900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1491-1513GTCTTGTGTTTCTTTAGTTTTTGAAAACUAAAGAAACACAAGACCUUGUGUUUCUUUAGUUUUUGU4.919.321


Target Position: 290, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
290CUGAAUUGGAAGUGAAUGU73.2549785

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
288-310TGCTGAATTGGAAGTGAATGTCCACAUUCACUUCCAAUUCAGCACUGAAUUGGAAGUGAAUGUCCU20.513.822


Target Position: 1454, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1454CCAAUAUUGUACAGUUUUU85.8019204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5181472CCAATATTGTACAGTTTTTAAAAACTGTACAATATTGG0.056500.002900.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1452-1474GACCAATATTGTACAGTTTTTATAAAAACUGUACAAUAUUGGUCCCAAUAUUGUACAGUUUUUAUU10.3-1.822


Target Position: 964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
964GUCCUGCUAUUGCAUUAUC70.5235943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506982GTCCTGCTATTGCATTATCGATAATGCAATAGCAGGAC0.098300.009600.637900.500000.907601.00000


Target Position: 143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
143UGGGAAAAGAUGGGGAGGA62.79921362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
565161TGGGAAAAGATGGGGAGGATCCTCCCCATCTTTTCCCA0.020800.019600.474100.500001.000001.00000


Target Position: 1457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1457AUAUUGUACAGUUUUUAUU76.1043621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5391475ATATTGTACAGTTTTTATTAATAAAAACTGTACAATAT0.071900.013500.534500.500001.000001.00000


Target Position: 1857, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1857CUUGUAUUAAGUUGUUAAU80.7966397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5141875CTTGTATTAAGTTGTTAATATTAACAACTTAATACAAG0.028600.003100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1855-1877GTCTTGTATTAAGTTGTTAATAAAUUAACAACUUAAUACAAGACCUUGUAUUAAGUUGUUAAUAAU7.26.922


Target Position: 1580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1580CUGUGGCCAAGUUCUUAGU71.0827915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5371598CTGTGGCCAAGTTCTTAGTACTAAGAACTTGGCCACAG0.045600.002300.577600.500001.000001.00000


Target Position: 1727, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1727GUUUUUCCUGUUCUUAAGA78.2891506

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1725-1747ACGTTTTTCCTGTTCTTAAGACGUCUUAAGAACAGGAAAAACGUGUUUUUCCUGUUCUUAAGACGU11.714.332


Target Position: 1430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1430CAUUUUUCAGAUAUAAAAG78.2718509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4551448CATTTTTCAGATATAAAAGCTTTTATATCTGAAAAATG0.249500.045100.517200.500001.000001.00000


Target Position: 243, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
243GUUUUUUAAAUUGCUUUAA77.1754560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
498261GTTTTTTAAATTGCTTTAATTAAAGCAATTTAAAAAAC0.030900.006000.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
241-263TGGTTTTTTAAATTGCTTTAAAAUUAAAGCAAUUUAAAAAACCAGUUUUUUAAAUUGCUUUAAAAU19.7-9.121


Target Position: 1380, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1380GAUGUAAAAGACUUUUUUU89.8901110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3051398GATGTAAAAGACTTTTTTTAAAAAAAGTCTTTTACATC0.100400.022400.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1378-1400CAGATGTAAAAGACTTTTTTTTAAAAAAAAGUCUUUUACAUCUGGAUGUAAAAGACUUUUUUUUAU-5.96.922


Target Position: 1162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1162GUGGAUUUCCAUCACCGAG69.7269989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5591180GTGGATTTCCATCACCGAGCTCGGTGATGGAAATCCAC0.037200.002400.482800.500000.923900.62500


Target Position: 943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
943CCUGCCUGGUAUUGUCAUC67.76821128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486961CCTGCCTGGTATTGTCATCGATGACAATACCAGGCAGG0.086900.003600.663800.750001.000001.00000


Target Position: 962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
962CUGUCCUGCUAUUGCAUUA89.2456121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
358980CTGTCCTGCTATTGCATTATAATGCAATAGCAGGACAG0.081100.009700.750000.750000.907600.87500


Target Position: 1429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1429ACAUUUUUCAGAUAUAAAA87.9817142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2221447ACATTTTTCAGATATAAAATTTTATATCTGAAAAATGT0.279300.059600.706900.750001.000001.00000


Target Position: 643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
643CAAGGCAGUCCAUGUCAUC73.7619750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
579661CAAGGCAGTCCATGTCATCGATGACATGGACTGCCTTG0.353900.001700.465500.500000.956500.62500


Target Position: 807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
807CCCUCCUGCUGACUAUUCC63.23491343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
480825CCCTCCTGCTGACTATTCCGGAATAGTCAGCAGGAGGG0.147300.057800.620700.500001.000001.00000


Target Position: 734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
734CACGCCACCAACAGUCAGA80.5372406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
508752CACGCCACCAACAGTCAGATCTGACTGTTGGTGGCGTG0.029100.006400.569000.500001.000001.00000


Target Position: 1880, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1880GUACAUGUUAAACUUAAAA89.95109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4441898GTACATGTTAAACTTAAAATTTTAAGTTTAACATGTAC0.431000.005300.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1878-1900AAGTACATGTTAAACTTAAAAAAUUUUAAGUUUAACAUGUACUUGUACAUGUUAAACUUAAAAAAU4.920.422


Target Position: 611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
611GUGGCAAACUGGUACUUUG79.6671451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
489629GTGGCAAACTGGTACTTTGCAAAGTACCAGTTTGCCAC0.052200.006800.646600.500001.000001.00000


Target Position: 1841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1841ACCUACAGUGUACAGUCUU72.992805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921859ACCTACAGTGTACAGTCTTAAGACTGTACACTGTAGGT0.061100.003400.715500.750001.000001.00000


Target Position: 1455, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1455CAAUAUUGUACAGUUUUUA90.67195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581473CAATATTGTACAGTTTTTATAAAAACTGTACAATATTG0.064700.004500.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1453-1475ACCAATATTGTACAGTTTTTATTUAAAAACUGUACAAUAUUGGUCAAUAUUGUACAGUUUUUAUUU3.2-1.822


Target Position: 436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
436CCUGCCCACCAUCUACUCC59.18021525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
568454CCTGCCCACCATCTACTCCGGAGTAGATGGTGGGCAGG0.367000.207300.474100.500001.000001.00000


Target Position: 1541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1541AUUUUUUUUGUUUCAUAUU68.93941044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051559ATTTTTTTTGTTTCATATTAATATGAAACAAAAAAAAT0.155200.098000.500000.500001.000001.00000


Target Position: 1521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1521UAAUUGACUUAUUUAUAUA94.956434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5351539TAATTGACTTATTTATATATATATAAATAAGTCAATTA0.197700.027600.491400.500001.000001.00000


Target Position: 1487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1487UUUUGUCUUGUGUUUCUUU70.1792966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031505TTTTGTCTTGTGTTTCTTTAAAGAAACACAAGACAAAA0.478500.076700.500000.500001.000001.00000


Target Position: 1208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1208AACCCCAUCCUCUAUGCUU72.3971839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4661226AACCCCATCCTCTATGCTTAAGCATAGAGGATGGGGTT0.172500.119200.508600.500001.000001.00000


Target Position: 1686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1686CAGCUGUUUAUGCAUAGAU85.1831227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3341704CAGCTGTTTATGCATAGATATCTATGCATAAACAGCTG0.156300.011800.603400.750000.994600.75000


Target Position: 1854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1854AGUCUUGUAUUAAGUUGUU80.8912390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4891872AGTCTTGTATTAAGTTGTTAACAACTTAATACAAGACT0.060600.003500.560300.750001.000001.00000


Target Position: 649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
649AGUCCAUGUCAUCUACACA94.130140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
522667AGTCCATGTCATCTACACATGTGTAGATGACATGGACT0.451400.049400.500000.500000.956500.62500


Target Position: 113, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
113CUACCAAAGAAGGAUAUAA92.38164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
376131CTACCAAAGAAGGATATAATTATATCCTTCTTTGGTAG0.192900.009100.637900.750000.962000.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
111-133TTCTACCAAAGAAGGATATAATGUUAUAUCCUUCUUUGGUAGAACUACCAAAGAAGGAUAUAAUGU16.720.022


Target Position: 966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
966CCUGCUAUUGCAUUAUCAU86.964172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
347984CCTGCTATTGCATTATCATATGATAATGCAATAGCAGG0.252100.010600.689701.000000.907600.75000


Target Position: 1071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1071GGCUGCCUUACUACAUUGG62.81881360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5811089GGCTGCCTTACTACATTGGCCAATGTAGTAAGGCAGCC0.016000.009500.655200.500000.994600.87500


Target Position: 94, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
94AAGAAUUUUGUAAUUGGUU72.5098832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
549112AAGAATTTTGTAATTGGTTAACCAATTACAAAATTCTT0.021900.011700.491400.500001.000001.00000


Target Position: 568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
568CCUCCUCUUUGUCAUCACG69.8856978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
521586CCTCCTCTTTGTCATCACGCGTGATGACAAAGAGGAGG0.076000.046700.569000.500001.000001.00000


Target Position: 864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
864GAUAUAUCUGUGACCGCUU85.8099203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
555882GATATATCTGTGACCGCTTAAGCGGTCACAGATATATC0.117900.001700.543100.750001.000001.00000


Target Position: 1184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1184CUAGCUUUCUUCCACUGUU81.953345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4401202CTAGCTTTCTTCCACTGTTAACAGTGGAAGAAAGCTAG0.196600.026200.525900.750000.983700.62500


Target Position: 1665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1665CGUAAAGCUAGAAAUGAUC73.3081783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3181683CGTAAAGCTAGAAATGATCGATCATTTCTAGCTTTACG0.546900.082400.594800.750001.000001.00000


Target Position: 1471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1471UUAUUGCUUGUUGGAUUUU58.93781535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5141489TTATTGCTTGTTGGATTTTAAAATCCAACAAGCAATAA0.165100.037100.534500.500001.000001.00000


Target Position: 1618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1618GGACUGUAGAAAAGGGAAC69.9212976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5561636GGACTGTAGAAAAGGGAACGTTCCCTTTTCTACAGTCC0.125500.001700.724100.750001.000001.00000


Target Position: 372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
372GGGACUAUGACUCCAUGAA93.377149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
341390GGGACTATGACTCCATGAATTCATGGAGTCATAGTCCC0.084900.011100.819001.000000.913000.62500


Target Position: 407, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
407GAAGAAAAUGCUAAUUUCA94.469537

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
405-427GTGAAGAAAATGCTAATTTCAATUGAAAUUAGCAUUUUCUUCACGAAGAAAAUGCUAAUUUCAAUU2.15.521


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675UCUACAGCAGUGUCCUCAU76.3402610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
554693TCTACAGCAGTGTCCTCATATGAGGACACTGCTGTAGA0.018400.010700.569000.750001.000001.00000


Target Position: 60, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
60CCCUCAGCGUCUCAGUGCC62.89181354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
54378CCCTCAGCGTCTCAGTGCCGGCACTGAGACGCTGAGGG0.186700.024900.491400.500000.907600.62500


Target Position: 1465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1465CAGUUUUUAUUGCUUGUUG73.6808753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5481483CAGTTTTTATTGCTTGTTGCAACAAGCAATAAAAACTG0.076300.014900.637900.500001.000001.00000


Target Position: 444, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
444CCAUCUACUCCAUCAUCUU88.8474129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
121462CCATCTACTCCATCATCTTAAGATGATGGAGTAGATGG0.595600.280600.706901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
442-464CACCATCTACTCCATCATCTTCTAAGAUGAUGGAGUAGAUGGUGCCAUCUACUCCAUCAUCUUCUU20.420.322


Target Position: 194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
194CCCUUAGCCCACUACUUCA87.7935150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
323212CCCTTAGCCCACTACTTCATGAAGTAGTGGGCTAAGGG0.090900.065600.767200.750001.000001.00000


Target Position: 1806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1806GGUUUUUCAGUUUUCAGGA84.7319237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5531824GGTTTTTCAGTTTTCAGGATCCTGAAAACTGAAAAACC0.174500.040200.482800.750001.000001.00000


Target Position: 1502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1502CUUUAGUUUUUGUGAAGUU81.7548357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5531520CTTTAGTTTTTGTGAAGTTAACTTCACAAAAACTAAAG0.018500.012300.491400.750001.000001.00000


Target Position: 1175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1175ACCGAGGCCCUAGCUUUCU56.72541616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011193ACCGAGGCCCTAGCTTTCTAGAAAGCTAGGGCCTCGGT0.053500.009400.629300.500001.000001.00000


Target Position: 1867, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1867GUUGUUAAUAAAAGUACAU81.7528358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411885GTTGTTAATAAAAGTACATATGTACTTTTATTAACAAC0.032800.015300.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1865-1887AAGTTGTTAATAAAAGTACATGTAUGUACUUUUAUUAACAACUUGUUGUUAAUAAAAGUACAUGUU19.07.222


Target Position: 1225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1225UUUCCUUGGAGCCAAAUUU61.88131407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5271243TTTCCTTGGAGCCAAATTTAAATTTGGCTCCAAGGAAA0.493400.004800.500000.500001.000001.00000


Target Position: 1779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1779CAAAGCCCAAAGUGGUAUA84.4036251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3811797CAAAGCCCAAAGTGGTATATATACCACTTTGGGCTTTG0.083900.008200.603400.750000.940201.00000


Target Position: 1182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1182CCCUAGCUUUCUUCCACUG68.71961059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2711200CCCTAGCTTTCTTCCACTGCAGTGGAAGAAAGCTAGGG0.186600.018000.706900.750000.983700.62500


Target Position: 1679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679UGAUCCCCAGCUGUUUAUG55.5981646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001697TGATCCCCAGCTGTTTATGCATAAACAGCTGGGGATCA0.030100.009100.569000.500001.000001.00000


Target Position: 981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
981UCAUCUCCAAGCUGUCACA79.8214442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483999TCATCTCCAAGCTGTCACATGTGACAGCTTGGAGATGA0.624000.540100.517200.500001.000001.00000


Target Position: 1804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1804CUGGUUUUUCAGUUUUCAG70.335956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5091822CTGGTTTTTCAGTTTTCAGCTGAAAACTGAAAAACCAG0.106600.023100.500000.500000.956500.62500


Target Position: 181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
181UAAUUCUCUUGUGCCCUUA74.9633685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
512199TAATTCTCTTGTGCCCTTATAAGGGCACAAGAGAATTA0.160200.050600.500000.500001.000001.00000


Target Position: 136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
136GUCACUAUGGGAAAAGAUG71.297901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
323154GTCACTATGGGAAAAGATGCATCTTTTCCCATAGTGAC0.164200.027900.663800.500001.000001.00000


Target Position: 1758, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1758GUAGAAGAUGGCACUUAUA96.538323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431776GTAGAAGATGGCACTTATATATAAGTGCCATCTTCTAC0.047800.002100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1756-1778CTGTAGAAGATGGCACTTATAACUAUAAGUGCCAUCUUCUACAGGUAGAAGAUGGCACUUAUAACU11.620.232


Target Position: 192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
192UGCCCUUAGCCCACUACUU69.35291017

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
308210TGCCCTTAGCCCACTACTTAAGTAGTGGGCTAAGGGCA0.098500.069000.715500.750000.945700.62500


Target Position: 1610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1610UCGUGGUAGGACUGUAGAA84.4106250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421628TCGTGGTAGGACTGTAGAATTCTACAGTCCTACCACGA0.049600.007200.620700.750001.000001.00000


Target Position: 110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
110GUUCUACCAAAGAAGGAUA89.4894116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484128GTTCTACCAAAGAAGGATATATCCTTCTTTGGTAGAAC0.170800.003700.603400.750000.956500.62500


Target Position: 1589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1589AGUUCUUAGUUGCUGUAUG74.7859689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5641607AGTTCTTAGTTGCTGTATGCATACAGCAACTAAGAACT0.016500.005000.551700.500001.000001.00000


Target Position: 732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
732UCCACGCCACCAACAGUCA70.5424942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
564750TCCACGCCACCAACAGTCATGACTGTTGGTGGCGTGGA0.134300.096700.646600.500001.000001.00000


Target Position: 576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
576UUGUCAUCACGCUUCCCUU72.3508843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473594TTGTCATCACGCTTCCCTTAAGGGAAGCGTGATGACAA0.046900.019300.508600.500001.000001.00000


Target Position: 1415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1415UUUUUUUAAGUUACACAUU65.52451223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5421433TTTTTTTAAGTTACACATTAATGTGTAACTTAAAAAAA0.209900.081700.491400.500001.000001.00000


Target Position: 301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
301GUGAAUGUCCAUUCCUUUG69.8155983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497319GTGAATGTCCATTCCTTTGCAAAGGAATGGACATTCAC0.206700.014500.646600.500000.972800.75000


Target Position: 1391, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1391CUUUUUUUUAUACGAUAAA81.366370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2391409CTTTTTTTTATACGATAAATTTATCGTATAAAAAAAAG0.258200.102400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1389-1411GACTTTTTTTTATACGATAAATAUUUAUCGUAUAAAAAAAAGUCCUUUUUUUUAUACGAUAAAUAU16.5-11.332


Target Position: 1035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1035CCACAGUCAUCCUCAUCCU83.3395298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111053CCACAGTCATCCTCATCCTAGGATGAGGATGACTGTGG0.491600.046700.500000.750001.000001.00000


Target Position: 330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
330AGAUAUACACUUCAGAUAA97.143616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
265348AGATATACACTTCAGATAATTATCTGAAGTGTATATCT0.367100.261900.689700.750001.000001.00000


Target Position: 1506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1506AGUUUUUGUGAAGUUUAAU76.6874589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5631524AGTTTTTGTGAAGTTTAATATTAAACTTCACAAAAACT0.016800.007900.698300.750001.000001.00000


Target Position: 1802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1802UGCUGGUUUUUCAGUUUUC62.33861383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5831820TGCTGGTTTTTCAGTTTTCGAAAACTGAAAAACCAGCA0.080300.005900.681000.500000.923900.75000


Target Position: 1881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1881UACAUGUUAAACUUAAAAA82.1281340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841899TACATGTTAAACTTAAAAATTTTTAAGTTTAACATGTA0.435500.038300.681000.500001.000001.00000


Target Position: 614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
614GCAAACUGGUACUUUGGGA82.8316315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
560632GCAAACTGGTACTTTGGGATCCCAAAGTACCAGTTTGC0.017100.004200.482800.750001.000001.00000


Target Position: 1760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1760AGAAGAUGGCACUUAUAAC80.2787420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5511778AGAAGATGGCACTTATAACGTTATAAGTGCCATCTTCT0.272600.001800.577600.500001.000001.00000


Target Position: 1749, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1749GAUUUUGCUGUAGAAGAUG71.645883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5851767GATTTTGCTGTAGAAGATGCATCTTCTACAGCAAAATC0.011900.005200.525900.500001.000001.00000


Target Position: 1181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1181GCCCUAGCUUUCUUCCACU80.0629428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2571199GCCCTAGCTTTCTTCCACTAGTGGAAGAAAGCTAGGGC0.266800.021200.793100.750000.989100.62500


Target Position: 1683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1683CCCCAGCUGUUUAUGCAUA86.0003195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3381701CCCCAGCTGTTTATGCATATATGCATAAACAGCTGGGG0.159200.011400.948301.000000.994600.87500


Target Position: 237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
237GAAUUGGUUUUUUAAAUUG76.8272581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501255GAATTGGTTTTTTAAATTGCAATTTAAAAAACCAATTC0.056100.003200.525900.500001.000001.00000


Target Position: 1528, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1528CUUAUUUAUAUAAAUUUUU77.14563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2421546CTTATTTATATAAATTTTTAAAAATTTATATAAATAAG0.242600.145600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1526-1548GACTTATTTATATAAATTTTTTTAAAAAUUUAUAUAAAUAAGUCCUUAUUUAUAUAAAUUUUUUUU-12.0-7.522


Target Position: 1513, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1513GUGAAGUUUAAUUGACUUA87.8178149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5381531GTGAAGTTTAATTGACTTATAAGTCAATTAAACTTCAC0.068600.002300.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1511-1533TTGTGAAGTTTAATTGACTTATTUAAGUCAAUUAAACUUCACAAGUGAAGUUUAAUUGACUUAUUU19.219.222


Target Position: 1381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1381AUGUAAAAGACUUUUUUUU72.5984825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4001399ATGTAAAAGACTTTTTTTTAAAAAAAAGTCTTTTACAT0.110200.019400.655200.500001.000001.00000


Target Position: 1156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1156GCACAAGUGGAUUUCCAUC74.0938727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5841174GCACAAGTGGATTTCCATCGATGGAAATCCACTTGTGC0.535100.001100.672400.750000.923900.75000


Target Position: 1645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1645CCAGAGCGUGUAGUGAAUC66.09181195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4351663CCAGAGCGTGTAGTGAATCGATTCACTACACGCTCTGG0.050700.006800.663800.750001.000001.00000


Target Position: 806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
806GCCCUCCUGCUGACUAUUC63.33531337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
274824GCCCTCCTGCTGACTATTCGAATAGTCAGCAGGAGGGC0.115100.057800.827600.750000.994600.62500


Target Position: 945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
945UGCCUGGUAUUGUCAUCCU71.5132891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
485963TGCCTGGTATTGTCATCCTAGGATGACAATACCAGGCA0.081700.003600.508600.500000.978300.62500


Target Position: 1447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1447AGACUGACCAAUAUUGUAC72.2659849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5491465AGACTGACCAATATTGTACGTACAATATTGGTCAGTCT0.021200.001800.543100.500000.989100.75000


Target Position: 236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
236UGAAUUGGUUUUUUAAAUU74.063731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
529254TGAATTGGTTTTTTAAATTAATTTAAAAAACCAATTCA0.122200.002600.715500.750001.000001.00000


Target Position: 1104, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1104CCUUCAUCCUCCUGGAAAU85.3556218

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2110419CCTTCATCCTCCTGGAAAT1/1/0/0100.00CXCR4NM_001008540.1+NM_003467.21+1NANANA2:136872692..136872710(-)00CXCR4(0.002)


Target Position: 1339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1339CACUGAGUCUGAGUCUUCA95.377329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4261357CACTGAGTCTGAGTCTTCATGAAGACTCAGACTCAGTG0.079400.006100.569000.500001.000001.00000


Target Position: 988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
988CAAGCUGUCACACUCCAAG74.5173701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5091006CAAGCTGTCACACTCCAAGCTTGGAGTGTGACAGCTTG0.074000.032400.508600.500000.907600.62500


Target Position: 1453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1453ACCAAUAUUGUACAGUUUU72.1932852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5671471ACCAATATTGTACAGTTTTAAAACTGTACAATATTGGT0.028600.001500.853400.750001.000001.00000


Target Position: 1646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1646CAGAGCGUGUAGUGAAUCA92.516959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5701664CAGAGCGTGTAGTGAATCATGATTCACTACACGCTCTG0.055900.003800.560300.500001.000001.00000


Target Position: 74, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
74GUGCCCUUUUGUUCUAAAC66.52981176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
46892GTGCCCTTTTGTTCTAAACGTTTAGAACAAAAGGGCAC0.043000.019800.646600.500001.000001.00000


Target Position: 79, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
79CUUUUGUUCUAAACAAAGA83.8736269

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
77-99CCCTTTTGTTCTAAACAAAGAATUCUUUGUUUAGAACAAAAGGGCUUUUGUUCUAAACAAAGAAUU10.35.622


Target Position: 1337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1337UCCACUGAGUCUGAGUCUU67.23721153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3901355TCCACTGAGTCTGAGTCTTAAGACTCAGACTCAGTGGA0.066100.010500.732800.750001.000001.00000


Target Position: 307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
307GUCCAUUCCUUUGCCUCUU69.49981006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
370325GTCCATTCCTTTGCCTCTTAAGAGGCAAAGGAATGGAC0.073100.013600.681000.750001.000001.00000


Target Position: 1778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1778CCAAAGCCCAAAGUGGUAU68.89921046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3881796CCAAAGCCCAAAGTGGTATATACCACTTTGGGCTTTGG0.071000.007700.801701.000000.940200.87500


Target Position: 1376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1376CACAGAUGUAAAAGACUUU86.2845187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3341394CACAGATGTAAAAGACTTTAAAGTCTTTTACATCTGTG0.086800.017800.793100.750001.000001.00000


Target Position: 661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
661CUACACAGUCAACCUCUAC71.5275890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
532679CTACACAGTCAACCTCTACGTAGAGGTTGACTGTGTAG0.758000.338900.491400.500000.962000.62500


Target Position: 1747, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1747GUGAUUUUGCUGUAGAAGA84.4338247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4461765GTGATTTTGCTGTAGAAGATCTTCTACAGCAAAATCAC0.048600.019300.569000.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1745-1767ACGTGATTTTGCTGTAGAAGATGUCUUCUACAGCAAAAUCACGUGUGAUUUUGCUGUAGAAGAUGU18.97.422


Target Position: 1725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1725ACGUUUUUCCUGUUCUUAA85.2735222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031743ACGTTTTTCCTGTTCTTAATTAAGAACAGGAAAAACGT0.029900.007100.741400.750001.000001.00000


Target Position: 1853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1853CAGUCUUGUAUUAAGUUGU80.3936414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821871CAGTCTTGTATTAAGTTGTACAACTTAATACAAGACTG0.065100.003700.577600.500001.000001.00000


Target Position: 1609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1609CUCGUGGUAGGACUGUAGA77.8269534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791627CTCGTGGTAGGACTGTAGATCTACAGTCCTACCACGAG0.037700.006600.586200.500001.000001.00000


Target Position: 456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
456UCAUCUUCUUAACUGGCAU75.1746669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
349474TCATCTTCTTAACTGGCATATGCCAGTTAAGAAGATGA0.116900.037500.569000.750001.000001.00000


Target Position: 1860, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1860GUAUUAAGUUGUUAAUAAA103.9111

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1858-1880TTGTATTAAGTTGTTAATAAAAGUUUAUUAACAACUUAAUACAAGUAUUAAGUUGUUAAUAAAAGU-7.5-2.322


Target Position: 81, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
81UUUGUUCUAAACAAAGAAU67.83441124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
57899TTTGTTCTAAACAAAGAATATTCTTTGTTTAGAACAAA0.013600.003900.491400.500000.945700.62500


Target Position: 328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
328GCAGAUAUACACUUCAGAU96.823219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
162346GCAGATATACACTTCAGATATCTGAAGTGTATATCTGC0.273400.061000.672401.000001.000001.00000


Target Position: 240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
240UUGGUUUUUUAAAUUGCUU62.88171355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
515258TTGGTTTTTTAAATTGCTTAAGCAATTTAAAAAACCAA0.049000.003000.508600.500001.000001.00000


Target Position: 571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
571CCUCUUUGUCAUCACGCUU78.1382516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
365589CCTCTTTGTCATCACGCTTAAGCGTGATGACAAAGAGG0.074600.053100.706901.000001.000001.00000


Target Position: 1483, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1483GGAUUUUUGUCUUGUGUUU85.5258212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1161501GGATTTTTGTCTTGTGTTTAAACACAAGACAAAAATCC0.291600.076300.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1481-1503TTGGATTTTTGTCTTGTGTTTCTAAACACAAGACAAAAAUCCAAGGAUUUUUGUCUUGUGUUUCUU19.30.421


Target Position: 453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
453CCAUCAUCUUCUUAACUGG75.9477630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
524471CCATCATCTTCTTAACTGGCCAGTTAAGAAGATGATGG0.155600.053900.500000.500001.000001.00000


Target Position: 1529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1529UUAUUUAUAUAAAUUUUUU79.4801457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4141547TTATTTATATAAATTTTTTAAAAAATTTATATAAATAA0.228700.152000.534500.500001.000001.00000


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768UGGCUGAAAAGGUGGUCUA78.3695502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
522786TGGCTGAAAAGGTGGTCTATAGACCACCTTTTCAGCCA0.056000.002700.672400.750001.000001.00000


Target Position: 256, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
256CUUUAAAAAUUUUUUUUAA90.1175107

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
254-276TGCTTTAAAAATTTTTTTTAACTUUAAAAAAAAUUUUUAAAGCACUUUAAAAAUUUUUUUUAACUU-9.1-9.111


Target Position: 89, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
89AAACAAAGAAUUUUGUAAU80.4965410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
534107AAACAAAGAATTTTGTAATATTACAAAATTCTTTGTTT0.128800.003400.491400.500000.945700.62500


Target Position: 913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
913CCAGUUUCAGCACAUCAUG70.8946924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
322931CCAGTTTCAGCACATCATGCATGATGTGCTGAAACTGG0.100500.012900.689700.750001.000001.00000


Target Position: 72, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
72CAGUGCCCUUUUGUUCUAA86.136191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
32290CAGTGCCCTTTTGTTCTAATTAGAACAAAAGGGCACTG0.091100.043900.750000.750001.000001.00000


Target Position: 805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
805UGCCCUCCUGCUGACUAUU65.08251246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
284823TGCCCTCCTGCTGACTATTAATAGTCAGCAGGAGGGCA0.110700.037400.844800.750000.923900.62500


Target Position: 1613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1613UGGUAGGACUGUAGAAAAG70.9218920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811631TGGTAGGACTGTAGAAAAGCTTTTCTACAGTCCTACCA0.098700.004500.706900.500001.000001.00000


Target Position: 1378, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1378CAGAUGUAAAAGACUUUUU81.9055346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2881396CAGATGTAAAAGACTTTTTAAAAAGTCTTTTACATCTG0.109600.018700.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1376-1398CACAGATGTAAAAGACTTTTTTTAAAAAGUCUUUUACAUCUGUGCAGAUGUAAAAGACUUUUUUUU13.320.322


Target Position: 200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
200GCCCACUACUUCAGAAUUU79.8963436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
441218GCCCACTACTTCAGAATTTAAATTCTGAAGTAGTGGGC0.049700.035401.000001.000001.000001.00000


Target Position: 1501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1501UCUUUAGUUUUUGUGAAGU63.22041344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5441519TCTTTAGTTTTTGTGAAGTACTTCACAAAAACTAAAGA0.020100.014000.517200.500001.000001.00000


Target Position: 30, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
30AGAGGAGUUAGCCAAGAUG72.451836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
50448AGAGGAGTTAGCCAAGATGCATCTTGGCTAACTCCTCT0.140200.003200.569000.500001.000001.00000


Target Position: 435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
435UCCUGCCCACCAUCUACUC53.09611726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
510453TCCTGCCCACCATCTACTCGAGTAGATGGTGGGCAGGA0.365100.214600.560300.500001.000001.00000


Target Position: 1394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1394UUUUUUAUACGAUAAAUAA83.7689276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5821412TTTTTTATACGATAAATAATTATTTATCGTATAAAAAA0.161700.006600.465500.500001.000001.00000


Target Position: 1342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1342UGAGUCUGAGUCUUCAAGU70.8385929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5271360TGAGTCTGAGTCTTCAAGTACTTGAAGACTCAGACTCA0.481400.004300.517200.500000.972800.75000


Target Position: 916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
916GUUUCAGCACAUCAUGGUU83.0999308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
582934GTTTCAGCACATCATGGTTAACCATGATGTGCTGAAAC0.012200.006700.500000.750001.000001.00000


Target Position: 1032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1032AGACCACAGUCAUCCUCAU88.3243138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3551050AGACCACAGTCATCCTCATATGAGGATGACTGTGGTCT0.523300.043400.569000.750000.934800.62500


Target Position: 559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
559AGUGGCCGACCUCCUCUUU68.42691081

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
224577AGTGGCCGACCTCCTCTTTAAAGAGGAGGTCGGCCACT0.538100.027600.706900.750000.983700.87500


Target Position: 249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
249UAAAUUGCUUUAAAAAUUU71.5275889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
585267TAAATTGCTTTAAAAATTTAAATTTTTAAAGCAATTTA0.448900.022300.534500.500001.000001.00000


Target Position: 300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
300AGUGAAUGUCCAUUCCUUU83.6706281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
344318AGTGAATGTCCATTCCTTTAAAGGAATGGACATTCACT0.120500.010900.706900.750000.972800.87500


Target Position: 1644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1644UCCAGAGCGUGUAGUGAAU73.6686756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3301662TCCAGAGCGTGTAGTGAATATTCACTACACGCTCTGGA0.861800.012100.862100.750001.000001.00000


Target Position: 133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
133GAAGUCACUAUGGGAAAAG68.0561109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
460151GAAGTCACTATGGGAAAAGCTTTTCCCATAGTGACTTC0.793700.038500.534500.500001.000001.00000


Target Position: 1179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1179AGGCCCUAGCUUUCUUCCA72.3389844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5181197AGGCCCTAGCTTTCTTCCATGGAAGAAAGCTAGGGCCT0.158000.010900.500000.500001.000001.00000


Target Position: 1470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1470UUUAUUGCUUGUUGGAUUU64.06961300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5061488TTTATTGCTTGTTGGATTTAAATCCAACAAGCAATAAA0.160800.035600.500000.500001.000001.00000


Target Position: 329, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
329CAGAUAUACACUUCAGAUA96.753120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
291347CAGATATACACTTCAGATATATCTGAAGTGTATATCTG0.296300.101400.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
327-349TGCAGATATACACTTCAGATAACUAUCUGAAGUGUAUAUCUGCACAGAUAUACACUUCAGAUAACU20.48.232


Target Position: 314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
314CCUUUGCCUCUUUUGCAGA78.1898513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484332CCTTTGCCTCTTTTGCAGATCTGCAAAAGAGGCAAAGG0.036700.006000.620700.750000.923900.75000


Target Position: 1554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1554CAUAUUGAUGUGUGUCUAG79.8834438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5831572CATATTGATGTGTGTCTAGCTAGACACACATCAATATG0.012100.003000.482800.500001.000001.00000


Target Position: 1531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1531AUUUAUAUAAAUUUUUUUU77.1223564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741549ATTTATATAAATTTTTTTTAAAAAAAATTTATATAAAT0.192400.114300.508600.500001.000001.00000


Target Position: 385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
385CAUGAAGGAACCCUGUUUC69.05991038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
584403CATGAAGGAACCCTGTTTCGAAACAGGGTTCCTTCATG0.071200.001200.482800.500000.994601.00000


Target Position: 1734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1734CUGUUCUUAAGACGUGAUU69.9457974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951752CTGTTCTTAAGACGTGATTAATCACGTCTTAAGAACAG0.044400.003400.775900.750001.000001.00000


Target Position: 68, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
68GUCUCAGUGCCCUUUUGUU82.6747321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
25186GTCTCAGTGCCCTTTTGTTAACAAAAGGGCACTGAGAC0.129100.049400.672400.750001.000001.00000


Target Position: 1025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1025GCCCUCAAGACCACAGUCA79.7436447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3721043GCCCTCAAGACCACAGTCATGACTGTGGTCTTGAGGGC0.072500.012700.775900.750000.934800.62500


Target Position: 1495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1495UGUGUUUCUUUAGUUUUUG59.27761522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3661513TGTGTTTCTTTAGTTTTTGCAAAAACTAAAGAAACACA0.144400.103800.560300.500001.000001.00000


Target Position: 801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
801UCCCUGCCCUCCUGCUGAC53.02111729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
550819TCCCTGCCCTCCTGCTGACGTCAGCAGGAGGGCAGGGA0.082400.031100.551700.500000.913000.62500


Target Position: 1871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1871UUAAUAAAAGUACAUGUUA79.262461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5251889TTAATAAAAGTACATGTTATAACATGTACTTTTATTAA0.026200.018400.500000.500001.000001.00000


Target Position: 1690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1690UGUUUAUGCAUAGAUAAUC63.97361307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381708TGTTTATGCATAGATAATCGATTATCTATGCATAAACA0.315500.097400.525900.500001.000001.00000


Target Position: 1515, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1515GAAGUUUAAUUGACUUAUU90.1603105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121533GAAGTTTAATTGACTTATTAATAAGTCAATTAAACTTC0.057200.007800.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1513-1535GTGAAGTTTAATTGACTTATTTAAAUAAGUCAAUUAAACUUCACGAAGUUUAAUUGACUUAUUUAU14.54.922


Target Position: 398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
398UGUUUCCGUGAAGAAAAUG55.81741640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
503416TGTTTCCGTGAAGAAAATGCATTTTCTTCACGGAAACA0.151200.003200.551700.500000.945700.62500


Target Position: 703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
703CAUCAGUCUGGACCGCUAC70.4233951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
572721CATCAGTCTGGACCGCTACGTAGCGGTCCAGACTGATG0.031800.013100.474100.500000.913000.87500


Target Position: 1524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1524UUGACUUAUUUAUAUAAAU77.6911540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771542TTGACTTATTTATATAAATATTTATATAAATAAGTCAA0.209300.036600.637900.500001.000001.00000


Target Position: 251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
251AAUUGCUUUAAAAAUUUUU69.46991008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
567269AATTGCTTTAAAAATTTTTAAAAATTTTTAAAGCAATT0.406500.028400.508600.500001.000001.00000


Target Position: 477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
477UGGGCAAUGGAUUGGUCAU72.49833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
559495TGGGCAATGGATTGGTCATATGACCAATCCATTGCCCA0.040100.001700.689700.750001.000001.00000


Target Position: 1744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1744GACGUGAUUUUGCUGUAGA89.5452114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431762GACGTGATTTTGCTGTAGATCTACAGCAAAATCACGTC0.057500.003200.594800.500001.000001.00000


Target Position: 1585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1585GCCAAGUUCUUAGUUGCUG65.00231248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301603GCCAAGTTCTTAGTTGCTGCAGCAACTAAGAACTTGGC0.021900.004900.715500.750001.000001.00000


Target Position: 440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
440CCCACCAUCUACUCCAUCA86.8088174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
283458CCCACCATCTACTCCATCATGATGGAGTAGATGGTGGG0.572200.296500.767200.750001.000001.00000


Target Position: 1346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1346UCUGAGUCUUCAAGUUUUC60.53351472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5781364TCTGAGTCTTCAAGTTTTCGAAAACTTGAAGACTCAGA0.376600.015600.551700.500000.972800.62500


Target Position: 1890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1890AACUUAAAAAAAAAAAAAA82.9333312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3881908AACTTAAAAAAAAAAAAAATTTTTTTTTTTTTTAAGTT0.992700.414000.646600.500001.000001.00000


Target Position: 950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
950GGUAUUGUCAUCCUGUCCU78.1921512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484968GGTATTGTCATCCTGTCCTAGGACAGGATGACAATACC0.082100.009900.508600.750001.000001.00000


Target Position: 198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
198UAGCCCACUACUUCAGAAU70.2275963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
367216TAGCCCACTACTTCAGAATATTCTGAAGTAGTGGGCTA0.073600.042500.663800.500001.000001.00000


Target Position: 802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
802CCCUGCCCUCCUGCUGACU59.75411502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
338820CCCTGCCCTCCTGCTGACTAGTCAGCAGGAGGGCAGGG0.084300.033200.784500.750000.923900.62500


Target Position: 186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
186CUCUUGUGCCCUUAGCCCA77.4877549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
576204CTCTTGTGCCCTTAGCCCATGGGCTAAGGGCACAAGAG0.367800.061000.465500.500000.918500.62500


Target Position: 1814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1814AGUUUUCAGGAGUGGGUUG64.54751270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5641832AGTTTTCAGGAGTGGGTTGCAACCCACTCCTGAAAACT0.053200.001500.560300.500001.000001.00000


Target Position: 1599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1599UGCUGUAUGUCUCGUGGUA84.4719246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4561617TGCTGTATGTCTCGTGGTATACCACGAGACATACAGCA0.046800.005700.672400.750001.000001.00000


Target Position: 1286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1286UCCAGCCUCAAGAUCCUCU61.43341432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5321304TCCAGCCTCAAGATCCTCTAGAGGATCTTGAGGCTGGA0.030100.002500.646600.500001.000001.00000


Target Position: 41, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
41CCAAGAUGUGACUUUGAAA97.534213

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
39-61AGCCAAGATGTGACTTTGAAACCUUUCAAAGUCACAUCUUGGCUCCAAGAUGUGACUUUGAAACCU12.218.123


Target Position: 1213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1213CAUCCUCUAUGCUUUCCUU89.4396119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521231CATCCTCTATGCTTTCCTTAAGGAAAGCATAGAGGATG0.073300.034100.517200.750001.000001.00000


Target Position: 1622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1622UGUAGAAAAGGGAACUGAA89.6681111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4331640TGTAGAAAAGGGAACTGAATTCAGTTCCCTTTTCTACA0.073400.011600.534500.750001.000001.00000


Target Position: 323, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
323CUUUUGCAGAUAUACACUU78.1157517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497341CTTTTGCAGATATACACTTAAGTGTATATCTGCAAAAG0.312500.021700.500000.750000.967400.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
321-343CTCTTTTGCAGATATACACTTCAAAGUGUAUAUCUGCAAAAGAGCUUUUGCAGAUAUACACUUCAU19.020.022


Target Position: 1527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1527ACUUAUUUAUAUAAAUUUU83.9601265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2961545ACTTATTTATATAAATTTTAAAATTTATATAAATAAGT0.263300.114300.706900.750001.000001.00000


Target Position: 954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
954UUGUCAUCCUGUCCUGCUA79.1364469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
571972TTGTCATCCTGTCCTGCTATAGCAGGACAGGATGACAA0.106700.003400.474100.500001.000001.00000


Target Position: 1491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1491GUCUUGUGUUUCUUUAGUU85.5373210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1771509GTCTTGTGTTTCTTTAGTTAACTAAAGAAACACAAGAC0.197200.059100.672400.750001.000001.00000


Target Position: 1143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1143UUGAGAACACUGUGCACAA84.1443261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451161TTGAGAACACTGTGCACAATTGTGCACAGTGTTCTCAA0.019600.006000.500000.500001.000001.00000


Target Position: 1322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1322GGACAUUCAUCUGUUUCCA90.139106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4491340GGACATTCATCTGTTTCCATGGAAACAGATGAATGTCC0.216500.028600.525900.750000.983700.75000


Target Position: 1678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1678AUGAUCCCCAGCUGUUUAU65.72321213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5421696ATGATCCCCAGCTGTTTATATAAACAGCTGGGGATCAT0.020300.009300.612100.500001.000001.00000


Target Position: 1886, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1886GUUAAACUUAAAAAAAAAA86.4631180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2161904GTTAAACTTAAAAAAAAAATTTTTTTTTTAAGTTTAAC0.970400.394500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1884-1906ATGTTAAACTTAAAAAAAAAAAAUUUUUUUUUUAAGUUUAACAUGUUAAACUUAAAAAAAAAAAAU-11.34.911


Target Position: 1484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1484GAUUUUUGUCUUGUGUUUC68.89321047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721502GATTTTTGTCTTGTGTTTCGAAACACAAGACAAAAATC0.466600.066900.508600.500001.000001.00000


Target Position: 567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
567ACCUCCUCUUUGUCAUCAC65.39041231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364585ACCTCCTCTTTGTCATCACGTGATGACAAAGAGGAGGT0.093800.059100.560300.500001.000001.00000


Target Position: 1448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1448GACUGACCAAUAUUGUACA94.413438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5761466GACTGACCAATATTGTACATGTACAATATTGGTCAGTC0.018800.001200.612100.500000.951100.62500


Target Position: 902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
902GUGGUUGUGUUCCAGUUUC67.28661150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
571920GTGGTTGTGTTCCAGTTTCGAAACTGGAACACAACCAC0.591100.001200.620700.500000.962000.62500


Target Position: 803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
803CCUGCCCUCCUGCUGACUA80.1352426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
343821CCTGCCCTCCTGCTGACTATAGTCAGCAGGAGGGCAGG0.082400.057400.672401.000000.923900.62500


Target Position: 1187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1187GCUUUCUUCCACUGUUGUC68.85071052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4251205GCTTTCTTCCACTGTTGTCGACAACAGTGGAAGAAAGC0.220000.049200.534500.750001.000001.00000


Target Position: 1324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1324ACAUUCAUCUGUUUCCACU76.9438569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5331342ACATTCATCTGTTTCCACTAGTGGAAACAGATGAATGT0.111900.057900.500000.500001.000001.00000


Target Position: 65, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
65AGCGUCUCAGUGCCCUUUU65.08341245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
23883AGCGTCTCAGTGCCCTTTTAAAAGGGCACTGAGACGCT0.188500.065200.853400.750000.923900.62500


Target Position: 558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
558CAGUGGCCGACCUCCUCUU76.8475578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
244576CAGTGGCCGACCTCCTCTTAAGAGGAGGTCGGCCACTG0.541300.022300.646600.750000.956500.62500


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204UCUGAACCCCAUCCUCUAU71.2839903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1451222TCTGAACCCCATCCTCTATATAGAGGATGGGGTTCAGA0.436200.226600.681000.750001.000001.00000


Target Position: 449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
449UACUCCAUCAUCUUCUUAA84.1459260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
566467TACTCCATCATCTTCTTAATTAAGAAGATGATGGAGTA0.680900.511000.646600.500001.000001.00000


Target Position: 608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
608GCCGUGGCAAACUGGUACU70.2038964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
409626GCCGTGGCAAACTGGTACTAGTACCAGTTTGCCACGGC0.068500.006700.793100.750001.000001.00000


Target Position: 1080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1080ACUACAUUGGGAUCAGCAU78.2402510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5651098ACTACATTGGGATCAGCATATGCTGATCCCAATGTAGT0.035800.001500.551700.750001.000001.00000


Target Position: 955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
955UGUCAUCCUGUCCUGCUAU75.87634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
315973TGTCATCCTGTCCTGCTATATAGCAGGACAGGATGACA0.095000.015200.663800.750001.000001.00000


Target Position: 1427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1427ACACAUUUUUCAGAUAUAA88.1129139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2001445ACACATTTTTCAGATATAATTATATCTGAAAAATGTGT0.174700.093700.672400.750001.000001.00000


Target Position: 343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
343AGAUAACUACACCGAGGAA93.178452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
385361AGATAACTACACCGAGGAATTCCTCGGTGTAGTTATCT0.179800.102200.551700.750000.962000.62500


Target Position: 613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
613GGCAAACUGGUACUUUGGG61.19211444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
574631GGCAAACTGGTACTTTGGGCCCAAAGTACCAGTTTGCC0.014100.003500.508600.500001.000001.00000


Target Position: 276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
276UGGGUUAAUGCUUGCUGAA79.2271463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
470294TGGGTTAATGCTTGCTGAATTCAGCAAGCATTAACCCA0.041600.007300.672400.750001.000001.00000


Target Position: 1257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1257AGCACGCACUCACCUCUGU72.2951847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5841275AGCACGCACTCACCTCTGTACAGAGGTGAGTGCGTGCT0.012000.004100.646600.500001.000001.00000


Target Position: 75, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
75UGCCCUUUUGUUCUAAACA73.033803

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
48593TGCCCTTTTGTTCTAAACATGTTTAGAACAAAAGGGCA0.036400.025100.646600.500001.000001.00000


Target Position: 1341, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1341CUGAGUCUGAGUCUUCAAG70.3064959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121359CTGAGTCTGAGTCTTCAAGCTTGAAGACTCAGACTCAG0.187900.005600.646600.500000.972800.62500


Target Position: 1044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1044UCCUCAUCCUGGCUUUCUU72.1167857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5491062TCCTCATCCTGGCTTTCTTAAGAAAGCCAGGATGAGGA0.018700.010300.732800.750000.994600.75000


Target Position: 904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
904GGUUGUGUUCCAGUUUCAG75.4906652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
575922GGTTGTGTTCCAGTTTCAGCTGAAACTGGAACACAACC0.181000.001200.569000.750001.000001.00000


Target Position: 403, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
403CCGUGAAGAAAAUGCUAAU85.397217

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_440319CCGTGAAGAAAATGCTAAT1/1/0/097.75CXCR4NM_001008540.1+NM_003467.21+1NANANA2:136873393..136873411(-)00CXCR4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
103421CCGTGAAGAAAATGCTAATATTAGCATTTTCTTCACGG0.449200.066100.905201.000001.000001.00000


Target Position: 1095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1095GCAUCGACUCCUUCAUCCU83.2061304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831113GCATCGACTCCTTCATCCTAGGATGAAGGAGTCGATGC0.094400.006900.508600.750000.951100.75000


Target Position: 798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
798GGAUCCCUGCCCUCCUGCU73.2231791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
458816GGATCCCTGCCCTCCTGCTAGCAGGAGGGCAGGGATCC0.106800.027600.517200.750000.951100.75000


Target Position: 1424, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1424GUUACACAUUUUUCAGAUA94.347539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3051442GTTACACATTTTTCAGATATATCTGAAAAATGTGTAAC0.198500.051700.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1422-1444AAGTTACACATTTTTCAGATATAUAUCUGAAAAAUGUGUAACUUGUUACACAUUUUUCAGAUAUAU20.420.422


Target Position: 1456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1456AAUAUUGUACAGUUUUUAU84.6568239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5781474AATATTGTACAGTTTTTATATAAAAACTGTACAATATT0.081900.006300.465500.500001.000001.00000


Target Position: 763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
763GCUGUUGGCUGAAAAGGUG72.5592828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
570781GCTGTTGGCTGAAAAGGTGCACCTTTTCAGCCAACAGC0.098200.001400.560300.750001.000001.00000


Target Position: 63, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
63UCAGCGUCUCAGUGCCCUU70.9044921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
32981TCAGCGTCTCAGTGCCCTTAAGGGCACTGAGACGCTGA0.193700.016500.586200.750000.902200.62500


Target Position: 1757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1757UGUAGAAGAUGGCACUUAU87.8603146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5621775TGTAGAAGATGGCACTTATATAAGTGCCATCTTCTACA0.016900.001900.663800.750001.000001.00000


Target Position: 1026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1026CCCUCAAGACCACAGUCAU85.4622215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3591044CCCTCAAGACCACAGTCATATGACTGTGGTCTTGAGGG0.078300.016600.836201.000000.934800.75000


Target Position: 819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819CUAUUCCCGACUUCAUCUU70.7415935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
424837CTATTCCCGACTTCATCTTAAGATGAAGTCGGGAATAG0.251700.171000.534500.750001.000001.00000


Target Position: 1866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1866AGUUGUUAAUAAAAGUACA92.287567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5831884AGTTGTTAATAAAAGTACATGTACTTTTATTAACAACT0.335500.001100.500000.500001.000001.00000


Target Position: 1587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1587CAAGUUCUUAGUUGCUGUA90.1814104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5801605CAAGTTCTTAGTTGCTGTATACAGCAACTAAGAACTTG0.021100.005300.465500.750001.000001.00000


Target Position: 1540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1540AAUUUUUUUUGUUUCAUAU81.175378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5771558AATTTTTTTTGTTTCATATATATGAAACAAAAAAAATT0.139700.075800.465500.500001.000001.00000


Target Position: 62, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
62CUCAGCGUCUCAGUGCCCU64.71561260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
58580CTCAGCGTCTCAGTGCCCTAGGGCACTGAGACGCTGAG0.162700.021300.465500.500000.902200.62500


Target Position: 69, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
69UCUCAGUGCCCUUUUGUUC57.81091572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
48887TCTCAGTGCCCTTTTGTTCGAACAAAAGGGCACTGAGA0.109700.044000.551700.500001.000001.00000


Target Position: 1347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1347CUGAGUCUUCAAGUUUUCA82.2845337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3691365CTGAGTCTTCAAGTTTTCATGAAAACTTGAAGACTCAG0.109500.018100.560300.500001.000001.00000


Target Position: 804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
804CUGCCCUCCUGCUGACUAU79.8669440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
329822CTGCCCTCCTGCTGACTATATAGTCAGCAGGAGGGCAG0.087200.054200.741400.750000.923900.62500


Target Position: 1045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1045CCUCAUCCUGGCUUUCUUC68.63561067

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041063CCTCATCCTGGCTTTCTTCGAAGAAAGCCAGGATGAGG0.029800.009200.672400.750001.000001.00000


Target Position: 642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
642GCAAGGCAGUCCAUGUCAU87.8407147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
562660GCAAGGCAGTCCATGTCATATGACATGGACTGCCTTGC0.126800.001600.698301.000000.923900.75000


Target Position: 688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
688CCUCAUCCUGGCCUUCAUC65.81341206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
328706CCTCATCCTGGCCTTCATCGATGAAGGCCAGGATGAGG0.088200.013900.663800.750001.000001.00000


Target Position: 505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
505GGGUUACCAGAAGAAACUG73.2044793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
525523GGGTTACCAGAAGAAACTGCAGTTTCTTCTGGTAACCC0.227600.002700.706900.750000.907600.62500


Target Position: 1070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1070UGGCUGCCUUACUACAUUG68.99871040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5741088TGGCTGCCTTACTACATTGCAATGTAGTAAGGCAGCCA0.062500.001200.698300.500000.994600.87500


Target Position: 1496, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1496GUGUUUCUUUAGUUUUUGU79.5706455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5711514GTGTTTCTTTAGTTTTTGTACAAAAACTAAAGAAACAC0.140400.095700.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1494-1516TTGTGTTTCTTTAGTTTTTGTGAACAAAAACUAAAGAAACACAAGUGUUUCUUUAGUUUUUGUGAU5.619.222


Target Position: 731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
731GUCCACGCCACCAACAGUC60.28141485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
519749GTCCACGCCACCAACAGTCGACTGTTGGTGGCGTGGAC0.142500.096500.500000.500001.000001.00000


Target Position: 1399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1399UAUACGAUAAAUAACUUUU75.6235645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5251417TATACGATAAATAACTTTTAAAAGTTATTTATCGTATA0.094900.027800.543100.500001.000001.00000


Target Position: 1689, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1689CUGUUUAUGCAUAGAUAAU86.2982186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1601707CTGTTTATGCATAGATAATATTATCTATGCATAAACAG0.312900.093900.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1687-1709AGCTGTTTATGCATAGATAATCTAUUAUCUAUGCAUAAACAGCUCUGUUUAUGCAUAGAUAAUCUU8.46.933


Target Position: 733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
733CCACGCCACCAACAGUCAG67.12921159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
476751CCACGCCACCAACAGTCAGCTGACTGTTGGTGGCGTGG0.039000.007200.560300.750001.000001.00000


Target Position: 817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
817GACUAUUCCCGACUUCAUC74.1979722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
406835GACTATTCCCGACTTCATCGATGAAGTCGGGAATAGTC0.214800.191900.637900.500001.000001.00000


Target Position: 438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
438UGCCCACCAUCUACUCCAU76.0754622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
285456TGCCCACCATCTACTCCATATGGAGTAGATGGTGGGCA0.355400.234700.698300.750001.000001.00000


Target Position: 912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
912UCCAGUUUCAGCACAUCAU72.0236864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
266930TCCAGTTTCAGCACATCATATGATGTGCTGAAACTGGA0.120900.068200.715500.750001.000001.00000


Target Position: 1891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1891ACUUAAAAAAAAAAAAAAA82.6239324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2091909ACTTAAAAAAAAAAAAAAATTTTTTTTTTTTTTTAAGT0.993900.428200.706900.750001.000001.00000


Target Position: 331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
331GAUAUACACUUCAGAUAAC85.329220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
423349GATATACACTTCAGATAACGTTATCTGAAGTGTATATC0.347100.239100.534500.500001.000001.00000


Target Position: 318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
318UGCCUCUUUUGCAGAUAUA81.1597380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
372336TGCCTCTTTTGCAGATATATATATCTGCAAAAGAGGCA0.084000.009200.810300.750000.967401.00000


Target Position: 410, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410GAAAAUGCUAAUUUCAAUA92.939658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
290428GAAAATGCTAATTTCAATATATTGAAATTAGCATTTTC0.489000.392300.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
408-430AAGAAAATGCTAATTTCAATAAAUAUUGAAAUUAGCAUUUUCUUGAAAAUGCUAAUUUCAAUAAAU7.414.022


Target Position: 1379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1379AGAUGUAAAAGACUUUUUU81.3183373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3021397AGATGTAAAAGACTTTTTTAAAAAAGTCTTTTACATCT0.101100.017100.724100.750001.000001.00000


Target Position: 1600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1600GCUGUAUGUCUCGUGGUAG75.1694670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431618GCTGTATGTCTCGTGGTAGCTACCACGAGACATACAGC0.020300.003700.681000.750001.000001.00000


Target Position: 224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
224AGAAAGCAAGCCUGAAUUG67.6121135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
552242AGAAAGCAAGCCTGAATTGCAATTCAGGCTTGCTTTCT0.018600.005800.577600.500001.000001.00000


Target Position: 566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
566GACCUCCUCUUUGUCAUCA82.7087318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
319584GACCTCCTCTTTGTCATCATGATGACAAAGAGGAGGTC0.103700.062900.594800.500001.000001.00000


Target Position: 1608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1608UCUCGUGGUAGGACUGUAG65.00191249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051626TCTCGTGGTAGGACTGTAGCTACAGTCCTACCACGAGA0.029800.004100.551700.500001.000001.00000


Target Position: 1664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1664ACGUAAAGCUAGAAAUGAU90.2635100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121682ACGTAAAGCTAGAAATGATATCATTTCTAGCTTTACGT0.228200.006600.594800.750001.000001.00000


Target Position: 95, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
95AGAAUUUUGUAAUUGGUUC67.42651145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
537113AGAATTTTGTAATTGGTTCGAACCAATTACAAAATTCT0.020900.009300.551700.500001.000001.00000


Target Position: 193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
193GCCCUUAGCCCACUACUUC67.97831113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
326211GCCCTTAGCCCACTACTTCGAAGTAGTGGGCTAAGGGC0.089700.069300.827600.750001.000001.00000


Target Position: 525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
525GAAGCAUGACGGACAAGUA102.7013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
533543GAAGCATGACGGACAAGTATACTTGTCCGTCATGCTTC0.067200.002700.491400.750001.000001.00000


Target Position: 1157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1157CACAAGUGGAUUUCCAUCA83.3931293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5811175CACAAGTGGATTTCCATCATGATGGAAATCCACTTGTG0.544700.001100.569000.500000.923900.87500


Target Position: 1748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1748UGAUUUUGCUGUAGAAGAU82.4718330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4751766TGATTTTGCTGTAGAAGATATCTTCTACAGCAAAATCA0.039800.014200.543100.750001.000001.00000


Target Position: 1777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1777ACCAAAGCCCAAAGUGGUA75.8913632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101795ACCAAAGCCCAAAGTGGTATACCACTTTGGGCTTTGGT0.059100.007200.672400.750000.940200.75000


Target Position: 1180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1180GGCCCUAGCUUUCUUCCAC72.3683840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2821198GGCCCTAGCTTTCTTCCACGTGGAAGAAAGCTAGGGCC0.154700.016700.706900.750001.000001.00000


Target Position: 1464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1464ACAGUUUUUAUUGCUUGUU64.38011280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3671482ACAGTTTTTATTGCTTGTTAACAAGCAATAAAAACTGT0.205100.030200.560300.750001.000001.00000


Target Position: 684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
684GUGUCCUCAUCCUGGCCUU76.0052625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506702GTGTCCTCATCCTGGCCTTAAGGCCAGGATGAGGACAC0.029600.003500.655200.750000.994601.00000


Target Position: 114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
114UACCAAAGAAGGAUAUAAU82.1037341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
446132TACCAAAGAAGGATATAATATTATATCCTTCTTTGGTA0.200000.012100.672400.500000.962000.75000


Target Position: 319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
319GCCUCUUUUGCAGAUAUAC69.6585994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342337GCCTCTTTTGCAGATATACGTATATCTGCAAAAGAGGC0.122400.011100.819000.750000.967400.87500


Target Position: 82, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
82UUGUUCUAAACAAAGAAUU61.23081439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
576100TTGTTCTAAACAAAGAATTAATTCTTTGTTTAGAACAA0.014000.004000.637900.500000.945700.62500


Target Position: 878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878CGCUUCUACCCCAAUGACU75.185667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
379896CGCTTCTACCCCAATGACTAGTCATTGGGGTAGAAGCG0.069800.046200.715500.750001.000001.00000


Target Position: 615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
615CAAACUGGUACUUUGGGAA88.0643140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
564633CAAACTGGTACTTTGGGAATTCCCAAAGTACCAGTTTG0.041700.003400.474100.750001.000001.00000


Target Position: 1093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1093CAGCAUCGACUCCUUCAUC74.5901696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5571111CAGCATCGACTCCTTCATCGATGAAGGAGTCGATGCTG0.051800.001700.603400.500000.945700.62500


Target Position: 1183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1183CCUAGCUUUCUUCCACUGU68.90791045

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2581201CCTAGCTTTCTTCCACTGTACAGTGGAAGAAAGCTAGG0.191000.021800.637900.750000.983700.62500


Target Position: 1289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1289AGCCUCAAGAUCCUCUCCA73.492768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451307AGCCTCAAGATCCTCTCCATGGAGAGGATCTTGAGGCT0.037700.006000.508600.500000.951100.62500


Target Position: 1417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1417UUUUUAAGUUACACAUUUU76.521598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991435TTTTTAAGTTACACATTTTAAAATGTGTAACTTAAAAA0.629900.109600.500000.500001.000001.00000


Target Position: 1155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1155UGCACAAGUGGAUUUCCAU78.767488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5851173TGCACAAGTGGATTTCCATATGGAAATCCACTTGTGCA0.049300.001100.698300.750000.923900.62500


Target Position: 29, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
29CAGAGGAGUUAGCCAAGAU91.608878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
53147CAGAGGAGTTAGCCAAGATATCTTGGCTAACTCCTCTG0.154500.002500.603400.750001.000001.00000


Target Position: 317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
317UUGCCUCUUUUGCAGAUAU70.8999922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
420335TTGCCTCTTTTGCAGATATATATCTGCAAAAGAGGCAA0.066900.006300.603400.500000.923900.62500


Target Position: 504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
504UGGGUUACCAGAAGAAACU67.22051155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
548522TGGGTTACCAGAAGAAACTAGTTTCTTCTGGTAACCCA0.230700.001800.637900.500000.978300.62500


Target Position: 702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
702UCAUCAGUCUGGACCGCUA86.6931176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
535720TCATCAGTCTGGACCGCTATAGCGGTCCAGACTGATGA0.021200.013100.551700.750000.913000.87500


Target Position: 1798, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1798GAAAUGCUGGUUUUUCAGU75.3136658

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1796-1818TAGAAATGCTGGTTTTTCAGTTTACUGAAAAACCAGCAUUUCUAGAAAUGCUGGUUUUUCAGUUUU12.218.522


Target Position: 396, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
396CCUGUUUCCGUGAAGAAAA85.5768209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
568414CCTGTTTCCGTGAAGAAAATTTTCTTCACGGAAACAGG0.145000.001500.844801.000000.945700.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
394-416ACCCTGTTTCCGTGAAGAAAATGUUUUCUUCACGGAAACAGGGUCCUGUUUCCGUGAAGAAAAUGU14.819.223


Target Position: 83, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
83UGUUCUAAACAAAGAAUUU78.6086494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
520101TGTTCTAAACAAAGAATTTAAATTCTTTGTTTAGAACA0.024100.004000.706900.750000.945700.62500


Target Position: 1462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1462GUACAGUUUUUAUUGCUUG74.5849697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4191480GTACAGTTTTTATTGCTTGCAAGCAATAAAAACTGTAC0.183500.014900.534500.500000.994600.62500


Target Position: 252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
252AUUGCUUUAAAAAUUUUUU66.19251190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
559270ATTGCTTTAAAAATTTTTTAAAAAATTTTTAAAGCAAT0.386600.030200.508600.500001.000001.00000


Target Position: 1367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1367UCCAGCUAACACAGAUGUA79.5486456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4261385TCCAGCTAACACAGATGTATACATCTGTGTTAGCTGGA0.053100.013600.689700.750001.000001.00000


Target Position: 115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
115ACCAAAGAAGGAUAUAAUG68.47891076

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
386133ACCAAAGAAGGATATAATGCATTATATCCTTCTTTGGT0.231400.022200.698300.500000.962000.75000


Target Position: 812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
812CUGCUGACUAUUCCCGACU67.73971129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
350830CTGCTGACTATTCCCGACTAGTCGGGAATAGTCAGCAG0.423400.051000.577600.500001.000001.00000


Target Position: 1831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1831UGAUUUCAGCACCUACAGU73.8572742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751849TGATTTCAGCACCTACAGTACTGTAGGTGCTGAAATCA0.014000.001700.517200.500000.972800.62500


Target Position: 645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
645AGGCAGUCCAUGUCAUCUA87.7751151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
335663AGGCAGTCCATGTCATCTATAGATGACATGGACTGCCT0.274400.011700.672400.750000.989100.75000


Target Position: 242, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
242GGUUUUUUAAAUUGCUUUA87.6062158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497260GGTTTTTTAAATTGCTTTATAAAGCAATTTAAAAAACC0.031200.004000.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
240-262TTGGTTTTTTAAATTGCTTTAAAUAAAGCAAUUUAAAAAACCAAGGUUUUUUAAAUUGCUUUAAAU18.6-1.811


Target Position: 1507, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1507GUUUUUGUGAAGUUUAAUU79.1995467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531525GTTTTTGTGAAGTTTAATTAATTAAACTTCACAAAAAC0.047000.007200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1505-1527TAGTTTTTGTGAAGTTTAATTGAAAUUAAACUUCACAAAAACUAGUUUUUGUGAAGUUUAAUUGAU-0.35.622


Target Position: 1254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1254CCCAGCACGCACUCACCUC64.45271276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4061272CCCAGCACGCACTCACCTCGAGGTGAGTGCGTGCTGGG0.205700.006800.681000.750000.983700.75000


Target Position: 967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
967CUGCUAUUGCAUUAUCAUC73.7701749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
436985CTGCTATTGCATTATCATCGATGATAATGCAATAGCAG0.621800.019600.603400.500000.907600.62500


Target Position: 1873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1873AAUAAAAGUACAUGUUAAA89.64113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5541891AATAAAAGTACATGTTAAATTTAACATGTACTTTTATT0.045800.002500.508600.500001.000001.00000


Target Position: 1392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1392UUUUUUUUAUACGAUAAAU69.18131028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5801410TTTTTTTTATACGATAAATATTTATCGTATAAAAAAAA0.221100.030200.491400.500001.000001.00000


Target Position: 1619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1619GACUGUAGAAAAGGGAACU77.3727553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411637GACTGTAGAAAAGGGAACTAGTTCCCTTTTCTACAGTC0.105000.006000.612100.500001.000001.00000


Target Position: 674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
674CUCUACAGCAGUGUCCUCA78.7884486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
547692CTCTACAGCAGTGTCCTCATGAGGACACTGCTGTAGAG0.019500.012500.586200.500001.000001.00000


Target Position: 1887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1887UUAAACUUAAAAAAAAAAA67.90871120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4181905TTAAACTTAAAAAAAAAAATTTTTTTTTTTAAGTTTAA0.973100.395400.534500.500001.000001.00000


Target Position: 810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
810UCCUGCUGACUAUUCCCGA69.29781022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
515828TCCTGCTGACTATTCCCGATCGGGAATAGTCAGCAGGA0.429800.051400.577600.500001.000001.00000


Target Position: 1759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1759UAGAAGAUGGCACUUAUAA83.7856275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5601777TAGAAGATGGCACTTATAATTATAAGTGCCATCTTCTA0.137200.001600.637900.500001.000001.00000


Target Position: 660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
660UCUACACAGUCAACCUCUA85.0038230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
399678TCTACACAGTCAACCTCTATAGAGGTTGACTGTGTAGA0.801600.383100.551700.750000.962000.62500


Target Position: 1081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1081CUACAUUGGGAUCAGCAUC67.66341130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5661099CTACATTGGGATCAGCATCGATGCTGATCCCAATGTAG0.056100.001500.491400.500000.989100.62500


Target Position: 727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
727CAUCGUCCACGCCACCAAC72.5896826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
469745CATCGTCCACGCCACCAACGTTGGTGGCGTGGACGATG0.228600.027000.508600.500000.983700.62500


Target Position: 572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
572CUCUUUGUCAUCACGCUUC63.63621325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
429590CTCTTTGTCATCACGCTTCGAAGCGTGATGACAAAGAG0.064000.038100.637900.500001.000001.00000


Target Position: 669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
669UCAACCUCUACAGCAGUGU55.32821655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
557687TCAACCTCTACAGCAGTGTACACTGCTGTAGAGGTTGA0.017400.016100.517200.500001.000001.00000


Target Position: 1320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1320GUGGACAUUCAUCUGUUUC66.8521167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5651338GTGGACATTCATCTGTTTCGAAACAGATGAATGTCCAC0.218500.003200.620700.500000.983700.87500


Target Position: 327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
327UGCAGAUAUACACUUCAGA80.1529425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
318345TGCAGATATACACTTCAGATCTGAAGTGTATATCTGCA0.282300.048200.629300.500001.000001.00000


Target Position: 345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
345AUAACUACACCGAGGAAAU76.9521566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
422363ATAACTACACCGAGGAAATATTTCCTCGGTGTAGTTAT0.238000.119400.534500.500001.000001.00000


Target Position: 1625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1625AGAAAAGGGAACUGAACAU81.0529383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3631643AGAAAAGGGAACTGAACATATGTTCAGTTCCCTTTTCT0.101800.012300.569000.750001.000001.00000


Target Position: 1879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1879AGUACAUGUUAAACUUAAA96.833418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4511897AGTACATGTTAAACTTAAATTTAAGTTTAACATGTACT0.425200.005000.706900.750001.000001.00000


Target Position: 384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
384CCAUGAAGGAACCCUGUUU80.5158408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
580402CCATGAAGGAACCCTGTTTAAACAGGGTTCCTTCATGG0.060400.001100.844801.000000.994601.00000


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778GGUGGUCUAUGUUGGCGUC75.1818668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
586796GGTGGTCTATGTTGGCGTCGACGCCAACATAGACCACC0.122800.001000.534500.750001.000001.00000


Target Position: 638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
638CUAUGCAAGGCAGUCCAUG64.02771303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
582656CTATGCAAGGCAGTCCATGCATGGACTGCCTTGCATAG0.033500.001100.517200.500000.962000.62500


Target Position: 415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
415UGCUAAUUUCAAUAAAAUC68.44721079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
425433TGCTAATTTCAATAAAATCGATTTTATTGAAATTAGCA0.361600.165400.672400.500001.000001.00000


Target Position: 1516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1516AAGUUUAAUUGACUUAUUU82.5602325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921534AAGTTTAATTGACTTATTTAAATAAGTCAATTAAACTT0.061500.017200.637900.500001.000001.00000


Target Position: 71, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
71UCAGUGCCCUUUUGUUCUA76.1576617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
38789TCAGTGCCCTTTTGTTCTATAGAACAAAAGGGCACTGA0.095100.048100.551700.750001.000001.00000


Target Position: 1522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1522AAUUGACUUAUUUAUAUAA95.10132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5741540AATTGACTTATTTATATAATTATATAAATAAGTCAATT0.201600.030400.474100.500001.000001.00000


Target Position: 1839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1839GCACCUACAGUGUACAGUC80.0735427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5791857GCACCTACAGTGTACAGTCGACTGTACACTGTAGGTGC0.086800.001100.534500.750000.913000.62500


Target Position: 174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
174UCUACAUUAAUUCUCUUGU65.8311205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
450192TCTACATTAATTCTCTTGTACAAGAGAATTAATGTAGA0.080800.025100.517200.500001.000001.00000


Target Position: 1818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1818UUCAGGAGUGGGUUGAUUU69.08441036

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5671836TTCAGGAGTGGGTTGATTTAAATCAACCCACTCCTGAA0.016300.009700.672400.500001.000001.00000


Target Position: 1843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1843CUACAGUGUACAGUCUUGU73.1878795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5741861CTACAGTGTACAGTCTTGTACAAGACTGTACACTGTAG0.037700.002600.465500.500001.000001.00000


Target Position: 1614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1614GGUAGGACUGUAGAAAAGG68.17971098

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5611632GGTAGGACTGTAGAAAAGGCCTTTTCTACAGTCCTACC0.052800.001600.508600.500001.000001.00000


Target Position: 402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
402UCCGUGAAGAAAAUGCUAA75.2225665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
286420TCCGTGAAGAAAATGCTAATTAGCATTTTCTTCACGGA0.474800.076500.836200.750001.000001.00000


Target Position: 1479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1479UGUUGGAUUUUUGUCUUGU68.41611084

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921497TGTTGGATTTTTGTCTTGTACAAGACAAAAATCCAACA0.122500.056000.500000.500001.000001.00000


Target Position: 1498, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1498GUUUCUUUAGUUUUUGUGA81.868349

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1496-1518GTGTTTCTTTAGTTTTTGTGAAGUCACAAAAACUAAAGAAACACGUUUCUUUAGUUUUUGUGAAGU12.25.512


Target Position: 1423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1423AGUUACACAUUUUUCAGAU83.3156299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4451441AGTTACACATTTTTCAGATATCTGAAAAATGTGTAACT0.214700.034100.525900.750001.000001.00000


Target Position: 770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
770GCUGAAAAGGUGGUCUAUG71.3789897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
535788GCTGAAAAGGTGGTCTATGCATAGACCACCTTTTCAGC0.060300.002400.698300.750001.000001.00000


Target Position: 1202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1202UGUCUGAACCCCAUCCUCU73.2642784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5521220TGTCTGAACCCCATCCTCTAGAGGATGGGGTTCAGACA0.457000.240400.482800.500000.972800.75000


Target Position: 1784, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1784CCCAAAGUGGUAUAGAAAU80.1929424

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7178419CCCAAAGTGGTATAGAAAT1/1/0/097.75CXCR4NM_001008540.1+NM_003467.21+1NANANA2:136872012..136872030(-)00CXCR4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5091802CCCAAAGTGGTATAGAAATATTTCTATACCACTTTGGG0.044500.003100.982801.000000.940200.62500


Target Position: 170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
170GGAUUCUACAUUAAUUCUC72.6786820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
373188GGATTCTACATTAATTCTCGAGAATTAATGTAGAATCC0.222700.032500.560300.750001.000001.00000


Target Position: 1894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1894UAAAAAAAAAAAAAAAAAA80.6168405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611912TAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTA0.996500.970200.534500.500001.000001.00000


Target Position: 28, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
28GCAGAGGAGUUAGCCAAGA80.7776399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
56946GCAGAGGAGTTAGCCAAGATCTTGGCTAACTCCTCTGC0.087000.001400.629300.750001.000001.00000


Target Position: 411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
411AAAAUGCUAAUUUCAAUAA83.3802294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
583429AAAATGCTAATTTCAATAATTATTGAAATTAGCATTTT0.497500.405000.465500.500001.000001.00000


Target Position: 685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
685UGUCCUCAUCCUGGCCUUC54.13831702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
496703TGTCCTCATCCTGGCCTTCGAAGGCCAGGATGAGGACA0.031300.013100.534500.500000.994600.87500


Target Position: 344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
344GAUAACUACACCGAGGAAA83.7262279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
235362GATAACTACACCGAGGAAATTTCCTCGGTGTAGTTATC0.190100.109700.681000.750001.000001.00000


Target Position: 1771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1771CUUAUAACCAAAGCCCAAA78.6641492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2531789CTTATAACCAAAGCCCAAATTTGGGCTTTGGTTATAAG0.446900.039000.637900.750001.000001.00000


Target Position: 693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
693UCCUGGCCUUCAUCAGUCU68.06191108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471711TCCTGGCCTTCATCAGTCTAGACTGATGAAGGCCAGGA0.041100.005600.646600.500000.902200.62500


Target Position: 47, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
47UGUGACUUUGAAACCCUCA73.8178745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
56065TGTGACTTTGAAACCCTCATGAGGGTTTCAAAGTCACA0.081100.017400.482800.500001.000001.00000


Target Position: 413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
413AAUGCUAAUUUCAAUAAAA93.593847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
476431AATGCTAATTTCAATAAAATTTTATTGAAATTAGCATT0.778800.427100.508600.500001.000001.00000


Target Position: 1452, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1452GACCAAUAUUGUACAGUUU90.777490

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1450-1472CTGACCAATATTGTACAGTTTTTAAACUGUACAAUAUUGGUCAGGACCAAUAUUGUACAGUUUUUU19.020.022


Target Position: 1676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1676AAAUGAUCCCCAGCUGUUU73.3679776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5551694AAATGATCCCCAGCTGTTTAAACAGCTGGGGATCATTT0.018000.007400.500000.500001.000001.00000


Target Position: 968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
968UGCUAUUGCAUUAUCAUCU72.7602817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
530986TGCTATTGCATTATCATCTAGATGATAATGCAATAGCA0.612800.032000.629300.500000.934800.62500


Target Position: 1137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1137GUGAGUUUGAGAACACUGU76.1225620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3501155GTGAGTTTGAGAACACTGTACAGTGTTCTCAAACTCAC0.082000.010300.586200.500000.978300.62500


Target Position: 1494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1494UUGUGUUUCUUUAGUUUUU68.34931090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5531512TTGTGTTTCTTTAGTTTTTAAAAACTAAAGAAACACAA0.163900.123900.646600.500001.000001.00000


Target Position: 1586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1586CCAAGUUCUUAGUUGCUGU82.0234343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411604CCAAGTTCTTAGTTGCTGTACAGCAACTAAGAACTTGG0.020400.006000.637900.750001.000001.00000


Target Position: 1382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1382UGUAAAAGACUUUUUUUUA85.0017231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2951400TGTAAAAGACTTTTTTTTATAAAAAAAAGTCTTTTACA0.122300.022800.672400.750001.000001.00000


Target Position: 1477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1477CUUGUUGGAUUUUUGUCUU76.9116570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301495CTTGTTGGATTTTTGTCTTAAGACAAAAATCCAACAAG0.119100.056700.500000.750001.000001.00000


Target Position: 1338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1338CCACUGAGUCUGAGUCUUC76.3867607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3861356CCACTGAGTCTGAGTCTTCGAAGACTCAGACTCAGTGG0.079000.007900.672400.750001.000001.00000


Target Position: 1553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1553UCAUAUUGAUGUGUGUCUA84.8747234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5861571TCATATTGATGTGTGTCTATAGACACACATCAATATGA0.011700.004700.551700.750001.000001.00000


Target Position: 1168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1168UUCCAUCACCGAGGCCCUA62.50121379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951186TTCCATCACCGAGGCCCTATAGGGCCTCGGTGATGGAA0.033200.009400.500000.500000.934800.75000


Target Position: 948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
948CUGGUAUUGUCAUCCUGUC71.4848892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
584966CTGGTATTGTCATCCTGTCGACAGGATGACAATACCAG0.128200.012600.465500.500000.978300.75000


Target Position: 1443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1443UAAAAGACUGACCAAUAUU77.2412556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001461TAAAAGACTGACCAATATTAATATTGGTCAGTCTTTTA0.079400.004900.525900.500001.000001.00000


Target Position: 1677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1677AAUGAUCCCCAGCUGUUUA83.7973274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5631695AATGATCCCCAGCTGTTTATAAACAGCTGGGGATCATT0.022500.007600.474100.500001.000001.00000


Target Position: 1612, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1612GUGGUAGGACUGUAGAAAA96.070826

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6161219GTGGTAGGACTGTAGAAAA1/1/0/097.75CXCR4NM_001008540.1+NM_003467.21+1NANANA2:136872184..136872202(-)00CXCR4(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3551630GTGGTAGGACTGTAGAAAATTTTCTACAGTCCTACCAC0.164500.009800.793100.750001.000001.00000


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975GCAUUAUCAUCUCCAAGCU84.3305254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
496993GCATTATCATCTCCAAGCTAGCTTGGAGATGATAATGC0.613100.406900.500000.750001.000001.00000


Target Position: 1469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1469UUUUAUUGCUUGUUGGAUU69.7673988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5381487TTTTATTGCTTGTTGGATTAATCCAACAAGCAATAAAA0.164100.022500.491400.500001.000001.00000


Target Position: 873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
873GUGACCGCUUCUACCCCAA81.0253386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
255891GTGACCGCTTCTACCCCAATTGGGGTAGAAGCGGTCAC0.126900.039000.646600.750001.000001.00000


Target Position: 961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
961CCUGUCCUGCUAUUGCAUU74.2612715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
392979CCTGTCCTGCTATTGCATTAATGCAATAGCAGGACAGG0.071100.007600.836201.000000.907600.75000


Target Position: 1845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1845ACAGUGUACAGUCUUGUAU78.1677515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5801863ACAGTGTACAGTCTTGTATATACAAGACTGTACACTGT0.013000.008000.663800.750000.967400.62500


Target Position: 1209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1209ACCCCAUCCUCUAUGCUUU75.3233657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2081227ACCCCATCCTCTATGCTTTAAAGCATAGAGGATGGGGT0.164300.107700.853400.750001.000001.00000


Target Position: 88, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
88UAAACAAAGAAUUUUGUAA83.9496266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
523106TAAACAAAGAATTTTGTAATTACAAAATTCTTTGTTTA0.199400.006500.500000.500000.945700.62500


Target Position: 942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
942UCCUGCCUGGUAUUGUCAU65.39621230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
511960TCCTGCCTGGTATTGTCATATGACAATACCAGGCAGGA0.082800.003100.715500.750000.989100.75000


Target Position: 1323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1323GACAUUCAUCUGUUUCCAC76.8465579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5371341GACATTCATCTGTTTCCACGTGGAAACAGATGAATGTC0.150500.073000.525900.500000.983700.62500


Target Position: 956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
956GUCAUCCUGUCCUGCUAUU76.4152602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
422974GTCATCCTGTCCTGCTATTAATAGCAGGACAGGATGAC0.054200.016900.810300.750001.000001.00000


Target Position: 1389, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1389GACUUUUUUUUAUACGAUA95.078433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2401407GACTTTTTTTTATACGATATATCGTATAAAAAAAAGTC0.143000.071400.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1387-1409AAGACTTTTTTTTATACGATAAAUAUCGUAUAAAAAAAAGUCUUGACUUUUUUUUAUACGAUAAAU16.43.222


Target Position: 687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
687UCCUCAUCCUGGCCUUCAU72.1788853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
305705TCCTCATCCTGGCCTTCATATGAAGGCCAGGATGAGGA0.360500.014100.715500.750000.994600.75000


Target Position: 1227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1227UCCUUGGAGCCAAAUUUAA74.7753690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411245TCCTTGGAGCCAAATTTAATTAAATTTGGCTCCAAGGA0.890300.005600.836200.750001.000001.00000


Target Position: 404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
404CGUGAAGAAAAUGCUAAUU78.0551523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
126422CGTGAAGAAAATGCTAATTAATTAGCATTTTCTTCACG0.416900.056200.767201.000001.000001.00000


Target Position: 1027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1027CCUCAAGACCACAGUCAUC75.7716638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3211045CCTCAAGACCACAGTCATCGATGACTGTGGTCTTGAGG0.092500.035900.663800.750000.934800.87500


Target Position: 607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
607UGCCGUGGCAAACUGGUAC55.94161637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
517625TGCCGTGGCAAACTGGTACGTACCAGTTTGCCACGGCA0.067600.002900.672400.500000.918500.62500


Target Position: 1099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1099CGACUCCUUCAUCCUCCUG67.25861152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5651117CGACTCCTTCATCCTCCTGCAGGAGGATGAAGGAGTCG0.016500.003400.508600.750000.951100.62500


Target Position: 459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
459UCUUCUUAACUGGCAUUGU63.79691316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
550477TCTTCTTAACTGGCATTGTACAATGCCAGTTAAGAAGA0.018700.016400.517200.500001.000001.00000


Target Position: 1518, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1518GUUUAAUUGACUUAUUUAU85.197226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3021536GTTTAATTGACTTATTTATATAAATAAGTCAATTAAAC0.185600.024700.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1516-1538AAGTTTAATTGACTTATTTATATAUAAAUAAGUCAAUUAAACUUGUUUAAUUGACUUAUUUAUAUU-7.5-9.722


Target Position: 667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667AGUCAACCUCUACAGCAGU75.6323643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501685AGTCAACCTCTACAGCAGTACTGCTGTAGAGGTTGACT0.046000.039600.500000.500001.000001.00000


Target Position: 1369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1369CAGCUAACACAGAUGUAAA102.0854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771387CAGCTAACACAGATGTAAATTTACATCTGTGTTAGCTG0.037900.022700.784500.750001.000001.00000


Target Position: 1401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1401UACGAUAAAUAACUUUUUU74.5403699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3811419TACGATAAATAACTTTTTTAAAAAAGTTATTTATCGTA0.068800.066700.681000.500001.000001.00000


Target Position: 441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
441CCACCAUCUACUCCAUCAU83.0075311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
138459CCACCATCTACTCCATCATATGATGGAGTAGATGGTGG0.579400.291200.689701.000001.000001.00000


Target Position: 909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
909UGUUCCAGUUUCAGCACAU78.2279511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
389927TGTTCCAGTTTCAGCACATATGTGCTGAAACTGGAACA0.156700.042500.551700.750001.000001.00000


Target Position: 1617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1617AGGACUGUAGAAAAGGGAA85.2479223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121635AGGACTGTAGAAAAGGGAATTCCCTTTTCTACAGTCCT0.110100.003100.672400.750001.000001.00000


Target Position: 1413, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413CUUUUUUUUAAGUUACACA84.5608243

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1411-1433AACTTTTTTTTAAGTTACACATTUGUGUAACUUAAAAAAAAGUUCUUUUUUUUAAGUUACACAUUU21.5-11.322


Target Position: 275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
275CUGGGUUAAUGCUUGCUGA85.597208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
568293CTGGGTTAATGCTTGCTGATCAGCAAGCATTAACCCAG0.043200.006400.560300.500001.000001.00000


Target Position: 1611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1611CGUGGUAGGACUGUAGAAA90.71894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3771629CGTGGTAGGACTGTAGAAATTTCTACAGTCCTACCACG0.119700.009000.775901.000001.000001.00000


Target Position: 1842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1842CCUACAGUGUACAGUCUUG80.2746421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5021860CCTACAGTGTACAGTCTTGCAAGACTGTACACTGTAGG0.048600.003200.698300.750001.000001.00000


Target Position: 561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
561UGGCCGACCUCCUCUUUGU68.0951105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
409579TGGCCGACCTCCTCTTTGTACAAAGAGGAGGTCGGCCA0.225300.029200.637900.500000.983700.75000


Target Position: 771, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771CUGAAAAGGUGGUCUAUGU81.3373372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
455789CTGAAAAGGTGGTCTATGTACATAGACCACCTTTTCAG0.047400.008100.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
769-791GGCTGAAAAGGTGGTCTATGTTGACAUAGACCACCUUUUCAGCCCUGAAAAGGUGGUCUAUGUUGU20.312.212


Target Position: 818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
818ACUAUUCCCGACUUCAUCU73.1248800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
557836ACTATTCCCGACTTCATCTAGATGAAGTCGGGAATAGT0.360700.179100.482800.500001.000001.00000


Target Position: 320, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
320CCUCUUUUGCAGAUAUACA91.123783

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
318-340TGCCTCTTTTGCAGATATACACTUGUAUAUCUGCAAAAGAGGCACCUCUUUUGCAGAUAUACACUU11.210.323


Target Position: 1349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1349GAGUCUUCAAGUUUUCACU84.5111245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671367GAGTCTTCAAGTTTTCACTAGTGAAAACTTGAAGACTC0.096500.023100.603400.500001.000001.00000